Next Article in Journal
The Aryl Hydrocarbon Receptor (AHR): Peacekeeper of the Skin
Previous Article in Journal
Synthesis and Evaluation of Aromatic A-Ring 23-Oxavitamin D3 Analogues as Hedgehog Pathway Inhibitors
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics

National Key Laboratory of Intelligent Tracking and Forecasting for Infectious Diseases, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(4), 1632; https://doi.org/10.3390/ijms26041632
Submission received: 19 December 2024 / Revised: 2 February 2025 / Accepted: 9 February 2025 / Published: 14 February 2025
(This article belongs to the Section Molecular Biophysics)

Abstract

The abuse of antibiotics has led to widespread resistance to Helicobacter pylori (H. pylori) in the population. There is an urgent need to establish a method to detect multiple antibiotic resistance rapidly. This study aimed to construct a novel strategy for the high-throughput detection of H. pylori’s resistance to varying antibiotics using multiplex PCR–mass spectrometry mini-sequencing (mPCR-MS mini-sequencing) technology. This study detected the resistance of H. pylori to six antibiotics using eight mutated sites (23S rRNA-2143; pbp1A-1667, 1684, 1240; gyrA-261, 271, 573; and 16S rRNA-928) of four resistance genes (pbp1A, gyrA, 23S rRNA, and 16S rRNA), and 525 were detected in all 528 results (99.43%). Then, the culture-based phenotypic drug susceptibility testing (DST) method was used as a reference for drug resistance detection. We found that the consistency rate between mPCR-MS mini-sequencing with the DST results of amoxicillin (AMX), moxifloxacin (MOX), levofloxacin (LEV), clarithromycin (CLA), azithromycin (AZI), and tetracycline (TET) were 95.5% (63/66), 77.3% (51/66), 68.2% (45/66), 93.9% (62/66), 92.4% (61/66), and 97.0% (64/66), respectively. This method was high-throughput and extensible, easily improving the entire detection system by adding new mutation sites. mPCR-MS mini-sequencing technology provides a new approach to mutation sites related to H. pylori’s antibiotic resistance.

1. Introduction

Helicobacter pylori (H. pylori), a Gram-negative bacillus, infects about 50% of the world’s population, approximately 4.4 billion individuals [1]. H. pylori infection often does not cause any symptoms, and about 1–10% of infected patients develop clinical symptoms, including peptic ulcer disease, gastric atrophy, gastric intestinal metaplasia, and ultimately, gastric cancer or mucosa-associated lymphoid tissue (MALT) lymphoma [2]. H. pylori is a potent carcinogen, and the eradication of H. pylori infection has shown positive effects in decreasing the risk of gastric cancer.
There are certain difficulties in eradicating H. pylori associated with its treatment, and a single antibiotic cannot achieve a therapeutic effect. The approach for treating H. pylori infection diverges considerably from treatment protocols used for other infectious diseases. Eliminating H. pylori necessitates a meticulous blend of multiple medications, primarily antibiotics and acid inhibitors, as the cornerstone regimen. The choice between quadruple and triple therapy as initial treatment hinges critically on the clarithromycin resistance rate exceeding 15% [3,4]. In cases where the initial treatment proves unsuccessful, alternative therapeutic avenues are evaluated [5].
Regrettably, the effectiveness of empirical therapy has been declining, primarily owing to the escalating antimicrobial resistance and the shifting epidemiological landscape. Notably, antimicrobial resistance has emerged as one of the foremost contributors to treatment ineffectiveness [6]. Specifically, the treatment of H. pylori should consider local and individual antibiotic resistance patterns. Moreover, it is essential to conduct antimicrobial resistance surveillance through bacterial culture or molecular methods to determine the most effective therapy for managing H. pylori infection [7]. Due to the difficulty and inconsistent success in isolating H. pylori from gastric biopsy samples, bacterial culture for antibiotic resistance is not always feasible [8].
Combination therapy for H. pylori includes proton pump inhibitors (PPIs) and gastric mucosal protectors with one or two antibiotics to form triple or quadruple therapy. Moreover, a few antibiotics, such as amoxicillin (AMX), moxifloxacin (MOX), levofloxacin (LEV), clarithromycin (CLA), azithromycin (AZI), and tetracycline (TET), and metronidazole (MET), effectively eradicate H. pylori [7]. These antibiotics are widely used in the population, increasing antibiotic resistance yearly [2,9]. Therefore, it is necessary to detect antibiotic resistance rapidly, which is conducive to precision medication to improve the eradication rate.
The reference method for detecting H. pylori resistance is still solid culture-based drug susceptibility testing (DST). DST has limitations because H. pylori is a slow-growing microaerobic bacteria, and which requires a relatively long time to identify multiple antibiotics [10]. The DST method includes agar dilution, gradient strip diffusion, disk diffusion, and broth microdilution testing. Agar dilution as the reference method for H. pylori susceptibility testing is time-consuming, labor-intensive, and expensive. Other DST methods have many limitations; the inoculum density, medium used, antibiotic disk content, incubation conditions, and zone diameter measurement criteria may contribute to variability [11]. Several molecular assays provide the possibility of rapid detection of antibiotic resistance. Whole genome sequencing (WGS) provides more comprehensive drug resistance information, but it is expensive and difficult to perform in many laboratories due to a lack of resources and expertise. Polymerase chain reaction (PCR) and quantitative PCR (qPCR) have poor coverage of different antibiotics and are mostly used to detect a few key antibiotic resistance genes. Molecular assays currently used in clinical practice include CLA and LEV [12,13,14]. Multisite detection methods of antibiotic resistance are urgently needed.
In recent decades, studies have demonstrated that a multitude of drug resistance mechanisms are associated with the emergence of antibiotic resistance in H. pylori, with genetic mutations playing a prominent role among them [6,15,16]. Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) has shown great potential in nucleic acid detection and analysis, and it has been used in the study of single nucleotide polymorphisms (SNPs), gene mutations, deoxyribonucleic acid (DNA) methylation, and DNA copy number variation. The basic process is as follows: amplifying the template DNA through multiplex PCR and performing single-base extension after shrimp alkaline phosphatase (SAP) treatment. MALDI-TOF MS is performed to identify the increase in mass-to-charge ratio (m/z) after single-base extension. To understand and distinguish it from other mass spectrometry techniques, our group named this technique of detecting SNPs by multiplex PCR coupled with MALDI-TOF MS ‘multiplex PCR–mass spectrometry mini-sequencing (mPCR-MS mini-sequencing) technology’ [17]. This detection method has been widely used in typing and identifying pathogenic microorganisms, drug resistance detection, and drug susceptibility [17,18,19].
In this study, using mPCR-MS mini-sequencing technology, a sixfold PCR system was constructed to detect the resistance to six antibiotics used to eradicate H. pylori. The reliability of the detection method was evaluated in 66 strains.

