Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis
Abstract
1. Introduction
2. Results
2.1. Identification and Sequence Characterization of gh/prl/sl Ligand and Receptor Family Members
2.2. Phylogenetic Analysis of gh/prl/sl Family
2.3. Conserved Domain, Gene Structure and Motif Composition
2.4. Protein–Protein Interaction (PPI) Network Analysis and Tissue Distribution of gh/prl/sl Family Members in the C. semilaevis
2.5. Spatiotemporal Expression Patterns of gh, prl, and sl
2.6. Differences in Genomic Structure Between Male, Female, and Pseudo-Male gh
2.7. The Fluorescence Resonance Energy Transfer (FRET) Efficiency for the Binding Relationship Between gh, sl and ghra, ghrb
2.8. Knock-Down Effects on gh, sl, prl, and Other Related Genes by RNAi Transfection in Pituitary Cells
3. Discussion
4. Materials and Methods
4.1. Animal Euthanasia and Ethics Statement
4.2. Fish Preparation and Sample Collection
4.3. Sequence Retrieval and Analyses
4.4. Phylogenetic Tree and Structural Analysis
4.5. Interaction Network Analysis and Tissue Expression Analysis
4.6. Spatiotemporal Expression Analysis
4.7. Genomic DNA Sequences for gh Gene from Female, Male, and Pseudo-Male C. semilaevis
4.8. The Fluorescence Resonance Energy Transfer (FRET) Efficiency for the Binding Relationship Between sl and ghra
4.9. Design and Transfection of RNAi in Female C. semilaevis Pituitary Cell Lines
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
gh | growth hormone |
prl | prolactin |
prl2 | prolactin 2 |
sl | somatolactin |
ghr | growth hormone receptor |
slr | somatolactin receptor |
prlr | prolactin receptor |
vip | vasoactive intestinal peptide |
pomc | pro-opiomelanocortin |
pou1f1 | pou Class 1 Homeobox 1 |
FRET | The Fluorescence Resonance Energy Transfer |
Appendix A
Species | Protein | Accession Number |
---|---|---|
Cynoglossus semilaevis | gh1 | NP_001281140.1 |
prl | XP_008328937.1 | |
prl2 | XP_024913906.1 | |
prl2-like | XP_024912122.1 | |
smtla | XP_008306726.1 | |
ghra | NP_001281126.1 | |
ghrb | NP_001315166.1 | |
prlr | XP_008324293.1 | |
prlrb | XP_008334066.1 | |
prlr-like | XP_024918466.1 | |
Sparus aurata | gh1 | XP_030262341.1 |
ghra | XP_030273854.1 | |
ghrb | XP_030292100.1 | |
prlrb | XP_030272992.1 | |
prlra | XP_030292731.1 | |
Homo sapiens | gh1 | NP_000506.2 |
prl | NP_000939.1 | |
ghr | NP_000154.1 | |
prlr | NP_000940.1 | |
Mus musculus | gh1 | NP_032143.1 |
prl | NP_001157002.1 | |
ghr | NP_001041643.1 | |
prlr | NP_001240710.1 | |
Danio rerio | gh1 | NP_001018328.2 |
prl | NP_852102.2 | |
smtla | NP_001032795.1 | |
smtlb | NP_001032763.1_ | |
ghra | NP_001077047.1 | |
ghrb | NP_001104551.1 | |
prlra | XP_021324476.1 | |
Scophthalmus maximus | prl | XP_035470397.1 |
prl2 | XP_035483075.1 | |
smtla | XP_035479871.1 | |
ghra | XP_035496335.1 | |
ghrb | XP_047185503.1 | |
prlra | XP_035464595.2 | |
prlrb | XP_035497061.1 | |
Oryzias latipes | smtla | NP_001098260.1_ |
prlra | XP_011479970.1 | |
prlrb | XP_004072141.1 | |
