Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics
Abstract
1. Introduction
2. Results
2.1. Establishment and Optimization of mPCR-MS Mini-Sequencing Technology
2.2. Antibiotic Susceptibility Testing of H. pylori Strains
2.3. Eight Mutation Sites of Sixty-Six Strains Were Detected by mPCR-MS Mini-Sequencing Technology
2.4. Consistency Rate of DST and mPCR-MS Mini-Sequencing Technology
3. Discussion
4. Materials and Methods
4.1. H. pylori Strains
4.2. Antibiotic Susceptibility Testing
4.3. H. pylori DNA Preparation
4.4. Selected Target Genes and Designed Primers and Mass Probes for Antibiotic Resistance
4.5. Establishment of mPCR-MS Mini-Sequencing Technology
4.6. SNP Identification and Data Analysis by MALDI-TOF MS
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hooi, J.K.Y.; Lai, W.Y.; Ng, W.K.; Suen, M.M.Y.; Underwood, F.E.; Tanyingoh, D.; Malfertheiner, P.; Graham, D.Y.; Wong, V.W.S.; Wu, J.C.Y.; et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology 2017, 153, 420–429. [Google Scholar] [CrossRef] [PubMed]
- Tshibangu-Kabamba, E.; Yamaoka, Y. Helicobacter pylori infection and antibiotic resistance—From biology to clinical implications. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 613–629. [Google Scholar] [CrossRef] [PubMed]
- Chey, W.D.; Howden, C.W.; Moss, S.F.; Morgan, D.R.; Greer, K.B.; Grover, S.; Shah, S.C. ACG Clinical Guideline: Treatment of Helicobacter pylori Infection. Am. J. Gastroenterol. 2024, 119, 1730–1753. [Google Scholar] [CrossRef]
- Malfertheiner, P.; Megraud, F.; O’Morain, C.A.; Gisbert, J.P.; Kuipers, E.J.; Axon, A.T.; Bazzoli, F.; Gasbarrini, A.; Atherton, J.; Graham, D.Y.; et al. Management of Helicobacter pylori infection-the Maastricht V/Florence Consensus Report. Gut 2017, 66, 6–30. [Google Scholar] [CrossRef]
- Shah, S.C.; Iyer, P.G.; Moss, S.F. AGA Clinical Practice Update on the Management of Refractory Helicobacter pylori Infection: Expert Review. Gastroenterology 2021, 160, 1831–1841. [Google Scholar] [CrossRef]
- Hu, Y.; Zhang, M.; Lu, B.; Dai, J.F. Helicobacter pylori and Antibiotic Resistance, A Continuing and Intractable Problem. Helicobacter 2016, 21, 349–363. [Google Scholar] [CrossRef]
- Gong, Y.H.; Yuan, Y. Resistance mechanisms of Helicobacter pylori and its dual target precise therapy. Crit. Rev. Microbiol. 2018, 44, 371–392. [Google Scholar] [CrossRef]
- Flores-Trevino, S.; Mendoza-Olazaran, S.; Bocanegra-Ibarias, P.; Maldonado-Garza, H.J.; Garza-Gonzalez, E. Helicobacter pylori drug resistance: Therapy changes and challenges. Expert Rev. Gastroenterol. Hepatol. 2018, 12, 819–827. [Google Scholar] [CrossRef]
- Thung, I.; Aramin, H.; Vavinskaya, V.; Gupta, S.; Park, J.Y.; Crowe, S.E.; Valasek, M.A. Review article: The global emergence of Helicobacter pylori antibiotic resistance. Aliment Pharm. Ther. 2016, 43, 514–533. [Google Scholar] [CrossRef]
- Kasahun, G.G.; Demoz, G.T.; Desta, D.M. Primary Resistance Pattern of Helicobacter pylori to Antibiotics in Adult Population: A Systematic Review. Infect. Drug Resist. 2020, 13, 1567–1573. [Google Scholar] [CrossRef]
- Schuetz, A.N.; Theel, E.S.; Cole, N.C.; Rothstein, T.E.; Gordy, G.G.; Patel, R. Testing for Helicobacter pylori in an era of antimicrobial resistance. J. Clin. Microbiol. 2024, 62, e0073223. [Google Scholar] [CrossRef] [PubMed]