2. Results

2.1. Establishment and Optimization of mPCR-MS Mini-Sequencing Technology

The eight target sites were amplified using six-fold PCR. The m/z of the mass probe extension (MPE) original peaks for eight mutation types (HP AP1a/b, HP AP2a/b, HP AP3, HP AP4, HP AP5a/b, HP BP3, HP BP4, and HP BP6) were 5251.4 ± 3, 5413.6 ± 3, 5777.8 ± 3, 5858.8 ± 3, 6407.2 ± 3, 5807.8 ± 3, 6031.0 ± 3, and 6756.4 ± 3 (Table 1), respectively (mass error less than 500 ppm, the same below). We established the method using the WGS strains numbered ICDC 31109 and ICDC 31116; the A-tube extension results of 31109 and 31116 strains were detected by mass spectrometry at 5524.4 ± 3, 5710.6 ± 3, 6074.8 ± 3, 6171.8 ± 3, and 6749.2 ± 3, and the extension bases were C, A, T, G, and A. The B-tube extension results of the 31109 and 31116 strains were 6104.8, 6373.0, and 7098.4, and the extension bases were A, T, and A. The results were consistent with the WGS results. There were no MS peaks in the blank tube, which was used to replace the template DNA with DNase-free water during PCR amplification. The mass spectrometry result also showed non-extension in the negative control tube, replacing the SAP product with DNase-free water during the MPE reaction (Table 1 and Table 2, Figure 1).
After optimization, the final concentrations of the eight MPEs were 7.14 μM (HP AP1a/b), 7.44 μM (HP AP2a/b), 8.06 μM (HP AP3), 8.19 μM (HP AP4), 9.05 μM (HP AP5a/b), 8.11 μM (HP BP3), 8.47 μM (HP BP4), and 9.56 μM (HP BP6).

2.2. Antibiotic Susceptibility Testing of H. pylori Strains

We assessed the antimicrobial susceptibility of 66 H. pylori strains to six antibiotics, AMX, LEV, MOX, CLA, AZI, and TET. The clinical breakpoints of each antibiotic were as follows: AMX, 1 mg/L, LEV, 1 mg/L, MOX, 1 mg/L, CLA, 1 mg/L, AZI, 1 mg/L, and TET, 4 mg/L. We judged whether resistance (R) and susceptibility (S) were based on the clinical breakpoints of each antibiotic. We found that 0% of all strains were resistant to AMX (0/66), 84.8% were resistant to LEV (56/66), 100% were resistant to MOX (66/66), 62.1% were resistant to CLA (41/66), 63.6% were resistant to AZI (42/66), and 0.45% were resistant to TET (3/66) (Figure 2, Table 3).

2.3. Eight Mutation Sites of Sixty-Six Strains Were Detected by mPCR-MS Mini-Sequencing Technology

Eight mutation sites were detected among the 66 H. pylori strains, and 525 were detected in all 528 mutation sites (99.43%). The detection rate of three mutation sites—the penicillin-binding proteins (pbp1A)-A1240C, C1667G, and A1684T of AMX—was 95.5% (63/66). The mutation rate of A1684T of pbp1A was 4.5% (3/66). There were three mutation sites—DNA gyrase subunit A (gyrA)-C261TAG, G271AT, and T573GC of LEV and MOX—with a 100% (66/66) detection rate. There was a 77.3% (51/66) mutation rate of gyrA. The most common mutation was C261TAG, present in 75.8% (50/66), the second-most common was G271AT, present in 24.2% (16/66), and the last one was T573GC, present in 1.5% (1/66). One mutation site, 23S ribosomal ribonucleic acid (rRNA)-A2143G, was tested for CLA and AZI, which had a 100% (66/66) detection rate and a 56.1% (37/66) mutation rate of 23S rRNA. A928C of 16S rRNA had a 100% (66/66) detection rate for testing the resistance of TET; only one mutation was detected in the 66 strains (1.5%) (Figure 3, Table 4).
The mass spectrometry test results showed bimodal peaks at four sites of eight strains (Table 4). These sites were compared using PCR combined with Sanger sequencing, and the sequencing results were bimodal: site 271 in strains 11050, 11091, and 12104; site 261 in strains 11091, 11085, 12057, 22090, 12104, and 31123; site 1684 in strain 11039; and site 2143 in strain 11050 (Table 4, Figure S1).

2.4. Consistency Rate of DST and mPCR-MS Mini-Sequencing Technology

DST methods were the reference for drug resistance detection in this study. Our paper detected the resistance of 66 strains to six antibiotics through DST and mass spectrometry detection of mutations. The consistency rate is [(true positive rate + true negative rate)/total number of tests × 100%]. These results suggest that the consistency rates of mass spectrometry detection of mutations with MICs of AMX, MOX, LEV, CLA, AZI, and TET were 95.5% (63/66), 77.3% (51/66), 68.2% (45/66), 93.9% (62/66), 92.4% (61/66), 97.0% (64/66), respectively (Table 5).