ghra | NP_001098560.1 | |
ghrb | NP_001116377.1 | |
Salmao salar | prl | XP_008328937.1 |
prl2a | XP_045578518.1 | |
slr | NP_001135089.1 | |
Oncorhynchus mykiss | gh2 | NP_001118162.2 |
gh1 | NP_001118161.1 | |
prl | NP_001118205.1 | |
Thunnus maccoyii | gh1 | XP_042247785.1 |
prl2 | XP_042259945.1 | |
smtla | XP_042270649.1 | |
Oreochromis niloticus | prl | NP_001266715.1 |
Poecilia latipinna | prl | XP_014877782.1 |
Takifugu rubripe | smtla | XP_029700280.1 |
prl | NP_001072092.1 | |
prl2a | XP_029681130.1 | |
prl2b | XP_029681130.1 | |
Scophthalmus maximus | prl | XP_035470397.1 |
prl2 | XP_035483075.1 | |
smtla | XP_035479871.1 | |
Hippoglossus stenolepis | prl-like | XP_047195737.1 |
Oncorhynchus masou | slr | NP_001281140.1 |
Solea senegalensis | prlra | XP_008328937.1 |
Hippoglossus hippoglossus | prlra | XP_034458243.1 |
prlrb | XP_034450669.1 | |
prlr-like | XP_034466717.1 | |
Paralichthys olivaceus | prlra | NP_001281126.1 |
prlrb | NP_001315166.1 | |
prlr-like | XP_008324293.1 |
References
- Dean, R.; Mank, J.E. The role of sex chromosomes in sexual dimorphism: Discordance between molecular and phenotypic data. J. Evol. Biol. 2014, 27, 1443–1453. [Google Scholar] [CrossRef] [PubMed]
- Kappeler, P.M. The evolution of sexual size dimorphism in prosimian primates. Am. J. Primatol. 1990, 21, 201–214. [Google Scholar] [CrossRef] [PubMed]
- Leinonen, T.; Cano, J.M.; Merilä, J. Genetic basis of sexual dimorphism in the threespine stickleback Gasterosteus aculeatus. Heredity 2011, 106, 218–227. [Google Scholar] [CrossRef]
- Horne, C.R.; Hirst, A.G.; Atkinson, D. Selection for increased male size predicts variation in sexual size dimorphism among fish species. Proc Biol Sci 2020, 287, 20192640. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, W.; Jian, Y.; Zhang, S.; Liu, D.; Zheng, K.; Tan, X.; You, F.; Pang, Q.; Jiao, S. Identification of candidate genes and pathways involved in the establishment of sexual size dimorphism in the olive flounder (Paralichthys olivaceus) using RNA-seq. Aquaculture 2025, 595, 741604. [Google Scholar] [CrossRef]
- Yao, X.; Zhou, Y.; Nyirenda, K.; Song, Y.; Ma, C.; Qian, K.; Zhao, Y.; Tang, S.; Zhao, J. Characterization of sexual size dimorphism in mandarin fish and association with igfbp-5a/b regulation. Fish Physiol. Biochem. 2024, 50, 2301–2313. [Google Scholar] [CrossRef]
- Li, X.; Yang, Q.; Shi, R.; Xu, X.; Chen, Z.; Chen, S.; Wang, N. Genome-wide identification of insulin-like growth factor-binding protein family in Chinese tongue sole (Cynoglossus semilaevis) and their responses to sex steroids. Aquaculture 2022, 557, 738346. [Google Scholar] [CrossRef]
- Wang, N.; Wang, R.; Wang, R.; Chen, S. Transcriptomics analysis revealing candidate networks and genes for the body size sexual dimorphism of Chinese tongue sole (Cynoglossus semilaevis). Funct. Integr. Genom. 2018, 18, 327–339. [Google Scholar] [CrossRef]