- Pohl, D.; Keller, P.M.; Bordier, V.; Wagner, K. Review of current diagnostic methods and advances in Helicobacter pylori diagnostics in the era of next generation sequencing. World J. Gastroenterol. 2019, 25, 4629–4660. [Google Scholar] [CrossRef] [PubMed]
- Qiu, E.M.; Li, Z.; Han, S. Methods for detection of Helicobacter pylori from stool sample: Current options and developments. Braz. J. Microbiol. 2021, 52, 2057–2062. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Li, Y.; Luan, Z.X.; Ma, C.P.; Yang, L.; Zhang, W.; Shi, C. Establishment of a TaqMan-MGB probe multiplex real-time PCR system for one-step levofloxacin and clarithromycin resistant Helicobacter pylori detection. J. Microbiol. Methods 2022, 192, 106393. [Google Scholar] [CrossRef]
- Cai, Y.; Wang, C.; Chen, Z.; Xu, Z.; Li, H.; Li, W.; Sun, Y. Transporters HP0939, HP0497, and HP0471 participate in intrinsic multidrug resistance and biofilm formation in Helicobacter pylori by enhancing drug efflux. Helicobacter 2020, 25, e12715. [Google Scholar] [CrossRef]
- Ng, H.Y.; Leung, W.K.; Cheung, K.S. Antibiotic Resistance, Susceptibility Testing and Stewardship in Helicobacter pylori Infection. Int. J. Mol. Sci. 2023, 24, 11708. [Google Scholar] [CrossRef]
- Zhao, F.; Lu, J.X.; Lu, B.; Qin, T.; Wang, X.M.; Hou, X.X.; Meng, F.L.; Xu, X.N.; Li, T.Y.; Zhou, H.J.; et al. A Novel Strategy for the Detection of SARS-CoV-2 Variants Based on Multiplex PCR-Mass Spectrometry Minisequencing Technology. Microbiol. Spectr. 2021, 9, e0126721. [Google Scholar] [CrossRef]
- Zhao, F.; Zhang, J.Z.; Wang, X.M.; Liu, L.Y.; Gong, J.; Zhai, Z.X.; He, L.H.; Meng, F.L.; Xiao, D. A multisite SNP genotyping and macrolide susceptibility gene method for Mycoplasma pneumoniae based on MALDI-TOF MS. iScience 2021, 24, 102447. [Google Scholar] [CrossRef]
- Mu, Q.Z.; Zhao, X.; Li, F.F.; Li, W.Y.; Zhou, X.X.; Lun, X.C.; Wang, Y.G.; Hua, D.D.; Liu, Q.Y.; Xiao, D.; et al. A novel strategy for screening mutations in the voltage-gated sodium channel gene of Aedes albopictus based on multiplex PCR-mass spectrometry minisequencing technology. Infect. Dis. Poverty 2023, 12, 74. [Google Scholar] [CrossRef]
- Zerbetto De Palma, G.; Mendiondo, N.; Wonaga, A.; Viola, L.; Ibarra, D.; Campitelli, E.; Salim, N.; Corti, R.; Goldman, C.; Catalano, M. Occurrence of Mutations in the Antimicrobial Target Genes Related to Levofloxacin, Clarithromycin, and Amoxicillin Resistance in Helicobacter pylori Isolates from Buenos Aires City. Microb. Drug Resist. 2017, 23, 351–358. [Google Scholar] [CrossRef]
- Vital, J.S.; Tanoeiro, L.; Lopes-Oliveira, R.; Vale, F.F. Biomarker Characterization and Prediction of Virulence and Antibiotic Resistance from Helicobacter pylori Next Generation Sequencing Data. Biomolecules 2022, 12, 691. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Zhu, Y.; Lu, N.H. Primary Antibiotic Resistance of Helicobacter pylori in China. Dig. Dis. Sci. 2017, 62, 1146–1154. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.N.; Li, P.H.; Huang, Y.; Guo, Y.X.; Ding, Z.H.; Lu, H. Primary Antibiotic Resistance of Helicobacter pylori in Different Regions of China: A Systematic Review and Meta-Analysis. Pathogens 2022, 11, 786. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.Z.; Xie, Y.; Lu, H.; Cheng, H.; Zeng, Z.R.; Zhou, L.Y.; Chen, Y.; Wang, J.B.; Du, Y.Q.; Lu, N.H.; et al. Fifth Chinese National Consensus Report on the management of Helicobacter pylori infection. Helicobacter 2018, 23, e12475. [Google Scholar] [CrossRef]