3. Discussion

In this endeavor, we devised mPCR-MS mini-sequencing technology that concurrently identifies resistance loci for six crucial drugs (AMX, MOX, LEV, CLA, AZI, and TET), and we judged drug resistance on the basis of mutational signatures within patient samples. Our method underwent rigorous validation, comparing the mutational profiles of these resistance sites with DST outcomes; notably, for AMX, MOX, LEV, CLA, AZI, and TET, the concordance between this molecular approach and DST result ranged from 68.2% to 97.0%. These results underscore the reliability and accuracy of our innovative detection strategy. The consistency rate of these two methods of AMX, CLA, AZI, and TET drug resistance detection was higher (95.5%, 93.9%, 92.4%, and 97.0% respectively). Among them, mPCR-MS mini-sequencing technology detected fewer strains containing AMX and TET resistance-related mutations (3/66 and 1/66, respectively), which was more in line with the low AMX and TET drug resistance rates in the clinical context [8]. At the same time, mPCR-MS mini-sequencing technology detected the presence of CLA and AZI resistance-related mutations (37/66) in multiple strains, which was more in line with the results of the current high clinical CLA drug resistance rate [8]. MPCR-MS mini-sequencing technology provides a novel strategy to detect resistance in patients to AMX, CLA, AZI, and TET. The detection method we constructed had a lower consistency rate regarding the DST results of MOX and LEV (77.3% and 68.2%, respectively), and the system needs to be further optimized.
In this study, no drug resistance was detected to the MIC of AMX by DST, but three isolates were detected by mPCR-MS mini-sequencing technology with mutations. Among them, the 11039 strain was identified with site 1684 as AT, and the other two strains, 12104 and 11022, were detected as T. According to the Sanger sequencing and mPCR-MS mini-sequencing results, it was determined to be an AMX-mutant strain, but these MIC results were sensitive. These three sites—1240, 1667, and 1684—represented the amino acid sites 414, 556, and 562 of pbp1A. According to previous research, several amino acid variations in or adjacent to the second and third conserved penicillin-binding protein motifs (PBM) could mediate AMX resistance in H. pylori [20,21]. Hence, 414 (site 1240, adjacent to the second PBM) and 556 (site 1667, located in the third PBM) mutations represented the major factors in resistance. Our results indicated that the three strains, which possessed only site 1684 mutations, were insufficient to induce amoxicillin resistance. In addition, it was postulated that potential synergistic interactions among other drug-resistant genes could facilitate the manifestation of drug resistance. Mutations in pbp2, pbp3, hefC, hopC, and lofH were also related to the resistance of H. pylori to AMX, and pbp1A may have a synergistic effect with these genes [2,22,23].
MOX and LEV are quinolone antibiotics, and the resistance rate of H. pylori to quinolone antibiotics in China is extremely high [24]. The consistency rate between mPCR-MS mini-sequencing and MICs of LEV was 68.2% (45/66). Eight strains with no phenotypic resistance were observed in the presence of gyrA sequence mutations. These results could be attributed to the LEV resistance breakpoint utilized in this study (1 μg/mL). Six of the eight sensitivity judgments had MIC values of 0.75 μg/mL, close to the drug resistance limit of 1 μg/mL. Other research reported isolates harboring gyrA mutations with a MIC of 0.5 μg/mL [25]. Additional studies are needed to correlate MIC and gyrA mutations to obtain an accurate breakpoint for levofloxacin [26]. No mutations were identified in 13 strains with phenotypic resistance in this study. The detected mutation sites C261TAG, G271AT, and T573GC in the gyrA gene correspond to the following gyrA amino acid sites: N87/N87K, D91/D91N/D91Y, and I191/I191M. Other studies have evaluated H. pylori genotypic resistance to LEV, where N87I, N87K, D91N, D91Y, and D91G were major mutations [26,27,28]. In this study, no MPE was designed for mutation N87I and D91G in our samples. We found in the pre-experiment that adding these two mutant probes affected the system stability. Previous retrospective studies have shown that the proportion of N87K in China is higher [29,30,31]. Moreover, mutations in gyrB, such as N481E and R484K, were also related to the resistance of H. pylori to LEV [32].
23S rRNA sequencing was performed on five inconsistent strains (12073, 12132, 21104, 22098, and 11039), of which the sequencing results of 12073 and 12132 showed that both were A2142G mutations. In the detection system employed for this study, we encountered nonspecific outcomes in identifying A2142G. Given the notably low detection rate of A2142G, which fell below 5%, the site was subsequently excluded from our analysis, with the focus solely directed toward detecting A2143G [33]. The remaining three strains (21104, 22098, and 11039) exhibited divergent DST outcomes when evaluated against CLA and AZI. However, mPCR-MS mini-sequencing technology indicated no mutations at sites 2142 and 2143. This observation suggests that the resistance might be attributed to mutations occurring at different sites. For instance, mutations such as C2694A and T2717C, which have been associated with lower resistance levels, may be contributing factors. Consequently, these particular sites may not serve as definitive drug resistance determinants [34,35].
The results detected by mPCR-MS mini-sequencing technology showed that isolates 12086 and 11039 were wild type A. The MIC result of 11039 to TET was the critical value, probably a human misjudgment. While the result of 12086 may be related to mutations in other missed detection locations, AGA926-928TTC was the major mutation of TET [36,37]. Combining large doses of TET and AMX could effectively eradicate H. pylori, and the incidence of adverse events was lower than that for programs containing furazolidone [38]. However, due to the low resistance of H. pylori to TET, the results of this experiment also supported this view, so it was recommended as a first-line drug for H. pylori infection in many countries, including China and the United States [4,39].
MET is the first-line therapy for H. pylori [4]. Recently, the results of some studies have indicated that the primary resistance rate to MET is 40–70% in China [24]. The mechanism of MET resistance is very complex [40,41,42]. It involves a wide range of genes and mutant forms, and many sites are still controversial [37,43]. In this study, only one relative mutation, C148T of rdxA, was selected for our experiment, and the results showed that the three isolates (strains 31073, 22103, and 22075) mutated at this site were both drug-resistant strains (Table S1). The primers, MPE probe, and extension bases are provided in the supplementary materials (Table S2).
We detected bimodal peaks at four sites of eight strains. The sites (site 271 of strains 11050, 11091, and 12104; site 261 of strains 11091, 11085, 12057, 22090, 12104, and 31123) of the gyrA associated with MOX and LEV resistance were detected as bimodal, and the DST results of these strains showed drug resistance (MIC > 32 mg/L). Site 2143 of 23S rRNA associated with CLA and AZI resistance was detected as bimodal, and the DST results of the 11050 strain showed drug resistance (MIC > 32 mg/L) too. The detected site 1684 of pbp1A associated with AMX was bimodal, and the DST results of these strains showed drug susceptibility (MIC < 1). Our results showed that when mPCR-MS mini-sequencing technology detected bimodal calls (one wild type, one mutant type, and two mutant types), there was a high probability of antibiotic resistance, indicating that they should be avoided. AMX with low drug resistance may be considered for use.
Compared with previous research, our research not only included the CLA and LEV drug resistance genes 23S rRNA and gyrA but also four other antibiotic-related drug resistance genes. What was inconsistent with some studies was the A2143G in the 23S rRNA selected in this study, not A2142G/C [14]. This study overlooked certain mutations associated with antibiotic resistance, namely gyrA-N87I and 23S rRNA-A2142GC et. The detection system should be optimized to encompass a broader range of mutations linked to antibiotic resistance. Furthermore, this approach was confined to detecting predetermined mutations and SNPs exclusively in pure samples. MPCR-MS mini-sequencing technology has certain limitations for detecting drug resistance in mixed samples. It detected the presence of a mutation in a specific drug-resistance gene in the mixed samples. It was not possible to determine which sample it was. It could be used for regional antibiotic resistance screening. If there is a specific mutation related to antibiotic resistance in several mixed samples, it may indicate that the local resistance rate of this kind of antibiotic is high. However, there are individual differences in antibiotic resistance, and screening of mixed samples is not recommended in clinical detection.
Despite these limitations, the mPCR-MS mini-sequencing technology is a valuable bridge between PCR-coupled Sanger and WGS. Its strengths lie in its swift analysis, heightened sensitivity, moderate throughput, and minimal sample consumption (96 samples with less than 50 sites could be detected within 7 h) [17]. With future refinements to the system and advancements in instrumentation, it holds immense potential to serve as a benchmark for clinical laboratories, facilitate rapid assessment of H. pylori drug resistance, and guide personalized medication strategies tailored to individual resistance profiles.

4. Materials and Methods

4.1. H. pylori Strains

Two WGS strains, ICDC 31109 and ICDC 31116, and 66 H. pylori strains were obtained from the Institute of National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention (ICDC).