- Li, S.; Crenshaw, E.B., 3rd; Rawson, E.J.; Simmons, D.M.; Swanson, L.W.; Rosenfeld, M.G. Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1. Nature 1990, 347, 528–533. [Google Scholar] [CrossRef]
- Fontaine, R.; Rahmad Royan, M.; Henkel, C.; Hodne, K.; Ager-Wick, E.; Weltzien, F.A. Pituitary multi-hormone cells in mammals and fish: History, origin, and roles. Front. Neuroendocrinol. 2022, 67, 101018. [Google Scholar] [CrossRef]
- Royan, M.R.; Siddique, K.; Csucs, G.; Puchades, M.A.; Nourizadeh-Lillabadi, R.; Bjaalie, J.G.; Henkel, C.V.; Weltzien, F.A.; Fontaine, R. 3D Atlas of the Pituitary Gland of the Model Fish Medaka (Oryzias latipes). Front. Endocrinol. 2021, 12, 719843. [Google Scholar] [CrossRef] [PubMed]
- Onuma, T.A.; Ban, M.; Makino, K.; Katsumata, H.; Hu, W.; Ando, H.; Fukuwaka, M.A.; Azumaya, T.; Urano, A. Changes in gene expression for GH/PRL/SL family hormones in the pituitaries of homing chum salmon during ocean migration through upstream migration. Gen. Comp. Endocrinol. 2010, 166, 537–548. [Google Scholar] [CrossRef]
- Ocampo Daza, D.; Larhammar, D. Evolution of the growth hormone, prolactin, prolactin 2 and somatolactin family. Gen. Comp. Endocrinol. 2018, 264, 94–112. [Google Scholar] [CrossRef]
- Li, C.H.; Evans, H.M. The Isolation of Pituitary Growth Hormone. Science 1944, 99, 183–184. [Google Scholar] [CrossRef]
- Chang, C.W.; Sung, Y.W.; Hsueh, Y.W.; Chen, Y.Y.; Ho, M.; Hsu, H.C.; Yang, T.C.; Lin, W.C.; Chang, H.M. Growth hormone in fertility and infertility: Mechanisms of action and clinical applications. Front. Endocrinol. 2022, 13, 1040503. [Google Scholar] [CrossRef]
- Ipsa, E.; Cruzat, V.F.; Kagize, J.N.; Yovich, J.L.; Keane, K.N. Growth Hormone and Insulin-Like Growth Factor Action in Reproductive Tissues. Front. Endocrinol. 2019, 10, 777. [Google Scholar] [CrossRef]
- Baumann, G.P. Growth hormone isoforms. Growth Horm. IGF Res. 2009, 19, 333–340. [Google Scholar] [CrossRef]
- Ber, R.; Daniel, V. Sequence analysis suggests a recent duplication of the growth hormone-encoding gene in Tilapia nilotica. Gene 1993, 125, 143–150. [Google Scholar] [CrossRef]
- Oscar, R.; Bates, R.W.; Dykshorn, S.W. The Preparation, Identification and Assay of Prolactin—A Hormone of the Anterior Pituitary. Am. J. Physiol. Leg. Content 1933, 105, 191–216. [Google Scholar]
- Freeman, M.E.; Kanyicska, B.; Lerant, A.; Nagy, G. Prolactin: Structure, Function, and Regulation of Secretion. Physiol. Rev. 2000, 80, 1523–1631. [Google Scholar] [CrossRef]
- Horseman, N.D. Prolactin and mammary gland development. J. Mammary Gland Biol. Neoplasia 1999, 4, 79–88. [Google Scholar] [CrossRef] [PubMed]
- Kawauchi, H.; Abe, K.-I.; Takahashi, A.; Hirano, T.; Hasegawa, S.; Naito, N.; Nakai, Y. Isolation and properties of chum salmon prolactin. Gen. Comp. Endocrinol. 1983, 49, 446–458. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Hui, M.N.; Liu, Y.; Yuen, D.S.; Zhang, Y.; Chan, W.Y.; Lin, H.R.; Cheng, S.H.; Cheng, C.H. Discovery of a novel prolactin in non-mammalian vertebrates: Evolutionary perspectives and its involvement in teleost retina development. PLoS ONE 2009, 4, e6163. [Google Scholar] [CrossRef]