- Liou, J.M.; Chang, C.Y.; Sheng, W.H.; Wang, Y.C.; Chen, M.J.; Lee, Y.C.; Hung, H.W.; Chian, H.; Chang, S.C.; Wu, M.S.; et al. Genotypic resistance in Helicobacter pylori strains correlates with susceptibility test and treatment outcomes after levofloxacin- and clarithromycin-based therapies. Antimicrob. Agents Chemother. 2011, 55, 1123–1129. [Google Scholar] [CrossRef]
- Trespalacios-Rangel, A.A.; Otero, W.; Arevalo-Galvis, A.; Poutou-Pinales, R.A.; Rimbara, E.; Graham, D.Y. Surveillance of Levofloxacin Resistance in Helicobacter pylori Isolates in Bogota-Colombia (2009–2014). PLoS ONE 2016, 11, e0160007. [Google Scholar] [CrossRef]
- Sanches, B.S.; Martins, G.M.; Lima, K.; Cota, B.; Moretzsohn, L.D.; Ribeiro, L.T.; Breyer, H.P.; Maguilnik, I.; Maia, A.B.; Rezende-Filho, J.; et al. Detection of Helicobacter pylori resistance to clarithromycin and fluoroquinolones in Brazil: A national survey. World J. Gastroenterol. 2016, 22, 7587–7594. [Google Scholar] [CrossRef]
- Trespalacios, A.A.; Rimbara, E.; Otero, W.; Reddy, R.; Graham, D.Y. Improved allele-specific PCR assays for detection of clarithromycin and fluoroquinolone resistant of Helicobacter pylori in gastric biopsies: Identification of N87I mutation in GyrA. Diagn. Microbiol. Infect. Dis. 2015, 81, 251–255. [Google Scholar] [CrossRef]
- Wei, W.; Wang, Z.; Li, C.; Jiang, Z.; Zhang, Z.; Wang, S. Antibiotic resistance of Helicobacter pylori in Nanjing, China: A cross-section study from 2018 to 2023. Front. Cell Infect. Microbiol. 2023, 13, 1294379. [Google Scholar] [CrossRef]
- Li, Y.; Lin, R.; Jin, Y.; Jin, S.; Chen, B.; Wu, X. Genotyping Helicobacter pylori antibiotic resistance and virulence-associated genes in patients with gastric cancer in Wenzhou, China. Arab. J. Gastroenterol. 2021, 22, 267–271. [Google Scholar] [CrossRef]
- Lok, C.H.; Zhu, D.; Wang, J.; Ren, Y.T.; Jiang, X.; Li, S.J.; Zhao, X.Y. Phenotype and Molecular Detection of Clarithromycin and Levofloxacin Resistance in Helicobacter pylori Clinical Isolates in Beijing. Infect. Drug Resist. 2020, 13, 2145–2153. [Google Scholar] [CrossRef] [PubMed]
- Samanic, I.; Dadic, B.; Sanader Marsic, Z.; Dzelalija, M.; Maravic, A.; Kalinic, H.; Vrebalov Cindro, P.; Sundov, Z.; Tonkic, M.; Tonkic, A.; et al. Molecular Characterization and Mutational Analysis of Clarithromycin- and Levofloxacin-Resistance Genes in Helicobacter pylori from Gastric Biopsies in Southern Croatia. Int. J. Mol. Sci. 2023, 24, 14560. [Google Scholar] [CrossRef] [PubMed]
- Park, C.G.; Kim, S.; Lee, E.J.; Jeon, H.S.; Han, S. Clinical relevance of point mutations in the 23S rRNA gene in Helicobacter pylori eradication: A prospective, observational study. Medicine 2018, 97, e11835. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.F.; Jiao, J.H.; Zhang, W.Y.; Pu, H.M.; Qu, B.J.; Yang, B.Y.; Hou, M.; Ji, M.J. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori. World J. Gastroenterol. 2016, 22, 5822–5830. [Google Scholar] [CrossRef]