4.2. Antibiotic Susceptibility Testing

We determined the MIC using the Etest (Liofilchem, Teramo, Italy) to measure the susceptibility of the 66 H. pylori strains to six antibiotics, including AMX, LEV, MOX, CLA, AZI, and TET. The isolates were subcultured three times from −80 °C bacterial stock in a blood agar plate without antibiotics in microaerophilic conditions. On day two, H. pylori cultures were collected in normal saline buffer and then adjusted to a turbidity of 3.0 McFarland units using a McFarland turbidity meter. The H. pylori cultures were inoculated into Mueller Hinton agar (Becton Dickinson, Isère, France) supplemented with 5% sheep blood, and the E-test strip was placed in the middle of the plate. The evaluation was performed after 72 h of incubation in microaerophilic conditions (5–10% CO2, 5% O2, 85% N2, and 5% H2 generated by gas-generating sachets at 37 °C) [17]. The clinical breakpoint of each antibiotic was as follows: AMX, 1 mg/L, LEV, 1 mg/L, MOX, 1 mg/L, CLA, 1 mg/L, AZI, 1 mg/L, TET, 4 mg/L.

4.3. H. pylori DNA Preparation

H. pylori DNA was isolated from H. pylori clinical isolation using QIAamp® DNA Micro (Qiagen, Dusseldorf, The Netherlands). The bacteria cultured overnight in 1 mL were centrifuged at 12,000 rpm for 1 min, and the supernatant was discarded. The steps were completed according to the kit’s protocol: the centrifuge column bound the bacterial DNA, washed it to remove impurities, eluted it from the centrifuge column, collected it, and stored it at −20 °C.

4.4. Selected Target Genes and Designed Primers and Mass Probes for Antibiotic Resistance

The design principles of multiplex-PCR primers have been previously described [17,18]. Initially, NCBI software (version hg38) retrieved resistance genes (pbp1A, gyrA, 23S rRNA, and 16S rRNA) sequences of standard strains and other thirty-odd uploaded strains (Table 6). A tool named Alignment was selected for sequence alignment. Eight mutation sites were chosen for antibiotic resistance, namely 23S rRNA-2143; pbp1A-1667, 1684, and 1240; gyrA-261, 271, and 573; and 16S rRNA-928 (Table 7). The conserved segment was analyzed using BatchPrimer3 (version 1.0) software (https://wheat.pw.usda.gov/demos/BatchPrimer3/, accessed on 18 November 2023) to design primers for multiplex PCR. Six primers were used for multiplex PCR, in which a 10 bp fixed sequence (acgttggatg) was added to the 5′ end of each primer (Table 8). Eleven quality difference probes for mutation sites were devoted into two groups, The probes HP AP1a, HP AP1b, HP AP2a, HP AP2b, HP AP3, HP AP4, HP AP5a, and HP AP5b were extended in one reaction tube (denoted as tube A), and probes HP BP3, HP BP4, and HP BP6 were extended in another reaction tube (denoted as tube B)→(Table 7).

4.5. Establishment of mPCR-MS Mini-Sequencing Technology

DNase-free water served as the blank control. The steps were as follows. (i) For multiplex PCR amplification, the mutated gene fragment was amplified. (ii) For SAP digestion, PCR products were treated with SAP to eliminate the free deoxynucleotide triphosphates. (iii) For the MPE reaction, the purified SAP products were added with mixed MPE reaction for the single base extension. The specific steps were previously described [18].

4.6. SNP Identification and Data Analysis by MALDI-TOF MS

The products from the MPE reaction were purified using the ion-exchange resin. An aliquot (0.2–1 µL) of purified products was spotted onto a matrix preliminarily dried on the MALDI target. The matrix employed was a saturated solution of 3-hydroxypicolinic acid (3-HPA). All solvents were of a quality suitable for mass spectrometry. The parameters and data analysis have been described previously [17,18,19].

4.7. Statistical Analysis

To calculate the consistency rate of detection results between the mPCR-MS mini-sequencing technology and the reference method DST, the calculation method of the consistency rate was [(true positive rate + true negative rate)/total number of tests × 100%].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26041632/s1.