- Rand-Weaver, M.; Baker, B.J.; Kawauchi, H. Cellular localization of somatolactin in the pars intermedia of some teleost fishes. Cell Tissue Res. 1991, 263, 207–215. [Google Scholar] [CrossRef]
- Zhu, Y.; Stiller, J.W.; Shaner, M.P.; Baldini, A.; Scemama, J.L.; Capehart, A.A. Cloning of somatolactin alpha and beta cDNAs in zebrafish and phylogenetic analysis of two distinct somatolactin subtypes in fish. J. Endocrinol. 2004, 182, 509–518. [Google Scholar] [CrossRef]
- Benedet, S.; Björnsson, B.T.; Taranger, G.L.; Andersson, E. Cloning of somatolactin alpha, beta forms and the somatolactin receptor in Atlantic salmon: Seasonal expression profile in pituitary and ovary of maturing female broodstock. Reprod. Biol. Endocrinol. 2008, 6, 42. [Google Scholar] [CrossRef]
- Fukamachi, S.; Sugimoto, M.; Mitani, H.; Shima, A. Somatolactin selectively regulates proliferation and morphogenesis of neural-crest derived pigment cells in medaka. Proc. Natl. Acad. Sci. USA 2004, 101, 10661–10666. [Google Scholar] [CrossRef]
- Jiang, Q.; Ko, W.K.; Wong, A.O. Insulin-like growth factor as a novel stimulator for somatolactin secretion and synthesis in carp pituitary cells via activation of MAPK cascades. Am. J. Physiol. Endocrinol. Metab. 2011, 301, E1208–E1219. [Google Scholar] [CrossRef]
- Pantel, J.; Machinis, K.; Sobrier, M.L.; Duquesnoy, P.; Goossens, M.; Amselem, S. Species-specific alternative splice mimicry at the growth hormone receptor locus revealed by the lineage of retroelements during primate evolution. J. Biol. Chem. 2000, 275, 18664–18669. [Google Scholar] [CrossRef]
- Jiao, B.; Huang, X.; Chan, C.B.; Zhang, L.; Wang, D.; Cheng, C.H. The co-existence of two growth hormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonal regulation of expression in seabream. J. Mol. Endocrinol. 2006, 36, 23–40. [Google Scholar] [CrossRef]
- Saera-Vila, A.; Calduch-Giner, J.A.; Pérez-Sánchez, J. Duplication of growth hormone receptor (GHR) in fish genome: Gene organization and transcriptional regulation of GHR type I and II in gilthead sea bream (Sparus aurata). Gen. Comp. Endocrinol. 2005, 142, 193–203. [Google Scholar] [CrossRef] [PubMed]
- Sandra, O.; Sohm, F.; de Luze, A.; Prunet, P.; Edery, M.; Kelly, P.A. Expression cloning of a cDNA encoding a fish prolactin receptor. Proc. Natl. Acad. Sci. USA 1995, 92, 6037–6041. [Google Scholar] [CrossRef] [PubMed]
- Tse, D.L.; Chow, B.K.; Chan, C.B.; Lee, L.T.; Cheng, C.H. Molecular cloning and expression studies of a prolactin receptor in goldfish (Carassius auratus). Life Sci. 2000, 66, 593–605. [Google Scholar] [CrossRef]
- Santos, C.R.; Ingleton, P.M.; Cavaco, J.E.; Kelly, P.A.; Edery, M.; Power, D.M. Cloning, characterization, and tissue distribution of prolactin receptor in the sea bream (Sparus aurata). Gen. Comp. Endocrinol. 2001, 121, 32–47. [Google Scholar] [CrossRef]