- Marques, A.T.; Vitor, J.M.B.; Santos, A.; Oleastro, M.; Vale, F.F. Trends in Helicobacter pylori resistance to clarithromycin: From phenotypic to genomic approaches. Microb. Genom. 2020, 6, e000344. [Google Scholar] [CrossRef]
- Suzuki, R.B.; Almeida, C.M.; Sperança, M.A. Absence of Helicobacter pylori high tetracycline resistant 16S rDNA AGA926-928TTC genotype in gastric biopsy specimens from dyspeptic patients of a city in the interior of São Paulo, Brazil. BMC Gastroenterol. 2012, 12, 49. [Google Scholar] [CrossRef]
- Mannion, A.; Dzink-Fox, J.; Shen, Z.L.; Piazuelo, M.B.; Wilson, K.T.; Correa, P.; Peek, R.M.; Camargo, M.C.; Fox, J.G. Helicobacter pylori Antimicrobial Resistance and Gene Variants in High- and Low-Gastric-Cancer-Risk Populations. J. Clin. Microbiol. 2021, 59, e03203–e03220. [Google Scholar] [CrossRef]
- Wang, J.X.; Cao, Y.P.; He, W.; Li, X.P. Efficacy and safety of bismuth quadruple regimens containing tetracycline or furazolidone for initial eradication of Helicobacter pylori. Medicine 2021, 100, e28323. [Google Scholar] [CrossRef]
- Alsamman, M.A.; Vecchio, E.C.; Shawwa, K.; Acosta-Gonzales, G.; Resnick, M.B.; Moss, S.F. Retrospective Analysis Confirms Tetracycline Quadruple as Best Helicobacter pylori Regimen in the USA. Dig. Dis. Sci. 2019, 64, 2893–2898. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhong, Z.S.; Hu, S.J.; Wang, J.; Deng, Y.H.; Li, X.M.; Chen, X.M.; Li, X.; Tang, Y.Y.; Li, X.F.; et al. A Survey of Helicobacter pylori Antibiotic-Resistant Genotypes and Strain Lineages by Whole-Genome Sequencing in China. Antimicrob. Agents Chemother. 2022, 66, e0218821. [Google Scholar] [CrossRef]
- Yang, J.M.; Zhang, J.Z.; Gu, Y.F.; Xiao, Y.L.; Chu, N.J.; Luo, H.Y.; Yang, J.; Wang, Q. Antimicrobial Resistance of Helicobacter pylori Among Low-resource Chinese Minorities. Altern. Ther. Health Med. 2023, 29, 224–229. [Google Scholar] [PubMed]
- Ghotaslou, R.; Baghi, H.B.; Alizadeh, N.; Yekani, M.; Arbabi, S.; Memar, M.Y. Mechanisms of Bacteroides fragilis resistance to metronidazole. Infect. Genet. Evol. 2018, 64, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Windham, I.H.; Merrell, D.S. Analysis of fitness costs associated with metronidazole and amoxicillin resistance in Helicobacter pylori. Helicobacter 2020, 25, e12724. [Google Scholar] [CrossRef] [PubMed]



| Mass Probes | Mutations | Mass Probe Sequences (5′-3′) | Mass Probe Mass (Da) | Extension Call | Mass Probe Mass (Da) | Extension Call | Mass Probe Mass (Da) | Extension Call | Mass Probe Mass (Da) | Extension Call | Mass Probe Mass (Da) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| HP AP1a | C/G | AGAAATTGCCGGTAAAA | 5251.4 | C | 5524.4 | G | 5564.4 | ||||
| HP AP1b | C/G | AGAAATCGCTGGTAAAA | 5251.4 | C | 5524.4 | G | 5564.4 | ||||
| HP AP2a | A/C | AACCACGCATGGCACCCT | 5413.6 | A | 5710.6 | C | 5686.6 | ||||
| HP AP2b | A/C | AATCACGCATGGCACCCC | 5413.6 | A | 5710.6 | C | 5686.6 | ||||
| HP AP3 | T/G/C | AAGCGTCTATGATTTCATC | 5777.8 | T | 6074.8 | G | 6050.8 | C | 6090.8 | ||
| HP AP4 | G/A/T | TGGCGATAACGCGGTTTAT | 5858.8 | G | 6171.8 | A | 6155.8 | T | 6200.8 | ||
| HP AP5a | A/T | CAATGAACCAAGCGTCAATAT | 6407.2 | A | 6749.2 | T | 6704.2 | ||||