Author Contributions

F.Z. and D.X. designed the study. J.Z. and L.H. provided the Helicobacter pylori strains. F.Z., X.Z., H.Z., L.H. and F.M. performed the experiments. F.Z. and X.Z. analyzed and interpreted the data. X.Z. drafted the manuscript. D.X. performed critical proofreading. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Capital’s Funds for Health Improvement and Research, grant number CFH 2024-1G-4362.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hooi, J.K.Y.; Lai, W.Y.; Ng, W.K.; Suen, M.M.Y.; Underwood, F.E.; Tanyingoh, D.; Malfertheiner, P.; Graham, D.Y.; Wong, V.W.S.; Wu, J.C.Y.; et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology 2017, 153, 420–429. [Google Scholar] [CrossRef] [PubMed]
  2. Tshibangu-Kabamba, E.; Yamaoka, Y. Helicobacter pylori infection and antibiotic resistance—From biology to clinical implications. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 613–629. [Google Scholar] [CrossRef] [PubMed]
  3. Chey, W.D.; Howden, C.W.; Moss, S.F.; Morgan, D.R.; Greer, K.B.; Grover, S.; Shah, S.C. ACG Clinical Guideline: Treatment of Helicobacter pylori Infection. Am. J. Gastroenterol. 2024, 119, 1730–1753. [Google Scholar] [CrossRef]
  4. Malfertheiner, P.; Megraud, F.; O’Morain, C.A.; Gisbert, J.P.; Kuipers, E.J.; Axon, A.T.; Bazzoli, F.; Gasbarrini, A.; Atherton, J.; Graham, D.Y.; et al. Management of Helicobacter pylori infection-the Maastricht V/Florence Consensus Report. Gut 2017, 66, 6–30. [Google Scholar] [CrossRef]
  5. Shah, S.C.; Iyer, P.G.; Moss, S.F. AGA Clinical Practice Update on the Management of Refractory Helicobacter pylori Infection: Expert Review. Gastroenterology 2021, 160, 1831–1841. [Google Scholar] [CrossRef]
  6. Hu, Y.; Zhang, M.; Lu, B.; Dai, J.F. Helicobacter pylori and Antibiotic Resistance, A Continuing and Intractable Problem. Helicobacter 2016, 21, 349–363. [Google Scholar] [CrossRef]
  7. Gong, Y.H.; Yuan, Y. Resistance mechanisms of Helicobacter pylori and its dual target precise therapy. Crit. Rev. Microbiol. 2018, 44, 371–392. [Google Scholar] [CrossRef]
  8. Flores-Trevino, S.; Mendoza-Olazaran, S.; Bocanegra-Ibarias, P.; Maldonado-Garza, H.J.; Garza-Gonzalez, E. Helicobacter pylori drug resistance: Therapy changes and challenges. Expert Rev. Gastroenterol. Hepatol. 2018, 12, 819–827. [Google Scholar] [CrossRef]
  9. Thung, I.; Aramin, H.; Vavinskaya, V.; Gupta, S.; Park, J.Y.; Crowe, S.E.; Valasek, M.A. Review article: The global emergence of Helicobacter pylori antibiotic resistance. Aliment Pharm. Ther. 2016, 43, 514–533. [Google Scholar] [CrossRef]
  10. Kasahun, G.G.; Demoz, G.T.; Desta, D.M. Primary Resistance Pattern of Helicobacter pylori to Antibiotics in Adult Population: A Systematic Review. Infect. Drug Resist. 2020, 13, 1567–1573. [Google Scholar] [CrossRef]
  11. Schuetz, A.N.; Theel, E.S.; Cole, N.C.; Rothstein, T.E.; Gordy, G.G.; Patel, R. Testing for Helicobacter pylori in an era of antimicrobial resistance. J. Clin. Microbiol. 2024, 62, e0073223. [Google Scholar] [CrossRef] [PubMed]
  12. Pohl, D.; Keller, P.M.; Bordier, V.; Wagner, K. Review of current diagnostic methods and advances in Helicobacter pylori diagnostics in the era of next generation sequencing. World J. Gastroenterol. 2019, 25, 4629–4660. [Google Scholar] [CrossRef] [PubMed]
  13. Qiu, E.M.; Li, Z.; Han, S. Methods for detection of Helicobacter pylori from stool sample: Current options and developments. Braz. J. Microbiol. 2021, 52, 2057–2062. [Google Scholar] [CrossRef] [PubMed]
  14. Zhao, Y.; Li, Y.; Luan, Z.X.; Ma, C.P.; Yang, L.; Zhang, W.; Shi, C. Establishment of a TaqMan-MGB probe multiplex real-time PCR system for one-step levofloxacin and clarithromycin resistant Helicobacter pylori detection. J. Microbiol. Methods 2022, 192, 106393. [Google Scholar] [CrossRef]
  15. Cai, Y.; Wang, C.; Chen, Z.; Xu, Z.; Li, H.; Li, W.; Sun, Y. Transporters HP0939, HP0497, and HP0471 participate in intrinsic multidrug resistance and biofilm formation in Helicobacter pylori by enhancing drug efflux. Helicobacter 2020, 25, e12715. [Google Scholar] [CrossRef]
  16. Ng, H.Y.; Leung, W.K.; Cheung, K.S. Antibiotic Resistance, Susceptibility Testing and Stewardship in Helicobacter pylori Infection. Int. J. Mol. Sci. 2023, 24, 11708. [Google Scholar] [CrossRef]
  17. Zhao, F.; Lu, J.X.; Lu, B.; Qin, T.; Wang, X.M.; Hou, X.X.; Meng, F.L.; Xu, X.N.; Li, T.Y.; Zhou, H.J.; et al. A Novel Strategy for the Detection of SARS-CoV-2 Variants Based on Multiplex PCR-Mass Spectrometry Minisequencing Technology. Microbiol. Spectr. 2021, 9, e0126721. [Google Scholar] [CrossRef]
  18. Zhao, F.; Zhang, J.Z.; Wang, X.M.; Liu, L.Y.; Gong, J.; Zhai, Z.X.; He, L.H.; Meng, F.L.; Xiao, D. A multisite SNP genotyping and macrolide susceptibility gene method for Mycoplasma pneumoniae based on MALDI-TOF MS. iScience 2021, 24, 102447. [Google Scholar] [CrossRef]
  19. Mu, Q.Z.; Zhao, X.; Li, F.F.; Li, W.Y.; Zhou, X.X.; Lun, X.C.; Wang, Y.G.; Hua, D.D.; Liu, Q.Y.; Xiao, D.; et al. A novel strategy for screening mutations in the voltage-gated sodium channel gene of Aedes albopictus based on multiplex PCR-mass spectrometry minisequencing technology. Infect. Dis. Poverty 2023, 12, 74. [Google Scholar] [CrossRef]
  20. Zerbetto De Palma, G.; Mendiondo, N.; Wonaga, A.; Viola, L.; Ibarra, D.; Campitelli, E.; Salim, N.; Corti, R.; Goldman, C.; Catalano, M. Occurrence of Mutations in the Antimicrobial Target Genes Related to Levofloxacin, Clarithromycin, and Amoxicillin Resistance in Helicobacter pylori Isolates from Buenos Aires City. Microb. Drug Resist. 2017, 23, 351–358. [Google Scholar] [CrossRef]