- Rentier-Delrue, F.; Swennen, D.; Prunet, P.; Lion, M.; Martial, J.A. Tilapia prolactin: Molecular cloning of two cDNAs and expression in Escherichia coli. DNA 1989, 8, 261–270. [Google Scholar] [CrossRef]
- Fukamachi, S.; Meyer, A. Evolution of receptors for growth hormone and somatolactin in fish and land vertebrates: Lessons from the lungfish and sturgeon orthologues. J. Mol. Evol. 2007, 65, 359–372. [Google Scholar] [CrossRef][Green Version]
- Moroki, Y.; Komori, M.; Ogawa, Y.; Nagumo, E.; Ohno, H.; Fukamachi, S. An Attempt to Identify the Medaka Receptor for Somatolactin Alpha Using a Reverse Genetics Approach. Genes 2023, 14, 796. [Google Scholar] [CrossRef]
- Pfab, A.; Bruckmann, A.; Nazet, J.; Merkl, R.; Grasser, K.D. The Adaptor Protein ENY2 Is a Component of the Deubiquitination Module of the Arabidopsis SAGA Transcriptional Co-activator Complex but not of the TREX-2 Complex. J. Mol. Biol. 2018, 430, 1479–1494. [Google Scholar] [CrossRef]
- Yao, R.W.; Xu, G.; Wang, Y.; Shan, L.; Luan, P.F.; Wang, Y.; Wu, M.; Yang, L.Z.; Xing, Y.H.; Yang, L.; et al. Nascent Pre-rRNA Sorting via Phase Separation Drives the Assembly of Dense Fibrillar Components in the Human Nucleolus. Mol. Cell 2019, 76, 767–783.e711. [Google Scholar] [CrossRef]
- Williams, T.M.; Carroll, S.B. Genetic and molecular insights into the development and evolution of sexual dimorphism. Nat. Rev. Genet. 2009, 10, 797–804. [Google Scholar] [CrossRef]
- Ji, X.-S.; Chen, S.-L.; Jiang, Y.-L.; Xu, T.-J.; Yang, J.-F.; Tian, Y.-S. Growth differences and differential expression analysis of pituitary adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing hormone (GHRH) between the sexes in half-smooth tongue sole Cynoglossus semilaevis. Gen. Comp. Endocrinol. 2011, 170, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Tian, Y.; Zhang, J.; Li, Z.; Cheng, M.; Wu, Y. Involvement of glycolysis activation in flatfish sexual size dimorphism: Insights from transcriptomic analyses of Platichthys stellatus and Cynoglossus semilaevis. Comp. Biochem. Physiol. Part D: Genom. Proteom. 2021, 39, 100832. [Google Scholar] [CrossRef] [PubMed]
- Hall, J.C. Control of male reproductive behavior by the central nervous system of Drosophila: Dissection of a courtship pathway by genetic mosaics. Genetics 1979, 92, 437–457. [Google Scholar] [CrossRef]
- Tompkins, L.; Hall, J.C. Identification of Brain Sites Controlling Female Receptivity in Mosaics of Drosophila melanogaster. Genetics 1983, 103, 179–195. [Google Scholar] [CrossRef]
- Yamaguchi, Y.; Takagi, W.; Kuraku, S.; Moriyama, S.; Bell, J.D.; Seale, A.P.; Lerner, D.T.; Grau, E.G.; Hyodo, S. Discovery of conventional prolactin from the holocephalan elephant fish, Callorhinchus milii. Gen. Comp. Endocrinol. 2015, 224, 216–227. [Google Scholar] [CrossRef]
- Gong, N.; Ferreira-Martins, D.; Norstog, J.L.; McCormick, S.D.; Sheridan, M.A. Discovery of prolactin-like in lamprey: Role in osmoregulation and new insight into the evolution of the growth hormone/prolactin family. Proc. Natl. Acad. Sci. USA 2022, 119, e2212196119. [Google Scholar] [CrossRef]