| HP AP5b | A/T | CAATGAACCAGGCATCAATAT | 6407.2 | A | 6749.2 | T | 6704.2 | ||||
| HP BP3 | A/G | CTACCCGCGGCAAGACGGA | 5807.8 | A | 6104.8 | G | 6120.8 | ||||
| HP BP4 | C/A/T/G | TACCACCCCCATGGCGATAA | 6031.0 | C | 6304.0 | A | 6328.0 | T | 6373.0 | G | 6344.0 |
| HP BP6 | A/C | CCTAGGTAAGGTTCTTCGTGTA | 6756.4 | A | 7098.4 | C | 7069.4 |
| Sample Number | Information | Code1 | Result1 | Code2 | Result2 | Code3 | Result3 | Code4 | Result4 | Code5 | Result5 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| A-31109 | HP-MPE-A | HP AP1a | C | HP AP2a | A | HP AP3 | T | HP AP4 | G | HP AP5a | A |
| A-31116 | HP-MPE-A | HP AP1a | C | HP AP2a | A | HP AP3 | T | HP AP4 | G | HP AP5a | A |
| MPE-A(NTC) | HP-MPE-A | HP AP1a | NoCall | HP AP2a | NoCall | HP AP3 | NoCall | HP AP4 | NoCall | HP AP5a | NoCall |
| BLANK-A | HP-MPE-A | HP AP1a | NoCall | HP AP2a | NoCall | HP AP3 | NoCall | HP AP4 | NoCall | HP AP5a | NoCall |
| B-31109 | HP-MPE-B | HP BP3 | A | HP BP4 | T | HP BP6 | A | ||||
| B-31116 | HP-MPE-B | HP BP3 | A | HP BP4 | T | HP BP6 | A | ||||
| MPE-B(NTC) | HP-MPE-B | HP BP3 | NoCall | HP BP4 | NoCall | HP BP6 | NoCall | ||||
| BLANK-B | HP-MPE-B | HP BP3 | NoCall | HP BP4 | NoCall | HP BP6 | NoCall |
| Strains | DST Results | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AMX (≥1 mg/L) | R/S | LEV (≥1 mg/L) | R/S | MOX (≥1 mg/L) | R/S | CLA (≥1 mg/L) | R/S | AZI (≥1 mg/L) | R/S | TET (≥4 mg/L) | R/S | |
| 32141 | 0.032 | S | >32 | R | >32 | R | 0.19 | S | 0.19 | S | 2 | S |
| 32130 | <0.016 | S | 2 | R | 1.5 | R | 0.19 | S | 3 | R | 0.38 | S |
| 32126 | <0.016 | S | 1.5 | R | 1.5 | R | 0.75 | S | 0.125 | S | 0.38 | S |
| 32115 | <0.016 | S | >32 | R | >32 | R | 12 | R | >256 | R | 0.19 | S |
| 32078 | <0.016 | S | 0.5 | S | 3 | R | 0.064 | S | 0.19 | S | 0.38 | S |
| 32041 | 0.023 | S | >32 | R | >32 | R | 4 | R | >256 | R | 0.75 | S |
| 31135 | 0.016 | S | 2 | R | 3 | R | 0.125 | S | 0.75 | S | 0.75 | S |
| 31123 | <0.016 | S | >32 | R | >32 | R | 24 | R | >256 | R | 0.38 | S |
| 31078 | 0.064 | S | >32 | R | >32 | R | 0.19 | S | 0.19 | S | 1 | S |
| 31073 | 0.016 | S | >32 | R | >32 | R | 0.125 | S | 0.125 | S | 0.5 | S |
| 31058 | 0.023 | S | >32 | R | >32 | R | 6 | R | >256 | R | 0.25 | S |
| 22105 | <0.016 | S | 0.75 | S | 2 | R | 0.125 | S | 0.125 | S | 0.38 | S |
| 22104 | 0.094 | S | >32 | R | >32 | R | 1.5 | R | 0.75 | S | 1 | S |
| 22103 | 0.016 | S | >32 | R | >32 | R | >256 | R | >256 | R | 0.38 | S |
| 22100 | <0.016 | S | 12 | R | >32 | R | 64 | R | >256 | R | 0.25 | S |
| 22098 | 0.016 | S | 0.75 | S | 3 | R | 1 | R | 2 | R | 0.5 | S |
| 22096 | <0.016 | S | >32 | R | >32 | R | 0.25 | S | 0.125 | S | 0.25 | S |
| 22092 | 0.125 | S | >32 | R | >32 | R | 16 | R | >256 | R | 0.25 | S |
| 22090 | <0.016 | S | >32 | R | >32 | R | 4 | R | >256 | R | 1.5 | S |
| 22089 | <0.016 | S | 6 | R | >32 | R | 16 | R | >256 | R | 1 | S |
| 22075 | <0.016 | S | >32 | R | >32 | R | 4 | R | >256 | R | 0.38 | S |
| 22070 | <0.016 | S | >32 | R | >32 | R | 0.047 | S | 0.094 | S | 0.25 | S |
| 22061 | <0.016 | S | >32 | R | >32 | R | 48 | R | >256 | R | 1.5 | S |
| 22059 | 0.047 | S | >32 | R | >32 | R | 12 | R | >256 | R | 6 | R |
| 22058 | <0.016 | S | 1.5 | R | 1.5 | R | 12 | R | >256 | R | 0.125 | S |
| 22051 | 0.094 | S | >32 | R | >32 | R | 16 | R | >256 | R | 1 | S |
| 22049 | <0.016 | S | >32 | R | >32 | R | 48 | R | >256 | R | 0.38 | S |
| 22027 | <0.016 | S | 0.38 | S | >32 | R | >256 | R | >256 | R | 0.094 | S |
| 22024 | <0.016 | S | 0.75 | S | 3 | R | 0.19 | S | 0.064 | S | 0.19 | S |
| 21076 | 0.023 | S | 32 | R | >32 | R | 24 | R | >256 | R | 1 | S |
| 21072 | 0.064 | S | 6 | R | >32 | R | 12 | R | >256 | R | 0.5 | S |
| 21062 | 0.016 | S | 0.75 | S | 2 | R | 0.19 | S | 0.19 | S | 1 | S |
| 21018 | <0.016 | S | >32 | R | >32 | R | 8 | R | >256 | R | 0.38 | S |
| 12142 | <0.016 | S | 1 | R | 1.5 | R | 0.25 | S | 0.19 | S | 0.25 | S |
| 12137 | <0.016 | S | 1 | R | 1.5 | R | 8 | R | >256 | R | 0.5 | S |
| 12133 | 0.023 | S | 1 | R | 2 | R | 0.064 | S | 0.094 | S | 0.38 | S |
| 12132 | <0.016 | S | 0.75 | S | 8 | R | 24 | R | >256 | R | 0.75 | S |
| 12130 | <0.016 | S | 0.75 | S | 1 | R | 0.125 | S | 0.19 | S | 0.5 | S |
| 12128 | <0.016 | S | >32 | R | >32 | R | >256 | R | >256 | R | 1.5 | S |
| 12122 | <0.016 | S | 0.75 | S | 3 | R | 0.047 | S | 0.094 | S | 0.5 | S |
| 12118 | <0.016 | S | >32 | R | >32 | R | 0.75 | S | 0.75 | S | 0.19 | S |
| 12114 | <0.016 | S | >32 | R | >32 | R | 16 | R | >256 | R | 0.25 | S |
| 12110 | 0.064 | S | >32 | R | >32 | R | 0.125 | S | 0.5 | S | 0.25 | S |
| 12104 | 0.047 | S | >32 | R | >32 | R | >256 | R | >256 | R | 0.75 | S |
| 12094 | <0.016 | S | >32 | R | >32 | R | 48 | R | >256 | R | 1 | S |
| 12086 | 0.38 | S | >32 | R | >32 | R | 12 | R | >256 | R | 12 | R |
| 12073 | <0.016 | S | 0.25 | S | 1.5 | R | 96 | R | >256 | R | 0.125 | S |
| 12058 | 0.047 | S | 1 | R | 4 | R | 0.19 | S | 0.094 | S | 0.5 | S |
| 12057 | 0.032 | S | >32 | R | >32 | R | 0.19 | S | 0.19 | S | 0.5 | S |
| 12050 | 0.047 | S | 1 | R | 1.5 | R | 0.047 | S | 0.38 | S | 0.5 | S |
| 12048 | <0.016 | S | >32 | R | >32 | R | 6 | R | >256 | R | 0.75 | S |
| 11142 | 0.023 | S | >32 | R | >32 | R | 24 | R | >256 | R | 0.75 | S |
| 11091 | <0.016 | S | >32 | R | >32 | R | >256 | R | >256 | R | 0.5 | S |
| 11085 | <0.016 | S | >32 | R | >32 | R | 0.19 | S | 0.19 | S | 0.75 | S |
| 11083 | <0.016 | S | 2 | R | 3 | R | 16 | R | >256 | R | 0.25 | S |
| 11077 | 0.047 | S | 3 | R | 4 | R | 32 | R | >256 | R | 0.5 | S |
| 11073 | 0.016 | S | >32 | R | >32 | R | 0.094 | S | 0.38 | S | 0.5 | S |
| 11072 | <0.016 | S | >32 | R | >32 | R | 0.38 | S | 0.19 | S | 1 | S |
| 11071 | 0.064 | S | >32 | R | >32 | R | >256 | R | >256 | R | 1 | S |
| 11065 | <0.016 | S | >32 | R | >32 | R | 16 | R | >256 | R | 0.25 | S |
| 11057 | <0.016 | S | >32 | R | >32 | R | 12 | R | >256 | R | 2 | S |
| 11056 | <0.016 | S | >32 | R | >32 | R | >256 | R | >256 | R | 1 | S |
| 11050 | <0.016 | S | >32 | R | >32 | R | 32 | R | >256 | R | 0.38 | S |
| 11039 | 0.25 | S | >32 | R | >32 | R | 0.75 | S | 8 | R | 4 | R |
| 11022 | 0.047 | S | 6 | R | >32 | R | 16 | R | >256 | R | 0.38 | S |
| 2402 | 0.023 | S | >32 | R | 32 | R | 48 | R | >256 | R | 2 | S |
| Strains | Mutation Sites | |||||||
|---|---|---|---|---|---|---|---|---|
| AMX | LEV/MOX | CLA/AZI | TET | |||||
| pbp1A | pbp1A | pbp1A | gyrA | gyrA | gyrA | 23S rRNA | 16S rRNA | |
| A1240C | C1667G | A1684T | C261TAG | G271AT | T573GC | A2143G | A928C | |
| 32141 | A | C | A | A | G | T | A | A |
| 32130 | A | C | A | T | G | T | A | A |
| 32126 | A | C | A | T | G | T | A | A |
| 32115 | A | C | A | C | G | T | G | A |
| 32078 | A | C | A | T | G | T | A | A |
| 32041 | A | C | A | T | G | T | G | A |
| 31135 | A | C | A | C | G | T | A | A |
| 31123 | A | C | A | T/G | G | T | G | A |
| 31078 | A | C | A | T | G | T | A | A |
| 31073 | A | C | A | T | A | T | A | A |
| 31058 | A | C | A | C | G | T | G | A |
| 22105 | A | C | A | T | G | T | A | A |
| 22104 | A | C | A | C | A | T | A | A |
| 22103 | A | C | A | C | G | T | G | A |
| 22100 | A | C | A | T | G | T | G | A |
| 22098 | A | C | A | T | G | T | A | A |
| 22096 | A | C | A | C | G | T | A | A |
| 22092 | A | C | A | G | G | T | G | A |
| 22090 | A | C | A | A/C | G | T | G | A |
| 22089 | A | C | A | C | G | T | G | A |
| 22075 | A | C | A | A | G | T | G | A |
| 22070 | A | C | A | T | A | T | A | A |
| 22061 | A | C | A | A | G | T | G | A |
| 22059 | A | C | A | C | G | T | G | C |
| 22058 | A | C | NoCall | C | G | T | G | A |
| 22051 | A | C | A | A | G | T | G | A |
| 22049 | A | C | A | A | G | T | G | A |
| 22027 | A | C | A | T | G | T | G | A |
| 22024 | A | C | A | C | G | T | A | A |
| 21076 | A | C | A | A | G | G | G | A |
| 21072 | A | C | A | T | G | T | G | A |
| 21062 | A | C | A | T | G | T | A | A |
| 21018 | A | C | A | T | G | T | G | A |
| 12142 | A | C | A | C | G | T | A | A |
| 12137 | A | NoCall | A | T | T | T | G | A |
| 12133 | A | C | A | T | G | T | A | A |
| 12132 | A | C | A | A | G | T | A | A |
| 12130 | A | NoCall | A | T | T | T | A | A |
| 12128 | A | C | A | G | G | T | G | A |
| 12122 | A | C | A | C | G | T | A | A |
| 12118 | A | C | A | A | G | T | A | A |
| 12114 | A | C | A | C | G | T | G | A |
| 12110 | A | C | A | T | G | T | A | A |
| 12104 | A | C | T | T/C | G/A | T | G | A |
| 12094 | A | C | A | G | G | T | G | A |
| 12086 | A | C | A | C | G | T | G | A |
| 12073 | A | C | A | T | G | T | A | A |
| 12058 | A | C | A | T | G | T | A | A |
| 12057 | A | C | A | A/C | G | T | A | A |
| 12050 | A | C | A | C | G | T | A | A |
| 12048 | A | C | A | T | T | T | G | A |
| 11142 | A | C | A | T | A | T | G | A |
| 11091 | A | C | A | T/G | G/A | T | G | A |
| 11085 | A | C | A | A/G | G | T | A | A |
| 11083 | A | C | A | T | G | T | G | A |
| 11077 | A | C | A | C | G | T | G | A |
| 11073 | A | C | A | A | T | T | A | A |
| 11072 | A | C | A | A | G | T | A | A |
| 11071 | A | C | A | T | T | T | G | A |
| 11065 | A | C | A | T | T | T | G | A |
| 11057 | A | C | A | T | T | T | G | A |
| 11056 | A | C | A | A | G | T | G | A |
| 11050 | A | C | A | T | G/A | T | A/G | A |
| 11039 | A | C | A/T | T | G | T | A | A |
| 11022 | A | C | T | T | A | T | G | A |
| 2402 | A | C | A | T | A | T | G | A |
| Antibiotics | mPCR-MS Mini-Sequencing Technology Results | DST Results | Consistency Rate | |
|---|---|---|---|---|
| Resistance (Count) | Susceptibility (Count) | |||
| AMX | mutation (count) | 0 | 3 | 95.5% |
| non-mutation (count) | 0 | 63 | ||
| MOX | mutation (count) | 51 | 0 | 77.3% |
| non-mutation (count) | 15 | 0 | ||
| LEV | mutation (count) | 43 | 8 | 68.2% |
| non-mutation (count) | 13 | 2 | ||
| CLA | mutation (count) | 37 | 0 | 93.9% |
| non-mutation (count) | 4 | 25 | ||
| AZI | mutation (count) | 37 | 0 | 92.4% |
| non-mutation (count) | 5 | 24 | ||
| TET | mutation (count) | 1 | 0 | 97.0% |
| non-mutation (count) | 2 | 63 | ||
| Antibiotics | Genes | Mutation Sites | Mutations |
|---|---|---|---|
| AMX | pbp1A | 1240 | A→C |
| 1667 | C→G | ||
| 1684 | A→T | ||
| LEV | gyrA | 261 | C→T/A/G |
| 271 | G→A/T | ||
| MOX | 573 | T→G/C | |
| CLA | 23S rRNA | 2143 | A→G |
| AZI | |||
| TET | 16S rRNA | 928 | A→C |
| Genes | Mutation Sites | Mass Probes | Mass Probe Tubes |
|---|---|---|---|
| 23S rRNA | 2143 | HP BP3 | B a-23S rRNA-2143F |
| pbp1A | 1667 | HP AP1a | A a-pbp1A-1667Fa |
| HP AP1b | A-pbp1A-1667Fb | ||
| 1684 | HP AP5a | A-pbp1A-1684Ra | |
| HP AP5b | A-pbp1A-1684Rb | ||
| 1240 | HP AP2a | A-pbp1A-1240Fa | |
| HP AP2b | A-pbp1A-1240Fb | ||
| gyrA | 261 | HP BP4 | B-gyrA-261F |
| 271 | HP AP4 | A-gyrA-271F | |
| 573 | HP AP3 | A-gyrA-573R | |
| 16S rRNA | 928 | HP BP6 | B-16S rRNA-928R |
| Genes | Mutation Sites | Primer Name | Fixed Sequence | Primer Sequences (5′-3′) | Complete Primer Sequences (5′-3′) |
|---|---|---|---|---|---|
| 23S rRNA | 2143 | HP 1F | acgttggatg | GGGAGCTGTCTCAACCAGAG | acgttggatgGGGAGCTGTCTCAACCAGAG |
| 2143 | HP 1R | acgttggatg | CAAAGCCTCCCACCTATCCT | acgttggatgCAAAGCCTCCCACCTATCCT | |
| pbp1A | 1667 1684 | HP 2F | acgttggatg | GGAGTTTGGCTCGCATTAAA | acgttggatgGGAGTTTGGCTCGCATTAAA |
| 1667 1684 | HP 2R | acgttggatg | GCCAATAGGCGTGTTATCGT | acgttggatgGCCAATAGGCGTGTTATCGT | |
| 1240 | HP 3F | acgttggatg | GCGCGAAAYTTTGAAAATG | acgttggatgGCGCGAAAYTTTGAAAATG | |
| 1240 | HP 3R | acgttggatg | AGCCAAGCTGATCGCTTAAA | acgttggatgAGCCAAGCTGATCGCTTAAA | |
| gyrA | 261 271 | HP 4F | acgttggatg | TAGGATCGTGGGTGATGTGA | acgttggatgTAGGATCGTGGGTGATGTGA |
| 261 271 | HP 4R | acgttggatg | CAGCGTTATCGCCATCAATA | acgttggatgCAGCGTTATCGCCATCAATA | |
| 573 | HP 5F | acgttggatg | AGCCGTCTGCCTAACCTTTT | acgttggatgAGCCGTCTGCCTAACCTTTT | |
| 573 | HP 5R | acgttggatg | TCAGGCCCTTTGACAAATTC | acgttggatgTCAGGCCCTTTGACAAATTC | |
| 16S rRNA | 928 | HP 6F | acgttggatg | CGGTCGCAAGATTAAAACTCA | acgttggatgCGGTCGCAAGATTAAAACTCA |
| 928 | HP 6R | acgttggatg | GCAGCACCTGTTTTCAAGGT | acgttggatgGCAGCACCTGTTTTCAAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, F.; Zhao, X.; Zhang, H.; He, L.; Meng, F.; Zhang, J.; Xiao, D. Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics. Int. J. Mol. Sci. 2025, 26, 1632. https://doi.org/10.3390/ijms26041632
Zhao F, Zhao X, Zhang H, He L, Meng F, Zhang J, Xiao D. Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics. International Journal of Molecular Sciences. 2025; 26(4):1632. https://doi.org/10.3390/ijms26041632
Chicago/Turabian StyleZhao, Fei, Xin Zhao, Huifang Zhang, Lihua He, Fanliang Meng, Jianzhong Zhang, and Di Xiao. 2025. "Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics" International Journal of Molecular Sciences 26, no. 4: 1632. https://doi.org/10.3390/ijms26041632
APA StyleZhao, F., Zhao, X., Zhang, H., He, L., Meng, F., Zhang, J., & Xiao, D. (2025). Multiplex PCR–Mass Spectrometry Mini-Sequencing Technology Detected Antibiotic Resistance of Helicobacter pylori to Six Antibiotics. International Journal of Molecular Sciences, 26(4), 1632. https://doi.org/10.3390/ijms26041632