  21. Vital, J.S.; Tanoeiro, L.; Lopes-Oliveira, R.; Vale, F.F. Biomarker Characterization and Prediction of Virulence and Antibiotic Resistance from Helicobacter pylori Next Generation Sequencing Data. Biomolecules 2022, 12, 691. [Google Scholar] [CrossRef] [PubMed]
  22. Hu, Y.; Zhu, Y.; Lu, N.H. Primary Antibiotic Resistance of Helicobacter pylori in China. Dig. Dis. Sci. 2017, 62, 1146–1154. [Google Scholar] [CrossRef] [PubMed]
  23. Chen, J.N.; Li, P.H.; Huang, Y.; Guo, Y.X.; Ding, Z.H.; Lu, H. Primary Antibiotic Resistance of Helicobacter pylori in Different Regions of China: A Systematic Review and Meta-Analysis. Pathogens 2022, 11, 786. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, W.Z.; Xie, Y.; Lu, H.; Cheng, H.; Zeng, Z.R.; Zhou, L.Y.; Chen, Y.; Wang, J.B.; Du, Y.Q.; Lu, N.H.; et al. Fifth Chinese National Consensus Report on the management of Helicobacter pylori infection. Helicobacter 2018, 23, e12475. [Google Scholar] [CrossRef]
  25. Liou, J.M.; Chang, C.Y.; Sheng, W.H.; Wang, Y.C.; Chen, M.J.; Lee, Y.C.; Hung, H.W.; Chian, H.; Chang, S.C.; Wu, M.S.; et al. Genotypic resistance in Helicobacter pylori strains correlates with susceptibility test and treatment outcomes after levofloxacin- and clarithromycin-based therapies. Antimicrob. Agents Chemother. 2011, 55, 1123–1129. [Google Scholar] [CrossRef]
  26. Trespalacios-Rangel, A.A.; Otero, W.; Arevalo-Galvis, A.; Poutou-Pinales, R.A.; Rimbara, E.; Graham, D.Y. Surveillance of Levofloxacin Resistance in Helicobacter pylori Isolates in Bogota-Colombia (2009–2014). PLoS ONE 2016, 11, e0160007. [Google Scholar] [CrossRef]
  27. Sanches, B.S.; Martins, G.M.; Lima, K.; Cota, B.; Moretzsohn, L.D.; Ribeiro, L.T.; Breyer, H.P.; Maguilnik, I.; Maia, A.B.; Rezende-Filho, J.; et al. Detection of Helicobacter pylori resistance to clarithromycin and fluoroquinolones in Brazil: A national survey. World J. Gastroenterol. 2016, 22, 7587–7594. [Google Scholar] [CrossRef]
  28. Trespalacios, A.A.; Rimbara, E.; Otero, W.; Reddy, R.; Graham, D.Y. Improved allele-specific PCR assays for detection of clarithromycin and fluoroquinolone resistant of Helicobacter pylori in gastric biopsies: Identification of N87I mutation in GyrA. Diagn. Microbiol. Infect. Dis. 2015, 81, 251–255. [Google Scholar] [CrossRef]
  29. Wei, W.; Wang, Z.; Li, C.; Jiang, Z.; Zhang, Z.; Wang, S. Antibiotic resistance of Helicobacter pylori in Nanjing, China: A cross-section study from 2018 to 2023. Front. Cell Infect. Microbiol. 2023, 13, 1294379. [Google Scholar] [CrossRef]
  30. Li, Y.; Lin, R.; Jin, Y.; Jin, S.; Chen, B.; Wu, X. Genotyping Helicobacter pylori antibiotic resistance and virulence-associated genes in patients with gastric cancer in Wenzhou, China. Arab. J. Gastroenterol. 2021, 22, 267–271. [Google Scholar] [CrossRef]
  31. Lok, C.H.; Zhu, D.; Wang, J.; Ren, Y.T.; Jiang, X.; Li, S.J.; Zhao, X.Y. Phenotype and Molecular Detection of Clarithromycin and Levofloxacin Resistance in Helicobacter pylori Clinical Isolates in Beijing. Infect. Drug Resist. 2020, 13, 2145–2153. [Google Scholar] [CrossRef] [PubMed]
  32. Samanic, I.; Dadic, B.; Sanader Marsic, Z.; Dzelalija, M.; Maravic, A.; Kalinic, H.; Vrebalov Cindro, P.; Sundov, Z.; Tonkic, M.; Tonkic, A.; et al. Molecular Characterization and Mutational Analysis of Clarithromycin- and Levofloxacin-Resistance Genes in Helicobacter pylori from Gastric Biopsies in Southern Croatia. Int. J. Mol. Sci. 2023, 24, 14560. [Google Scholar] [CrossRef] [PubMed]
  33. Park, C.G.; Kim, S.; Lee, E.J.; Jeon, H.S.; Han, S. Clinical relevance of point mutations in the 23S rRNA gene in Helicobacter pylori eradication: A prospective, observational study. Medicine 2018, 97, e11835. [Google Scholar] [CrossRef] [PubMed]
  34. Luo, X.F.; Jiao, J.H.; Zhang, W.Y.; Pu, H.M.; Qu, B.J.; Yang, B.Y.; Hou, M.; Ji, M.J. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori. World J. Gastroenterol. 2016, 22, 5822–5830. [Google Scholar] [CrossRef]
  35. Marques, A.T.; Vitor, J.M.B.; Santos, A.; Oleastro, M.; Vale, F.F. Trends in Helicobacter pylori resistance to clarithromycin: From phenotypic to genomic approaches. Microb. Genom. 2020, 6, e000344. [Google Scholar] [CrossRef]
  36. Suzuki, R.B.; Almeida, C.M.; Sperança, M.A. Absence of Helicobacter pylori high tetracycline resistant 16S rDNA AGA926-928TTC genotype in gastric biopsy specimens from dyspeptic patients of a city in the interior of São Paulo, Brazil. BMC Gastroenterol. 2012, 12, 49. [Google Scholar] [CrossRef]
  37. Mannion, A.; Dzink-Fox, J.; Shen, Z.L.; Piazuelo, M.B.; Wilson, K.T.; Correa, P.; Peek, R.M.; Camargo, M.C.; Fox, J.G. Helicobacter pylori Antimicrobial Resistance and Gene Variants in High- and Low-Gastric-Cancer-Risk Populations. J. Clin. Microbiol. 2021, 59, e03203–e03220. [Google Scholar] [CrossRef]
  38. Wang, J.X.; Cao, Y.P.; He, W.; Li, X.P. Efficacy and safety of bismuth quadruple regimens containing tetracycline or furazolidone for initial eradication of Helicobacter pylori. Medicine 2021, 100, e28323. [Google Scholar] [CrossRef]
  39. Alsamman, M.A.; Vecchio, E.C.; Shawwa, K.; Acosta-Gonzales, G.; Resnick, M.B.; Moss, S.F. Retrospective Analysis Confirms Tetracycline Quadruple as Best Helicobacter pylori Regimen in the USA. Dig. Dis. Sci. 2019, 64, 2893–2898. [Google Scholar] [CrossRef]
  40. Zhou, Y.; Zhong, Z.S.; Hu, S.J.; Wang, J.; Deng, Y.H.; Li, X.M.; Chen, X.M.; Li, X.; Tang, Y.Y.; Li, X.F.; et al. A Survey of Helicobacter pylori Antibiotic-Resistant Genotypes and Strain Lineages by Whole-Genome Sequencing in China. Antimicrob. Agents Chemother. 2022, 66, e0218821. [Google Scholar] [CrossRef]