- Ocampo Daza, D.; Sundström, G.; Larsson, T.A.; Larhammar, D. Evolution of the growth hormone-prolactin-somatolactin system in relation to vertebrate tetraploidizations. Ann. NY Acad. Sci. 2009, 1163, 491–493. [Google Scholar] [CrossRef]
- Ma, Q.; Liu, S.; Zhuang, Z.; Lin, L.; Sun, Z.; Liu, C.; Ma, H.; Su, Y.; Tang, Q. Genomic structure, polymorphism and expression analysis of the growth hormone (GH) gene in female and male Half-smooth tongue sole (Cynoglossus semilaevis). Gene 2012, 493, 92–104. [Google Scholar] [CrossRef]
- Dias, C.; Elzein, S.; Sladek, R.; Goodyer, C.G. Sex-specific effects of a microsatellite polymorphism on human growth hormone receptor gene expression. Mol. Cell. Endocrinol. 2019, 492, 110442. [Google Scholar] [CrossRef]
- Li, Y.C.; Korol, A.B.; Fahima, T.; Nevo, E. Microsatellites within genes: Structure, function, and evolution. Mol. Biol. Evol. 2004, 21, 991–1007. [Google Scholar] [CrossRef]
- Fukada, H.; Ozaki, Y.; Pierce, A.L.; Adachi, S.; Yamauchi, K.; Hara, A.; Swanson, P.; Dickhoff, W.W. Identification of the salmon somatolactin receptor, a new member of the cytokine receptor family. Endocrinology 2005, 146, 2354–2361. [Google Scholar] [CrossRef] [PubMed]
- Di Prinzio, C.M.; Botta, P.; Barriga, E.H.; Rios, E.A.; Reyes, A.E.; Arranz, S.E. Growth hormone receptors in zebrafish (Danio rerio): Adult and embryonic expression patterns. Gene Expr. Patterns 2010, 10, 214–225. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Sun, D.; Jiang, J.; Deng, L.; Zhang, Y.; Yu, H.; Bahl, D.; Langenheim, J.F.; Chen, W.Y.; Fuchs, S.Y.; et al. The Role of Prolactin Receptor in GH Signaling in Breast Cancer Cells. Mol. Endocrinol. 2013, 27, 266–279. [Google Scholar] [CrossRef]
- Wang, D.; Qin, J.; Jia, J.; Yan, P.; Li, W. Pou1f1, the key transcription factor related to somatic growth in tilapia (Orechromis niloticus), is regulated by two independent post-transcriptional regulation mechanisms. Biochem. Biophys. Res. Commun. 2017, 483, 559–565. [Google Scholar] [CrossRef]
- Gozes, I.; Brenneman, D.E. VIP: Molecular biology and neurobiological function. Mol. Neurobiol. 1989, 3, 201–236. [Google Scholar] [CrossRef]
- Ruberg, M.; Rotsztejn, W.H.; Arancibia, S.; Besson, J.; Enjalbert, A. Stimulation of prolactin release by vasoactive intestinal peptide (VIP). Eur. J. Pharmacol. 1978, 51, 319–320. [Google Scholar] [CrossRef]
- Quaresma, P.G.F.; Teixeira, P.D.S.; Furigo, I.C.; Wasinski, F.; Couto, G.C.; Frazão, R.; List, E.O.; Kopchick, J.J.; Donato, J., Jr. Growth hormone/STAT5 signaling in proopiomelanocortin neurons regulates glucoprivic hyperphagia. Mol. Cell. Endocrinol. 2019, 498, 110574. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Ma, A.; Zhang, J.; Yang, S.; Cui, W.; Xia, D.; Qu, J. Cloning and molecular characterization of PRL and PRLR from turbot (Scophthalmus maximus) and their expressions in response to short-term and long-term low salt stress. Fish Physiol. Biochem. 2020, 46, 501–517. [Google Scholar] [CrossRef]
- Shu, Y.; Lou, Q.; Dai, Z.; Dai, X.; He, J.; Hu, W.; Yin, Z. The basal function of teleost prolactin as a key regulator on ion uptake identified with zebrafish knockout models. Sci. Rep. 2016, 6, 18597. [Google Scholar] [CrossRef]
- Rubin, D.A.; Specker, J.L. In vitro effects of homologous prolactins on testosterone production by testes of tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol. 1992, 87, 189–196. [Google Scholar] [CrossRef]
- Singh, H.; Griffith, R.W.; Takahashi, A.; Kawauchi, H.; Thomas, P.; Stegeman, J.J. Regulation of gonadal steroidogenesis in Fundulus heteroclitus by recombinant salmon growth hormone and purified salmon prolactin. Gen. Comp. Endocrinol. 1988, 72, 144–153. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Huang, X.; Yuen, D.S.; Cheng, C.H. A study on the functional interaction between the GH/PRL family of polypeptides with their receptors in zebrafish: Evidence against GHR1 being the receptor for somatolactin. Mol. Cell. Endocrinol. 2011, 337, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.Y.; Arab, M.; Chen, T.T. Cloning and characterization of rainbow trout (Oncorhynchus mykiss) somatolactin cDNA and its expression in pituitary and nonpituitary tissues. Gen. Comp. Endocrinol. 1997, 106, 271–280. [Google Scholar] [CrossRef]
- Ashcom, G.; Gurland, G.; Schwartz, J. Growth hormone synergizes with serum growth factors in inducing c-fos transcription in 3T3-F442A cells. Endocrinology 1992, 131, 1915–1921. [Google Scholar] [CrossRef]
- Wang, Z.Q.; Ovitt, C.; Grigoriadis, A.E.; Möhle-Steinlein, U.; Rüther, U.; Wagner, E.F. Bone and haematopoietic defects in mice lacking c-fos. Nature 1992, 360, 741–745. [Google Scholar] [CrossRef]
- Accorsi, P.A.; Pacioni, B.; Pezzi, C.; Forni, M.; Flint, D.J.; Seren, E. Role of Prolactin, Growth Hormone and Insulin-Like Growth Factor 1 in Mammary Gland Involution in the Dairy Cow. J. Dairy Sci. 2002, 85, 507–513. [Google Scholar] [CrossRef]
- Koouman, R.; Hooghe-Peters, E.L.; Hooghe, R. Prolactin, Growth Hormone, and Insulin-like Growth Factor-I in the Immune System. In Advances in Immunology; Dixon, F.J., Ed.; Academic Press: Cambridge, MA, USA, 1996; Volume 63, pp. 377–454. [Google Scholar]
Name | Gene ID | Gene Length (bp) | ORF Length (bp) | Amino Length (aa) | MW (kDa) | pI | Chr | Location | No. of Exons |
---|---|---|---|---|---|---|---|---|---|
gh | 103387754 | 2358 | 603 | 200 | 23.15 | 7.04 | 12 | 16,479,910–16,482,267 | 6 |
sl | 103377636 | 3334 | 699 | 232 | 26.73 | 5.76 | 4 | 1,102,903–1,106,236 | 5 |
prl | 103393669 | 1205 | 654 | 217 | 23.66 | 8.32 | 17 | 15,922,112–15,923,316 | 5 |
prl2a | 103383000 | 2061 | 708 | 235 | 27.19 | 6.62 | 8 | 28,798,050–28,800,110 | 5 |
prl2b | 103380354 | 1993 | 762 | 253 | 28.72 | 7.65 | 6 | 14,399,000–14,400,992 | 5 |
ghra | 103397680 | 24,333 | 1902 | 633 | 70.71 | 4.69 | Z | 6,180,207–6,204,539 | 9 |
ghrb | 103389092 | 14,280 | 1686 | 561 | 62.41 | 4.76 | 14 | 1,970,750–1,985,029 | 9 |
prlra | 103390274 | 14,542 | 1860 | 619 | 69.58 | 5.34 | 14 | 25,242,433–25,256,974 | 9 |
prlr-like | 103389689 | 13,111 | 1536 | 511 | 57.99 | 5.94 | 14 | 12,848,157–12,861,267 | 10 |
prlrb | 103397545 | 6636 | 1334 | 443 | 49.03 | 6.64 | Z | 4,468,207–4,474,842 | 9 |
sl + ghra | sl + ghrb | gh + ghra | gh + ghrb | |
---|---|---|---|---|
Donor Pre | 927 | 199 | 547.11 | 556 |
Donor Post | 976.7 | 205 | 578.34 | 577 |
Acceptor Pre | 272.6 | 721.04 | 160.74 | 817.76 |
Acceptor Post | 159.6 | 573.48 | 57 | 455.22 |
Efficiency | 0.050886 | 0.029268 | 0.0534 | 0.036 |
Primer | Sequences (5′–3′) | Information |
---|---|---|
gh-F | ATCCACGCAGCCGGTTATAG | qPCR |
gh-R | CTCATGCTTGTTGTCGGGGA | qPCR |
prl-F | ATTCCAAGAGTCTGGGCGAC | qPCR |
prl -R | CGATCTTGTGGGAATCCCGT | qPCR |
sl-F | CTGCTTGTTTACCGTGAGCG | qPCR |
sl-R | GGAGACGCAGTGGAAAAGGA | qPCR |
gh-DNA-F | GTCAGAATCAGAACCAAACCA | DNA |
gh-DNA-R | ACATATGCCGACAGAATGACA | DNA |
βactin-F | TTCCAGCCTTCCTTCCTT | qPCR |
βactin-R | TACCTCCAGACAGCACAG | qPCR |
gh-cds-F | TAGCGTTTAAACTTAAGCTTATGGACAAACTTGTTTTACTGT | FRET |
gh-cds-R | GAACCGTTGCCAGAGGATCCGGCGGTGCTTCCCTACAGGGTACAGTTAGCTTCT | FRET |
sl-cds-F | TAGCGTTTAAACTTAAGCTTATGCATGCAATGATGACAGTA | FRET |
sl-cds-R | GAACCGTTGCCAGAGGATCCGGCGGTGCTTCCTTATGCACAGTTGTACTTGTC | FRET |
ghra-cds-F | TAGCGTTTAAACTTAAGCTTATGGCTATCCACTCACTCTC | FRET |
ghra-cds-R | GAACCGTTGCCAGAGGATCCGGCGGTGCTTCCGCAAATTTCATGGTGAGAG | FRET |
ghrb-cds-F | TAGCGTTTAAACTTAAGCTTATGGTTGCTGCAGGACTCGG | FRET |
ghrb-cds-R | GAACCGTTGCCAGAGGATCCGGCGGTGCTTCCGGAGATAGAGCTGATTTATGGTG | FRET |
gh-site1 | GCUCAGUCCUGAAUCUCUUTT | RNAi site1 |
gh-site2 | GGACAUGCACAAGGUGGAATT | RNAi site2 |
gh-site3 | GCACAAGGUGGAAACAUAUTT | RNAi site3 |
prl-site1 | CCGUACAUGUGUCACACCUTT | RNAi site1 |
prl-site2 | GACGGGAUUCCCACAAGAUTT | RNAi site2 |
prl-site3 | GAUCGACAGCUUCCUGAAATT | RNAi site3 |
sl-site1 | CCAUCCAAGAUGCCAGUAATT | RNAi site1 |
sl-site2 | GGAUCGAGCCUCUGAUCUATT | RNAi site2 |
sl-site3 | GCACCAGACCUGUUGGAAUTT | RNAi site3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, M.; Shi, Y.; Wang, Z.; Chen, Z.; Li, X.; Xu, W.; Wang, N. Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis. Int. J. Mol. Sci. 2025, 26, 1585. https://doi.org/10.3390/ijms26041585
Zhang M, Shi Y, Wang Z, Chen Z, Li X, Xu W, Wang N. Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis. International Journal of Molecular Sciences. 2025; 26(4):1585. https://doi.org/10.3390/ijms26041585
Chicago/Turabian StyleZhang, Min, Yuhong Shi, Zhe Wang, Zhangfan Chen, Xihong Li, Wenteng Xu, and Na Wang. 2025. "Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis" International Journal of Molecular Sciences 26, no. 4: 1585. https://doi.org/10.3390/ijms26041585
APA StyleZhang, M., Shi, Y., Wang, Z., Chen, Z., Li, X., Xu, W., & Wang, N. (2025). Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis. International Journal of Molecular Sciences, 26(4), 1585. https://doi.org/10.3390/ijms26041585