  41. Yang, J.M.; Zhang, J.Z.; Gu, Y.F.; Xiao, Y.L.; Chu, N.J.; Luo, H.Y.; Yang, J.; Wang, Q. Antimicrobial Resistance of Helicobacter pylori Among Low-resource Chinese Minorities. Altern. Ther. Health Med. 2023, 29, 224–229. [Google Scholar] [PubMed]
  42. Ghotaslou, R.; Baghi, H.B.; Alizadeh, N.; Yekani, M.; Arbabi, S.; Memar, M.Y. Mechanisms of Bacteroides fragilis resistance to metronidazole. Infect. Genet. Evol. 2018, 64, 156–163. [Google Scholar] [CrossRef] [PubMed]
  43. Windham, I.H.; Merrell, D.S. Analysis of fitness costs associated with metronidazole and amoxicillin resistance in Helicobacter pylori. Helicobacter 2020, 25, e12724. [Google Scholar] [CrossRef] [PubMed]
Figure 1. MS peaks of the MPE probes in different samples. (A,B): MS peaks of MPE probes without extension; (C,D): SNP peaks of MPE probes extended in strain 31109; (E,F): SNP peaks of MPE probes extended in strain 31116; (G,H): MS peaks of MPE probes without extension in blank control. Colors: each color represents one MPE and its extension bases. Letters: the letters denote the types of bases the MPE probes can extend. Red circles: the circles represent the bases extended by the MPE probes in the strains.
Figure 1. MS peaks of the MPE probes in different samples. (A,B): MS peaks of MPE probes without extension; (C,D): SNP peaks of MPE probes extended in strain 31109; (E,F): SNP peaks of MPE probes extended in strain 31116; (G,H): MS peaks of MPE probes without extension in blank control. Colors: each color represents one MPE and its extension bases. Letters: the letters denote the types of bases the MPE probes can extend. Red circles: the circles represent the bases extended by the MPE probes in the strains.
Ijms 26 01632 g001
Figure 2. The numbers of resistance or susceptibility to six antibiotics.
Figure 2. The numbers of resistance or susceptibility to six antibiotics.
Ijms 26 01632 g002
Figure 3. The number of mutations at mutation sites associated with six antibiotics.
Figure 3. The number of mutations at mutation sites associated with six antibiotics.
Ijms 26 01632 g003
Table 1. Sequences and extension calls of mass probe.
Table 1. Sequences and extension calls of mass probe.
Mass ProbesMutationsMass Probe
Sequences (5′-3′)
Mass Probe Mass (Da)Extension CallMass Probe Mass (Da)Extension CallMass Probe Mass (Da)Extension CallMass Probe Mass (Da)Extension CallMass Probe Mass (Da)
HP AP1aC/GAGAAATTGCCGGTAAAA5251.4C5524.4G5564.4
HP AP1bC/GAGAAATCGCTGGTAAAA5251.4C5524.4G5564.4
HP AP2aA/CAACCACGCATGGCACCCT5413.6A5710.6C5686.6
HP AP2bA/CAATCACGCATGGCACCCC5413.6A5710.6C5686.6
HP AP3T/G/CAAGCGTCTATGATTTCATC5777.8T6074.8G6050.8C6090.8
HP AP4G/A/TTGGCGATAACGCGGTTTAT5858.8G6171.8A6155.8T6200.8
HP AP5aA/TCAATGAACCAAGCGTCAATAT6407.2A6749.2T6704.2
HP AP5bA/TCAATGAACCAGGCATCAATAT6407.2A6749.2T6704.2
HP BP3A/GCTACCCGCGGCAAGACGGA5807.8A6104.8G6120.8
HP BP4C/A/T/GTACCACCCCCATGGCGATAA6031.0C6304.0A6328.0T6373.0G6344.0
HP BP6A/CCCTAGGTAAGGTTCTTCGTGTA6756.4A7098.4C7069.4
Table 2. Results of two WGS strains (ICDC 31109 and ICDC 3111) detected by mPCR-MS mini-sequencing technology.
Table 2. Results of two WGS strains (ICDC 31109 and ICDC 3111) detected by mPCR-MS mini-sequencing technology.
Sample
Number
InformationCode1Result1Code2Result2Code3Result3Code4Result4Code5Result5
A-31109HP-MPE-AHP AP1aCHP AP2aAHP AP3THP AP4GHP AP5aA
A-31116HP-MPE-AHP AP1aCHP AP2aAHP AP3THP AP4GHP AP5aA
MPE-A(NTC)HP-MPE-AHP AP1aNoCallHP AP2aNoCallHP AP3NoCallHP AP4NoCallHP AP5aNoCall
BLANK-AHP-MPE-AHP AP1aNoCallHP AP2aNoCallHP AP3NoCallHP AP4NoCallHP AP5aNoCall
B-31109HP-MPE-BHP BP3AHP BP4THP BP6A
B-31116HP-MPE-BHP BP3AHP BP4THP BP6A
MPE-B(NTC)HP-MPE-BHP BP3NoCallHP BP4NoCallHP BP6NoCall
BLANK-BHP-MPE-BHP BP3NoCallHP BP4NoCallHP BP6NoCall
Table 3. The DST results for six antibiotics tested on sixty-six strains.
Table 3. The DST results for six antibiotics tested on sixty-six strains.
StrainsDST Results
AMX (≥1 mg/L)R/SLEV (≥1 mg/L)R/SMOX (≥1 mg/L)R/SCLA (≥1 mg/L)R/SAZI (≥1 mg/L)R/STET (≥4 mg/L)R/S
321410.032S>32R>32R0.19S0.19S2S
32130<0.016S2R1.5R0.19S3R0.38S
32126<0.016S1.5R1.5R0.75S0.125S0.38S
32115<0.016S>32R>32R12R>256R0.19S
32078<0.016S0.5S3R0.064S0.19S0.38S
320410.023S>32R>32R4R>256R0.75S
311350.016S2R3R0.125S0.75S0.75S
31123<0.016S>32R>32R24R>256R0.38S
310780.064S>32R>32R0.19S0.19S1S
310730.016S>32R>32R0.125S0.125S0.5S
310580.023S>32R>32R6R>256R0.25S
22105<0.016S0.75S2R0.125S0.125S0.38S
221040.094S>32R>32R1.5R0.75S1S
221030.016S>32R>32R>256R>256R0.38S
22100<0.016S12R>32R64R>256R0.25S
220980.016S0.75S3R1R2R0.5S
22096<0.016S>32R>32R0.25S0.125S0.25S
220920.125S>32R>32R16R>256R0.25S
22090<0.016S>32R>32R4R>256R1.5S
22089<0.016S6R>32R16R>256R1S
22075<0.016S>32R>32R4R>256R0.38S
22070<0.016S>32R>32R0.047S0.094S0.25S
22061<0.016S>32R>32R48R>256R1.5S
220590.047S>32R>32R12R>256R6R
22058<0.016S1.5R1.5R12R>256R0.125S
220510.094S>32R>32R16R>256R1S
22049<0.016S>32R>32R48R>256R0.38S
22027<0.016S0.38S>32R>256R>256R0.094S
22024<0.016S0.75S3R0.19S0.064S0.19S
210760.023S32R>32R24R>256R1S
210720.064S6R>32R12R>256R0.5S
210620.016S0.75S2R0.19S0.19S1S
21018<0.016S>32R>32R8R>256R0.38S
12142<0.016S1R1.5R0.25S0.19S0.25S
12137<0.016S1R1.5R8R>256R0.5S
121330.023S1R2R0.064S0.094S0.38S
12132<0.016S0.75S8R24R>256R0.75S
12130<0.016S0.75S1R0.125S0.19S0.5S
12128<0.016S>32R>32R>256R>256R1.5S
12122<0.016S0.75S3R0.047S0.094S0.5S
12118<0.016S>32R>32R0.75S0.75S0.19S
12114<0.016S>32R>32R16R>256R0.25S
121100.064S>32R>32R0.125S0.5S0.25S
121040.047S>32R>32R>256R>256R0.75S
12094<0.016S>32R>32R48R>256R1S
120860.38S>32R>32R12R>256R12R
12073<0.016S0.25S1.5R96R>256R0.125S
120580.047S1R4R0.19S0.094S0.5S
120570.032S>32R>32R0.19S0.19S0.5S
120500.047S1R1.5R0.047S0.38S0.5S
12048<0.016S>32R>32R6R>256R0.75S
111420.023S>32R>32R24R>256R0.75S
11091<0.016S>32R>32R>256R>256R0.5S
11085<0.016S>32R>32R0.19S0.19S0.75S
11083<0.016S2R3R16R>256R0.25S
110770.047S3R4R32R>256R0.5S
110730.016S>32R>32R0.094S0.38S0.5S
11072<0.016S>32R>32R0.38S0.19S1S
110710.064S>32R>32R>256R>256R1S
11065<0.016S>32R>32R16R>256R0.25S
11057<0.016S>32R>32R12R>256R2S
11056<0.016S>32R>32R>256R>256R1S
11050<0.016S>32R>32R32R>256R0.38S
110390.25S>32R>32R0.75S8R4R
110220.047S6R>32R16R>256R0.38S
24020.023S>32R32R48R>256R2S
Table 4. The results of eight mutation sites in sixty-six strains detected by mPCR-MS mini-sequencing technology.
Table 4. The results of eight mutation sites in sixty-six strains detected by mPCR-MS mini-sequencing technology.
StrainsMutation Sites
AMX LEV/MOX CLA/AZITET
pbp1Apbp1Apbp1AgyrAgyrAgyrA23S rRNA16S rRNA
A1240CC1667GA1684TC261TAGG271ATT573GCA2143GA928C
32141ACAAGTAA
32130ACATGTAA
32126ACATGTAA
32115ACACGTGA
32078ACATGTAA
32041ACATGTGA
31135ACACGTAA
31123ACAT/GGTGA
31078ACATGTAA
31073ACATATAA
31058ACACGTGA
22105ACATGTAA
22104ACACATAA
22103ACACGTGA
22100ACATGTGA
22098ACATGTAA
22096ACACGTAA
22092ACAGGTGA
22090ACAA/CGTGA
22089ACACGTGA
22075ACAAGTGA
22070ACATATAA
22061ACAAGTGA
22059ACACGTGC
22058ACNoCallCGTGA
22051ACAAGTGA
22049ACAAGTGA
22027ACATGTGA
22024ACACGTAA
21076ACAAGGGA
21072ACATGTG A
21062ACATGTAA
21018ACATGTGA
12142ACACGTAA
12137ANoCallATTTGA
12133ACATGTAA
12132ACAAGTAA
12130ANoCallATTTAA
12128ACAGGTGA
12122ACACGTAA
12118ACAAGTAA
12114ACACGTGA
12110ACATGTAA
12104ACTT/CG/ATGA
12094ACAGGTGA
12086ACACGTGA
12073ACATGTAA
12058ACATGTAA
12057ACAA/CGTAA
12050ACACGTAA
12048ACATTTG A
11142ACATATGA
11091ACAT/GG/ATGA
11085ACAA/GGTAA
11083ACATGTGA
11077ACACGTGA
11073ACAATTAA
11072ACAAGTAA
11071ACATTTGA
11065ACATTTGA
11057ACATTTGA
11056ACAAGTGA
11050ACATG/ATA/GA
11039ACA/TTGTAA
11022ACTTATGA
2402ACATATGA
Table 5. Consistency rate of DST and mPCR-MS mini-sequencing technology.
Table 5. Consistency rate of DST and mPCR-MS mini-sequencing technology.
AntibioticsmPCR-MS Mini-Sequencing Technology ResultsDST ResultsConsistency Rate
Resistance (Count)Susceptibility (Count)
AMXmutation (count)0395.5%
non-mutation (count)063
MOXmutation (count)51077.3%
non-mutation (count)150
LEVmutation (count)43868.2%
non-mutation (count)132
CLAmutation (count)37093.9%
non-mutation (count)425
AZImutation (count)37092.4%
non-mutation (count)524
TETmutation (count)1097.0%
non-mutation (count)263
Table 6. Target genes with mutation sites of six antibiotics.
Table 6. Target genes with mutation sites of six antibiotics.
AntibioticsGenesMutation SitesMutations
AMXpbp1A1240A→C
1667C→G
1684A→T
LEVgyrA261C→T/A/G
271G→A/T
MOX573T→G/C
CLA23S rRNA2143A→G
AZI
TET16S rRNA928A→C
Table 7. Mass probes of variant target sites.
Table 7. Mass probes of variant target sites.
GenesMutation SitesMass ProbesMass Probe Tubes
23S rRNA2143HP BP3B a-23S rRNA-2143F
pbp1A1667HP AP1aA a-pbp1A-1667Fa
HP AP1bA-pbp1A-1667Fb
1684HP AP5aA-pbp1A-1684Ra
HP AP5bA-pbp1A-1684Rb
1240HP AP2aA-pbp1A-1240Fa
HP AP2bA-pbp1A-1240Fb
gyrA261HP BP4B-gyrA-261F
271HP AP4A-gyrA-271F
573HP AP3A-gyrA-573R
16S rRNA928HP BP6B-16S rRNA-928R
a: A and B represent that the mass probe has divided into two tubes; tube A contained AP1-5 and tube B contained BP3, 4, 6.
Table 8. Primer sequences for variant sites of target genes.
Table 8. Primer sequences for variant sites of target genes.
GenesMutation SitesPrimer NameFixed SequencePrimer Sequences (5′-3′)Complete Primer Sequences (5′-3′)
23S rRNA2143HP 1FacgttggatgGGGAGCTGTCTCAACCAGAGacgttggatgGGGAGCTGTCTCAACCAGAG
2143HP 1RacgttggatgCAAAGCCTCCCACCTATCCTacgttggatgCAAAGCCTCCCACCTATCCT
pbp1A1667 1684HP 2FacgttggatgGGAGTTTGGCTCGCATTAAAacgttggatgGGAGTTTGGCTCGCATTAAA
1667 1684HP 2RacgttggatgGCCAATAGGCGTGTTATCGTacgttggatgGCCAATAGGCGTGTTATCGT
1240HP 3FacgttggatgGCGCGAAAYTTTGAAAATGacgttggatgGCGCGAAAYTTTGAAAATG
1240HP 3RacgttggatgAGCCAAGCTGATCGCTTAAAacgttggatgAGCCAAGCTGATCGCTTAAA
gyrA261 271HP 4FacgttggatgTAGGATCGTGGGTGATGTGAacgttggatgTAGGATCGTGGGTGATGTGA
261 271HP 4RacgttggatgCAGCGTTATCGCCATCAATAacgttggatgCAGCGTTATCGCCATCAATA
573HP 5FacgttggatgAGCCGTCTGCCTAACCTTTTacgttggatgAGCCGTCTGCCTAACCTTTT
573HP 5RacgttggatgTCAGGCCCTTTGACAAATTCacgttggatgTCAGGCCCTTTGACAAATTC
16S rRNA928HP 6FacgttggatgCGGTCGCAAGATTAAAACTCAacgttggatgCGGTCGCAAGATTAAAACTCA
928HP 6RacgttggatgGCAGCACCTGTTTTCAAGGTacgttggatgGCAGCACCTGTTTTCAAGGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, F.; Zhao, X.; Zhang, H.; He, L.; Meng, F.; Zhang, J.; Xiao, D. Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics. Int. J. Mol. Sci. 2025, 26, 1632. https://doi.org/10.3390/ijms26041632

AMA Style

Zhao F, Zhao X, Zhang H, He L, Meng F, Zhang J, Xiao D. Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics. International Journal of Molecular Sciences. 2025; 26(4):1632. https://doi.org/10.3390/ijms26041632

Chicago/Turabian Style

Zhao, Fei, Xin Zhao, Huifang Zhang, Lihua He, Fanliang Meng, Jianzhong Zhang, and Di Xiao. 2025. "Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics" International Journal of Molecular Sciences 26, no. 4: 1632. https://doi.org/10.3390/ijms26041632

APA Style

Zhao, F., Zhao, X., Zhang, H., He, L., Meng, F., Zhang, J., & Xiao, D. (2025). Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics. International Journal of Molecular Sciences, 26(4), 1632. https://doi.org/10.3390/ijms26041632

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop