Next Article in Journal
Genome-Wide Analysis of the Aspartate Aminotransferase Family in Brassica rapa and the Role of BraASP1 in Response to Nitrogen Starvation
Previous Article in Journal
Transcriptome-Wide Insights: Neonatal Lactose Intolerance Promotes Telomere Damage, Senescence, and Cardiomyopathy in Adult Rat Heart
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis

by
Min Zhang
1,
Yuhong Shi
2,
Zhe Wang
2,
Zhangfan Chen
2,3,
Xihong Li
2,3,
Wenteng Xu
2,3 and
Na Wang
2,3,*
1
College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China
2
State Key Laboratory of Mariculture Bioreading and Sustainable Goods, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
3
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao Marine Science and Technology Center, Qingdao 266237, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(4), 1585; https://doi.org/10.3390/ijms26041585
Submission received: 26 December 2024 / Revised: 9 February 2025 / Accepted: 10 February 2025 / Published: 13 February 2025
(This article belongs to the Section Molecular Biology)

Abstract

The Chinese tongue sole (Cynoglossus semilaevis) is a marine flatfish of significant economic value, characterized by pronounced female-biased sexual size dimorphism (SSD). Sexual differences of cell number and gene expression within the PIT-1 lineage of the pituitary gland may be crucial for interpreting the female-biased SSD of C. semilaevis. Among hormones secreted by PIT-1 cell lineage, growth hormone (gh), prolactin (prl), prolactin 2 (prl2), and somatolactin (sl) comprise a gene family within the extensive superfamily of class-1 helical cytokines. To better understand the function of the gh/prl/sl in teleost SSD, we firstly identified five genes of the gh/prl/sl family (gh, sl, prl, prl2a, and prl2b) and their receptors (ghra, ghrb, prlra, prlrb, and prlr-like) from C. semilaevis at the genome-wide level. Phylogenetic analyses revealed that the gh/prl/sl family and their receptors were each clustered into five distinct groups. More microsatellites were revealed in the intron 2 of gh gene of female rather than the male and pseudo-male individuals, which is positively correlated with its sexual expression pattern. Interaction network prediction indicated that gh, prl, and sl may collectively contribute to individual growth and development. A FRET experiment showed that ghra can act as a receptor for sl. Additionally, the transcripts of the gh/prl/sl family and their receptors exhibited varying abundances in the pituitary, brain, gonad, and liver of both female and male C. semilaevis, with most ligands showing the highest abundance in the female pituitary. Furthermore, gh and sl were found to be maternally expressed. The knock-down of gh, prl, and sl in the pituitary cells could lead to the expression change of igf1, c-fos, and sos2. This study provided a foundation for further functional characterization of the gh/prl/sl gene family, contributing to a deeper understanding of the growth and reproductive mechanisms in C. semilaevis.

1. Introduction

Sexual size dimorphism (SSD) has been widely observed in animals including mammals, birds, reptiles, and fishes, characterized by different body or segment sizes in different sexes [1,2,3]. For example, more than 600 fish species exhibit obvious SSD [4], and this phenomenon in farmed fish species could cause growth disadvantages within a single sex, then leading to a decrease in production. Thus, an increasing number of studies have focused on elucidating the molecular mechanism of SSD in farmed fish, including Japanese flounder (Paralichthys olivaceus) [5], Mandarin fish (Siniperca chuatsi) [6], and Chinese tongue sole (Cynoglossus semilaevis) [7,8].
Importantly, our recent integration analysis by scRNA-seq and scATAC-seq revealed that the differences in the cell number and gene expression pattern of the pituitary gland are essential for interpreting female-biased SSD in C. semilaevis, a female heterogamete flatfish. Specifically, pituitary-specific POU homeodomain transcription factor 1 (PIT-1) cell lineages capture our interest because the mutation of PIT-1 in mammals could result in the failure of PIT-1 lineage differentiation, subsequently leading to a dwarf phenotype [9]. In contrast to three kinds of PIT-1 sublineages in mammals somatotrophs, lactotrophs, and thyrotropes, the fourth cell type, somatolactotrophs, were exclusively found in teleost [10,11], including C. semilaevis. Correspondingly, somatotrophs, lactotrophs, somatolactotrophs, and thyrotropes separately secrete growth hormone (gh), prolactin (prl), somatolactin (sl), and thyrotropic hormone (tsh), among which, gh, prl, and sl belong to the same hormone family and are involved in multiple effects including growth regulation, metabolism, energy balance, and osmoregulation [12].
The gh/prl/sl family presumably evolved from a common ancestor through gene duplication [13]. They share similarities in gene and protein tertiary structures, featuring four helices. Gh was first isolated from the human pituitary gland, and its mutation led to a disorder characterized by short stature [14]. Increasing evidence has indicated its multiple roles in regulating growth, metabolism, and reproduction of vertebrates including teleost [15,16]. The heterogeneity of gh has been identified in humans at the genome, mRNA, and post-transcriptional modification levels [17]. Similarly, two duplicated isoforms of gh genes are discovered in fish species, including salmonids and tilapias [18].
Prl was originally described as a polypeptide hormone to promote lactation [19]. Later studies found that prl was also involved in luteal function, reproductive behavior, immune response, osmoregulation, and angiogenesis [20,21]. In teleost, prl was first isolated from chum salmon (Oncorhynchus keta) and has a typical gene structure similar to mammals [22]. So far, three duplicated isoforms of prl genes have been discovered in teleost: prl, prl2a, and prl2b [23].
Sl was first found in the pituitary gland of Atlantic cod (Gadus morhua) and Japanese flounder (Paralichthys olivaceus) [24]. Two isoforms have been isolated, with slα being present in all fish species, and slβ being found only in a limited number of fish species [25]. Like gh and prl, sl have multiple functions in the gonad development, spawning, and body color formation [26,27].
Commonly, gh/prl/sl genes exert multiple biological effects by binding to single transmembrane domain receptors. Binding subsequently causes receptor dimerization and activates Janus kinase 2 (JAK2), a tyrosine kinase that initiates JAK-STAT signaling [28]. Different from two isoforms of ghr transcripts in humans [29], in teleost, ghr is divided into two branches: ghr1 (type I GHR) and ghr2 (type II GHR) [30]; two kinds of ghr genes have duplicated in teleost including salmonids, fugu, and zebrafish [31]. Similarly, two duplicated prlr genes (prlra and prlrb) were also discovered in Nile tilapia (Oreochromis niloticus) [32], goldfish (Carassius auratus) [33], sea bream (Sparus auratus) [34], and rainbow trout (Oncorhynchus mykiss) [35]. Slr has been reported in masu salmon (Oncorhynchus masou), medaka, and other fish species [36], with only one gene.
Given their high structural conservation, the one-to-one correspondence between gh/prl/sl ligands and receptors cannot be easily derived. To date, there is still much controversy regarding their binding relationship. For instance, in zebrafish, it was found that two sl genes did not physically interact with ghr1, while slr and ghr could both interact with gh of medaka [37].
To better understand the function of the gh/prl/sl family in teleost SSD, we first identified the members of the gh/prl/sl family and their receptors at the genome-wide level. Subsequently, a phylogenetic tree was constructed to reveal evolutionary relationships. In addition, conserved domains/motifs and protein interaction networks were analyzed. As well as their spatiotemporal expression patterns were detected, and the interaction of ligand receptors within the gh/prl/sl family was explored. Finally, the knock-down effect of important ligands on the downstream genes was studied.

2. Results

2.1. Identification and Sequence Characterization of gh/prl/sl Ligand and Receptor Family Members

A domain search of the whole genome of C. semilaevis identified five genes in the gh/prl/sl family: gh, sl, prl, prl2b, and prl2a (Table 1), located in different autosomes. In addition, the ORF sequences of these genes ranged in length from 603 bp to 762 bp, encoding 200–253 amino acids. The predicted MWs and pIs were 23.15–28.72 kDa and 5.76–8.32, respectively.
Similarly, five gh/prl/sl receptors including ghra, ghrb, prlra, prlrb, and prlr-like were identified from C. semilaevis. Ghra and prlrb are located on the Z chromosome. The ORF sequences of these genes ranged in length from 1334 bp to 1902 bp, encoding 443–663 amino acids. The predicted MWs and pIs were 62.41–70.712 kDa and 4.69–5.34, respectively.

2.2. Phylogenetic Analysis of gh/prl/sl Family

To investigate the evolutionary relationships of gh/prl/sl family members, a phylogenetic tree was constructed with homology proteins retrieved from the NCBI database (Figure 1A). The genetic relationship between sl and gh is relatively close. Interestingly, sl sequence was only found in fish, but not in Homo sapiens, Mus musculus, and Gallus gallus. As shown in Figure 1B, no receptor for sl was found in C. semilaevis. However, slr was found in Oncorhynchus masou and Salmo salar and clustered with ghr. This shows that the relationship between slr and ghr is close and conservative. We found that there are three receptors for prl in Cynoglossus semilaevis, Hippoglossus hippoglossus, Sole senegalensis, and Paralichthys olivaceus. However, only prlra and prlrb were found in zebrafish and Sparus aurata.

2.3. Conserved Domain, Gene Structure and Motif Composition

To further understand the structural diversity of gh, sl, and prl genes in C. semilaevis, the exon–intron of each gene was characterized. These genes possessed 5–6 exons and 4–5 introns (Figure 2A). As shown in Figure 2B, gh, sl, and prl in mammals and fish all contain a domain that belongs to the growth hormone superfamily. A total of 12 conserved motifs were searched from gh/prl/sl family, which showed that the sequences were relatively conserved. The length of these motifs ranged from 200 to 253 amino acids, as shown in Figure 2B. Three conserved motifs (Motif 3, Motif 2, and Motif 1) existed in almost all members, with the order of Motif 3, Motif 2, and Motif 1. This indicates that the gh/prl/sl family has highly conserved sequences in the process of evolution. In addition, the gh, sl, and prl2 of C. semilaevis owned their unique motifs, indicating that there may be functional differences among different sub-clusters (Figure 2B).
The receptors all have nine exons and eight introns, suggesting high gene structural conservation throughout the evolutionary process. The ghra and ghrb all have FN3 and GHBP domain. In addition, the prlr of tongue sole have EpoR_lig-bind domain and FN3 domain. Six conserved motifs (Motif 6, Motif 4, Motif 5, Motif 8, and Motif 11) existed in almost all members, and they were all arranged in the order of Motif 6, Motif 4, Motif 5, Motif 8, and Motif 11, as shown in Figure 2C.

2.4. Protein–Protein Interaction (PPI) Network Analysis and Tissue Distribution of gh/prl/sl Family Members in the C. semilaevis

To elucidate the biological activity and intricate regulatory network of the gh/prl/sl family, a protein–protein interaction (PPI) network was constructed comprising 40 nodes and 148 edges (Figure 3A). According to the PPI network, the pou1f1 transcription factor was identified as a key regulator involved in the expression, and the main biological processes involved are response to growth hormone, growth hormone receptor signaling pathway, positive regulation of receptor signaling pathway via JAK-STAT, cellular response to peptide, and cytokine-mediated signaling pathway. Additionally, the primary KEGG pathways associated with these processes are cytokine–cytokine receptor interaction and neuroactive ligand–receptor interaction. For example, the binding of gh and ghr, as well as the binding of prl and prlr, all involve JAK-STAT, cytokine–cytokine receptor interaction, and neuroactive ligand–receptor interaction. These processes and pathways are interconnected and play critical roles in various physiological and pathological conditions.
To better understand the potential roles of gh, prl, sl, and their receptors, their expression patterns were illustrated by using of 2-year-old female and male C. semilaevis RNA-seq data [8] (Figure 3B). The transcripts of three ligands (gh, prl and sl) showed different mRNA abundances in the pituitary of female and male C. semilaevis. The prl2a and prl2a were found in the gonad with the highest abundance. As for receptors, ghrb, and prlr-like are primarily expressed in the liver, while prlrb and prlra mainly expressed in the pituitary and brain, respectively.

2.5. Spatiotemporal Expression Patterns of gh, prl, and sl

To further understand the detailed expression pattern of three pituitary abundant ligands, the expression characteristics of gh, prl, and sl in twelve tissues of male and female C. semilaevis were detected by qPCR (Figure 4A–C). Specifically, the expressions of gh, prl, and sl in the pituitary were significantly higher (p = 0.001, p = 0.001, p = 0.001) than in other tissues. On the other hand, gh, prl, and sl exhibited higher expression levels in the pituitary of 1-year-old female fish than in the pituitary of male fish.
The expression characteristics of gh, prl, and sl in four development stages (4 Months, 7 Months, 1 Year, 1.5 Years) of male and female C. semilaevis were further detected (Figure 4D–F). Specifically, the expressions of gh in 4 months were significantly higher (p = 0.002) than in other times. On the other hand, sl and prl exhibit high expression levels at the ages of 7 months and 1.5 years.
Furthermore, gh and sl are highly expressed during the cleavage stage. Prl was predominantly observed during the pharyngula period, indicating that gh and sl exhibited maternal expression (Figure 4G–I).

2.6. Differences in Genomic Structure Between Male, Female, and Pseudo-Male gh

The gh genomic sequences obtained from the female, male, and pseudo-male C. semilaevis were 2336 bp, 2277, and 2278 bp, respectively. There was no significant difference in the genetic organization of the gh genes between the sexes, with six exons and five introns. However, the sexual differences were mainly within the second intron size produced by two kinds of microsatellites, “TAGA” and “GT” (Figure 5A). The number of “TAGA” in female, male and pseudo-male is 27, 14, and 18, respectively. In addition, there are twelve “GT” in females, ten in males, and eight in pseudo-males. Therefore, the size of the second introns in female, male, and pseudo-male fish were 316, 260, and 272 bp, respectively. The qPCR experiment further showed that gh had the highest expression level in female fish and the lowest expression level in pseudo-male fish (Figure 5B).

2.7. The Fluorescence Resonance Energy Transfer (FRET) Efficiency for the Binding Relationship Between gh, sl and ghra, ghrb

To validate the binding relationship between ligands and receptors, FRET was employed according to previous study [38,39]. Briefly, we obtained the fluorescence intensity change curve and corresponding values using the laser confocal microscope’s fret AB module. Based on the results in Table 2, the FRET efficiency of sl and ghra co-transfection is comparable to that of gh and ghra co-transfection, and notably higher than that of sl and ghrb co-transfection. This suggests that sl and ghra interact with each other. When comparing the FRET effectiveness of gh and ghrb, gh and ghra have a greater efficiency, implying that the binding of gh and ghra is stronger than that of ghrb in C. semilaevis. The change curve of donor acceptor fluorescence intensity is shown in Figure A1.

2.8. Knock-Down Effects on gh, sl, prl, and Other Related Genes by RNAi Transfection in Pituitary Cells

Three siRNA sites were each designed on the CDS region of gh, prl, and sl genes of Cynoglossus semilaevis by Sangon Biotech (Shanghai, China) Co., Ltd., named gh-siRNA1, gh-siRNA2, gh-siRNA3, prl-siRNA1, prl-siRNA2, prl-siRNA2, sl-siRNA1, sl-siRNA2, and sl-siRNA3. Female C. semilaevis pituitary cells were used for RNAi experiments to investigate the knock-down impact of gh, prl, and sl. Figure 6A shows that the 3rd site of gh, the 2nd site of prl, and the 2nd site of sl all had strong knock-down effects, with inhibition efficiencies more than 50%. And genes associated with prl, gh, and sl were screened based on the prolactin signaling pathway and growth hormone receptor pathway. After the transfection of siRNA for ligands, the qPCR analysis was performed to evaluate the expression levels of gh, prl, sl and their related genes: insulin-like growth factor 1 (igf1), proto-oncogene c-Fos-like (c-fos), and son of sevenless homolog 2 (sos2). The NC is the negative control. The results showed that c-fos, prl, and sl increased after the knock-down of gh. When prl was interfered, the decrease in igf1 and sos2 were observed. After sl was knocked down, prl and c-fos increased to varying degrees (Figure 6B).

3. Discussion

Sexual dimorphism, characterized by morphological, physiological, and behavioral differences between males and females, is prevalent throughout the animal kingdom [40]. To interpret sexual size dimorphism (SSD) of C. semilaevis, transcriptomics and molecular experiments have identified numerous genes and pathways including steroid biosynthesis, cell cycle regulation, and hippo signaling pathways, which exhibit significantly different expression levels between the sexes [8,41,42]. Given the observation of differentially expressed gh/prl/sl family genes across sexes and the extensive biological functions of this gene family in fish growth, development, and reproduction [43,44], a comprehensive genomic identification of gh/prl/sl family genes from C. semilaevis was conducted to facilitate the investigation of these genes’ involvement in fish SSD.
From the phylogenetic analysis, five main clusters were identified—gh, prl, prl2a, prl2b, and sl—diverging early in vertebrate evolution, which is agreement with previous phylogeny research [45]. The origin of the gh/prl/sl family can be traced back to early branched vertebrates, with gh and prl-like members identified in jawless vertebrates (agnathans), such as the sea lamprey (Petromyzon marinus) [46]. These ancient members provide significant insights into the early evolution of the gh/prl/sl family. In teleost, an additional genome-wide duplication event (3R) also occurred, resulting in the replication of the sl gene and the emergence of two subtypes: slα and slβ [13,47]. We only identified sla in C. semilaevis, but slβ was only reported in some teleost such as goldfish, zebrafish, and grass carp [26]. The identification of three prl genes and one sl gene in C. semilaevis demonstrated their derivation from the first two genome-wide duplication events (1R and 2R) [26].
Interestingly, the sexual sequence differences are primarily attributed to the microsatellite (TAGA) located in the second intron, which is similar with previous study in C. semilaevis [48]. However, the identification of microsatellite differences in the pseudo-male is reported for the first time. In humans, GT microsatellites within the promoter of ghr gene could exert both cis- and trans- effects on ghr in a sex-specific manner [49]. In present study, the numbers of “TAGA” in female, male, and pseudo-male individuals are positively related with their expression levels, which implied that this intronic SSR could affect gene transcription [50], although the regulation mechanism needs further exploration.
The receptors of the gh/prl/sl hormone family also evolved from a common ancestral source, akin to ligands. In C. semilaevis, it has two different ghr genes (ghr1 and ghr2). Slr is not found in C. semilaevis, and the first documentation of sl receptors originated from studies on salmon (Salmo salar), placing sl receptors within the evolutionary lineage of ghra [51]. To gain further insights on the interaction among ghra, ghrb, and sl, a fluorescence resonance energy transfer (FRET) experiment was employed, and the interaction between sl and ghra was slightly higher than that of ghrb, which implied that sl may bind to ghra. It is similar with the binding relationship in zebrafish [52].
Through PPI network analysis, we found that there are interactions between gh, prl, and sl and that there is not a one-to-one correspondence between receptors and ligands; for example, in humans, gh binds both ghr and prlr [53]. In the context of the PPI network, we focused on three genes—pou1f1, vasoactive intestinal peptide (vip), and Pro-opiomelanocortin (pomc)—which are interconnected with the gh/prl/sl family. Pou1f1 is involved in pituitary development, body growth, and the production of several hormone genes in fish. It can bind to the promoter region and stimulate the production of gh, prl, and sl [54]. As a growth and developmental regulator, vip plays a critical role as a neuronal survival factor [55] and stimulates prl release [56]. As a common precursor for adrenocorticotropic hormone (ACTH) and corticotropin-releasing hormone, pomc is also involved in the regulation of gh release [57]. In the future, the involvement of pou1f1, vip, and pomc in the function of gh/prl/sl family deserves further in-depth study.
The pituitary gland-biased distribution pattern of gh, prl, and sl were noticed in the present study. Specifically, gh exhibited a declining trajectory from 4 months until the age of 1.5 years, with female-biased expression, which is generally consistent with previous reports [48]. In zebrafish (Danio rerio) and turbot (Scophthalmus maximus), prl showed significant expression levels in the pituitary gland, while demonstrating minimal expression in brain tissue and negligible expression in other tissues [58,59]. Compared with prl, only few transcripts of prl2a and prl2b were found in the gonads, with male-biased expression. It is inferred that the action of prolactin is mainly through prl. In fish, prl has been shown to stimulate steroidogenesis in both males and females, such as tilapia (Oreochromis mossambicus) [60] and chum salmon (Oncorhynchus keta) [61].
The detection of gh and sl in the cleavage stage suggested the involvement of these two genes in the early embryonic development process. Similarly, the maternal mRNA of gh and prl was also detected in rainbow trout (Oncorhynchus mykiss) and zebrafish [62,63]. The growth hormone/prolactin family may have a collaborative role in early embryonic development; however, the precise mechanisms by which they contribute to this process necessitate additional investigation.
It was found that after gh knocking down, c-fos, prl and sl were activated. The gh gene can regulate the transcription of c-fos [64], and c-fos deficiency perturbs normal development of bone, cartilage, and the hematopoietic system [65]. The increase of prl and sl implied their compensatory effect to gh. We discovered that after knocking out sl, c-fos and prl up-regulated, suggesting that prl and sl shared similar functions. After prl was knocked down, the down-regulation of igf1 and sos2 were detected. Prl regulates mammary epithelial cell survival and death via influencing the production of igf-1 and its binding protein igfbp-5 [66]. Prl and igf-1 regulate immune responses through synergistic action [67]. Further exploration of complex interaction among these ligands and other growth-related genes would be helpful to understand sexual size dimorphism in fish species.

4. Materials and Methods

4.1. Animal Euthanasia and Ethics Statement

In this study, the fish were anesthetized with MS-222 to alleviate pain. All experimental procedures were performed in accordance with the Institutional Animal Care and Use Committee of the Yellow Sea Fisheries Research Institute.

4.2. Fish Preparation and Sample Collection

Fish samples were obtained from the Haiyang Yellow Sea Fisheries Co., Ltd., Qingdao, China. After dissection, tissues including gonads, liver, spleen, pituitary, brain, muscle, gill, intestine, heart, skin, and kidney were collected from three female and three male individuals of 4-month-old, 7-month-old, 1-year-old, and 1.5-year-old of C. semilaevis individuals. All tissues were stored in an RNA preservation solution (TaKaRa, Osaka, Japan), and total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The integrity, concentration, and quality of the isolated RNA were determined by agarose gel electrophoresis and NanoPlus (GE, Boston, MA, USA). The cDNA was synthesized using TB Green®Premix Ex Taq™ (TaKaRa, Osaka, Japan) and stored at −20 °C.

4.3. Sequence Retrieval and Analyses

The Hormone_1 domain (PF00103) and GHBP(PF12772) were downloaded from the PFAM database (http://pfam.xfam.org/, accessed on 6 October 2023) and used to identify the growth hormone/prolactin ligand and receptor family members from the C. semilaevis genome. The available sequences of C. semilaevis and other species, including humans (Homo sapiens), zebrafish (Danio rerio), medaka (Oryzias latipes), mouse (Mus musculus), chicken (Gallus gallus), rainbow trout (Oncorhynchus mykiss), sea bream (Sparus aurata), Tiger Puffer (Takifugu rubripes), southern bluefin tuna (Thunnus maccoyii), and turbot (Scophthalmus maximus) were retrieved and confirmed in the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/, accessed on 6 October 2023). The accession numbers for proteins have been presented in Appendix A Table A1. The molecular weights (MWs) and theoretical isoelectric points (pIs) were predicted using ExPASy (http://web.expasy.org/protparam/, accessed on 20 October 2023). The conserved domains were characterized using the PFAM database. Chromosomal locations and exon/intron gene structures were obtained from the NCBI database.

4.4. Phylogenetic Tree and Structural Analysis

Multiple sequence alignments of the identified growth hormone/prolactin ligand and receptor family member amino acid sequences from different species were performed using ClustalW version 2.0. A phylogenetic tree with a bootstrap value of 1000 was constructed using MEGA 11.0, using the neighbor-joining method. Using the Newick file retrieved from MEGA 11.0, the tree was further beautified and visualized in Chiplot (https://www.chiplot.online, accessed on 10 April 2024). Gene structure display server 2.0 (GSDS2.0, http://gsds.gao-lab.org/index.php, accessed on 20 April 2024) was used to analyze the exon/intron gene structure of C. semilaevis sequences. The conserved domains and motifs were, respectively, characterized by the Conserved Domain Database from the NCBI (https://www.ncbi.nlm.nih.gov/cdd, accessed on 6 May 2024) and MEME (Version 5.4.1, https://meme-suite.org/meme/tools/meme, accessed on 6 May 2024) programs, followed by visualization using the TB-tools 2.154.

4.5. Interaction Network Analysis and Tissue Expression Analysis

The protein–protein interaction (PPI) network was predicted based on the homology of C. semilaevis using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (https://string-db.org/cgi, accessed on 1 October 2024) with a medium level of confidence (0.40). Cytoscape 3.10 software was used to visualize and exhibit the interaction network.
We utilized RNA-seq data of the brain, liver, gonads, and pituitary from 2-year-old fish [8] to understand the mRNA distribution in C. semilaevis. The relative mRNA abundances of the above-mentioned growth hormone/prolactin ligand and receptor family member genes were obtained from these data, and a heatmap was created using the Omicshare Tool (https://www.omicshare.com/tools, accessed on 12 October 2024) to visualize the expression profiles.

4.6. Spatiotemporal Expression Analysis

The qPCR primers (Table 3) were designed to detect the expression patterns of gh, prl, and sl in different tissues and at different times. In brief, 12 tissues, including the gonad, liver, spleen, brain, pituitary, muscle, gill, intestine, heart, skin, and kidney, were isolated from three female and three male 1-year-old C. semilaevis. We also examined gene expression during embryonic development. We collected samples from five stages of C. semilaevis, including the cleavage period, blastocyst period, gastrula period, segmentation period, and pharyngula period.
β-actin was selected as the internal reference gene. Amplification was accomplished using THUNDERBIRD™ Next SYBR® qPCR Mix (Toyobo, Tokyo, Japan) on a 7500 Fast Real-Time PCR system (ABI, Los Angeles, CA, USA). The conditions were 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 34 s. Melting curve analysis confirmed the specificity of this reaction. The relative expression of each gene was analyzed using the 2−ΔΔCt method. Statistical analyses were performed using the GraphPad Prismversion 10.1.2.

4.7. Genomic DNA Sequences for gh Gene from Female, Male, and Pseudo-Male C. semilaevis

The genomic DNA was extracted using the TIANamp Marine Animals DNA Kit (Tiangen, China) according to the manufacturer’s protocol. The integrity, concentration, and quality of the DNA were assessed using agarose gel electrophoresis and a Nano Vue Plus spectrophotometer (GE, USA). Primers, gh-DNA-F and gh-DNA-R (Table 3) were designed to amplify genomic DNA from three female, three male, and three pseudo-male fish. The amplification was performed using the KOD DNA polymerase enzyme (Toyobo, Tokyo, Japan) under the following thermal cycling conditions: an initial denaturation step at 94 °C for 2 min, 40 cycles of 98 °C for 10 s, 56 °C for 10 s, and 68 °C for 30 s. The PCR products were purified, cloned into the pEASY-T1 vector, and sequenced by Qingdao Ruibo Company, Qingdao, China. To explore the expression of gh gene in the pituitary of three genders, pituitary tissues from three biological replicates per group (two-year-old females, males, and pseudomales) were collected for quantitative real-time PCR (qPCR) analysis.

4.8. The Fluorescence Resonance Energy Transfer (FRET) Efficiency for the Binding Relationship Between sl and ghra

The coding sequences (CDS) of sl, gh, ghra, and ghrb were initially amplified using specific primers (sl-cds-F, sl-cds-R, gh-cds-F, gh-cds-R, ghra-cds-F, ghra-cds-R, ghrb-cds-F, ghrb-cds-R) as listed in Table 3. These amplified fragments were subcloned into pcDNA3.1-mNeonGreen and pcDNA3.1-mScarlet-I plasmids using HindIII restriction enzymes and the TOROIVD® One-Step Fusion Cloning MIX Seamless Cloning Kit (TOROIVD, Shanghai, China). This process generated recombinant plasmids: pcDNA3.1-N-sl, pcDNA3.1-N-gh, pcDNA3.1-S-ghra, and pcDNA3.1-S-ghrb. HEK 293T cells were co-transfected with various plasmid combinations—pcDNA3.1-N-sl/pcDNA3.1-S-ghra, pcDNA3.1-N-sl/pcDNA3.1-S-ghrb, pcDNA3.1-N-gh/pcDNA3.1-S-ghra, and pcDNA3.1-N-gh/pcDNA3.1-S-ghrb—at a 1:2 ratio, with 2.5 μg of plasmid per well in 6-well plates, using the Lipo8000™ transfection reagent (Beyotime, Shanghai, China). After 48 h of transfection, fluorescence signals were visualized using a Nikon A1R HD25 laser confocal microscope (Nikon, Tokyo, Japan). The FRET (Förster Resonance Energy Transfer) Acceptor Bleaching method was employed to detect changes in donor fluorescence intensity. The FRET efficiency was calculated using the formula FRETeff = (Dpost − Dpre)/Dpost, where Dpost represents the fluorescence intensity of the donor after quenching, and Dpre represents the intensity before quenching.

4.9. Design and Transfection of RNAi in Female C. semilaevis Pituitary Cell Lines

Based on the mRNA sequences of gh, prl, and sl, three specific small interfering RNA (siRNA) were designed and ordered from Sangon Biotech (Shanghai) Co., Ltd. (Sangon, Shanghai, China), as detailed in Table 3. The negative control (RNAi-NC) is provided by Sangon Biotech. Utilizing the RiboFECT™ CP Transfection Kit (Ribobio, Guangzhou, China), the negative control (RNAi-NC), positive control (RNAi-cy3), and the siRNA targeting were transfected into female pituitary cells. Specifically, 3 µL of siRNA (20 µM) was diluted in 60 µL of CP buffer and 5 µL of CP reagent, and the resulting mixture was added to each well of a 12-well plate. Forty-eight hours post-transfection, total RNA extraction, complementary DNA (cDNA) synthesis, and quantitative polymerase chain reaction (qPCR) were performed according to the previously described methods. The data were analyzed using SPSS version 25.0 (IBM Corp., Armonk, NY, USA), employing a t-test for statistical comparison. The expression levels of each downstream gene were compared to the negative control, with a p-value of less than 0.05 considered statistically significant.

5. Conclusions

In conclusion, we identified five gh/prl/sl family ligands and five receptor genes from Chinese tongue sole and characterized their evolutionary relationships. The genomic structure analysis for gh gene revealed that sexual differences mainly existed in number of intronic microsatellite “TAGA”, which might influence the expression pattern. The predominant expressions of gh, sl, and prl in the pituitary tissues were observed and their interaction with other factors including pou1f1, vip, and pomc warrants further research. The maternal expression of gh and prl implied that they had a collaborative role in early embryonic development. FRET experiments showed that sl and ghra may interact and exert their effects. Moreover, our research would be helpful to better understand the evolution and function of gh/prl/sl family and receptors in teleost.

Author Contributions

The experiments were conceived and designed by N.W. Fish samples were collected by M.Z. and Y.S. qPCR analysis was performed by M.Z. and Z.W. Phylogenetic tree construction was carried out by X.L. and M.Z. Gene structure and conserved domain analysis was carried out by M.Z. PPI network analysis was conducted by N.W. and M.Z. The FRET efficiency for the binding relationship between sl and ghra was performed by N.W. and M.Z. This paper was written, revised and discussed by M.Z., X.L., Y.S., Z.W., W.X., Z.C. and N.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by National Natural Science Foundation of China (32230107), Taishan Young Scholar Project of Shandong Province (tsqn202211266), Key Research and Development Project of Shandong Province (2023ZLYS02), and the Central Public-interest Scientific Institution Basal Research Fund, CAFS (2023TD20).

Institutional Review Board Statement

We followed the guidelines for the Care and Use of Laboratory Animals at the Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences during all experimental procedures.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
ghgrowth hormone
prlprolactin
prl2prolactin 2
slsomatolactin
ghrgrowth hormone receptor
slrsomatolactin receptor
prlrprolactin receptor
vipvasoactive intestinal peptide
pomcpro-opiomelanocortin
pou1f1pou Class 1 Homeobox 1
FRETThe Fluorescence Resonance Energy Transfer

Appendix A

Figure A1. The fluorescence intensity change curve before and after the receptor–ligand interaction is quenched by laser. Green lines represent donor and red lines represent acceptor. The yellow area indicates the start of laser quenching, and after yellow is the end of quenching.
Figure A1. The fluorescence intensity change curve before and after the receptor–ligand interaction is quenched by laser. Green lines represent donor and red lines represent acceptor. The yellow area indicates the start of laser quenching, and after yellow is the end of quenching.
Ijms 26 01585 g0a1
Table A1. Accession numbers of gh/prl/sl family and their receptors used in this study.
Table A1. Accession numbers of gh/prl/sl family and their receptors used in this study.
SpeciesProteinAccession Number
Cynoglossus semilaevisgh1NP_001281140.1
prlXP_008328937.1
prl2XP_024913906.1
prl2-likeXP_024912122.1
smtlaXP_008306726.1
ghraNP_001281126.1
ghrbNP_001315166.1
prlrXP_008324293.1
prlrbXP_008334066.1
prlr-likeXP_024918466.1
Sparus auratagh1XP_030262341.1
ghraXP_030273854.1
ghrbXP_030292100.1
prlrbXP_030272992.1
prlraXP_030292731.1
Homo sapiensgh1NP_000506.2
prlNP_000939.1
ghrNP_000154.1
prlrNP_000940.1
Mus musculusgh1NP_032143.1
prlNP_001157002.1
ghrNP_001041643.1
prlrNP_001240710.1
Danio reriogh1NP_001018328.2
prlNP_852102.2
smtlaNP_001032795.1
smtlbNP_001032763.1_
ghraNP_001077047.1
ghrbNP_001104551.1
prlraXP_021324476.1
Scophthalmus maximusprlXP_035470397.1
prl2XP_035483075.1
smtlaXP_035479871.1
ghraXP_035496335.1
ghrbXP_047185503.1
prlraXP_035464595.2
prlrbXP_035497061.1
Oryzias latipessmtlaNP_001098260.1_
prlraXP_011479970.1
prlrbXP_004072141.1
ghraNP_001098560.1
ghrbNP_001116377.1
Salmao salarprlXP_008328937.1
prl2aXP_045578518.1
slrNP_001135089.1
Oncorhynchus mykissgh2NP_001118162.2
gh1NP_001118161.1
prlNP_001118205.1
Thunnus maccoyiigh1XP_042247785.1
prl2XP_042259945.1
smtlaXP_042270649.1
Oreochromis niloticusprlNP_001266715.1
Poecilia latipinnaprlXP_014877782.1
Takifugu rubripesmtlaXP_029700280.1
prlNP_001072092.1
prl2aXP_029681130.1
prl2bXP_029681130.1
Scophthalmus maximusprlXP_035470397.1
prl2XP_035483075.1
smtlaXP_035479871.1
Hippoglossus stenolepisprl-likeXP_047195737.1
Oncorhynchus masouslrNP_001281140.1
Solea senegalensisprlraXP_008328937.1
Hippoglossus hippoglossusprlraXP_034458243.1
prlrbXP_034450669.1
prlr-likeXP_034466717.1
Paralichthys olivaceusprlraNP_001281126.1
prlrbNP_001315166.1
prlr-likeXP_008324293.1

References

  1. Dean, R.; Mank, J.E. The role of sex chromosomes in sexual dimorphism: Discordance between molecular and phenotypic data. J. Evol. Biol. 2014, 27, 1443–1453. [Google Scholar] [CrossRef] [PubMed]
  2. Kappeler, P.M. The evolution of sexual size dimorphism in prosimian primates. Am. J. Primatol. 1990, 21, 201–214. [Google Scholar] [CrossRef] [PubMed]
  3. Leinonen, T.; Cano, J.M.; Merilä, J. Genetic basis of sexual dimorphism in the threespine stickleback Gasterosteus aculeatus. Heredity 2011, 106, 218–227. [Google Scholar] [CrossRef]
  4. Horne, C.R.; Hirst, A.G.; Atkinson, D. Selection for increased male size predicts variation in sexual size dimorphism among fish species. Proc Biol Sci 2020, 287, 20192640. [Google Scholar] [CrossRef]
  5. Zhang, Y.; Zhang, W.; Jian, Y.; Zhang, S.; Liu, D.; Zheng, K.; Tan, X.; You, F.; Pang, Q.; Jiao, S. Identification of candidate genes and pathways involved in the establishment of sexual size dimorphism in the olive flounder (Paralichthys olivaceus) using RNA-seq. Aquaculture 2025, 595, 741604. [Google Scholar] [CrossRef]
  6. Yao, X.; Zhou, Y.; Nyirenda, K.; Song, Y.; Ma, C.; Qian, K.; Zhao, Y.; Tang, S.; Zhao, J. Characterization of sexual size dimorphism in mandarin fish and association with igfbp-5a/b regulation. Fish Physiol. Biochem. 2024, 50, 2301–2313. [Google Scholar] [CrossRef]
  7. Li, X.; Yang, Q.; Shi, R.; Xu, X.; Chen, Z.; Chen, S.; Wang, N. Genome-wide identification of insulin-like growth factor-binding protein family in Chinese tongue sole (Cynoglossus semilaevis) and their responses to sex steroids. Aquaculture 2022, 557, 738346. [Google Scholar] [CrossRef]
  8. Wang, N.; Wang, R.; Wang, R.; Chen, S. Transcriptomics analysis revealing candidate networks and genes for the body size sexual dimorphism of Chinese tongue sole (Cynoglossus semilaevis). Funct. Integr. Genom. 2018, 18, 327–339. [Google Scholar] [CrossRef]
  9. Li, S.; Crenshaw, E.B., 3rd; Rawson, E.J.; Simmons, D.M.; Swanson, L.W.; Rosenfeld, M.G. Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1. Nature 1990, 347, 528–533. [Google Scholar] [CrossRef]
  10. Fontaine, R.; Rahmad Royan, M.; Henkel, C.; Hodne, K.; Ager-Wick, E.; Weltzien, F.A. Pituitary multi-hormone cells in mammals and fish: History, origin, and roles. Front. Neuroendocrinol. 2022, 67, 101018. [Google Scholar] [CrossRef]
  11. Royan, M.R.; Siddique, K.; Csucs, G.; Puchades, M.A.; Nourizadeh-Lillabadi, R.; Bjaalie, J.G.; Henkel, C.V.; Weltzien, F.A.; Fontaine, R. 3D Atlas of the Pituitary Gland of the Model Fish Medaka (Oryzias latipes). Front. Endocrinol. 2021, 12, 719843. [Google Scholar] [CrossRef] [PubMed]
  12. Onuma, T.A.; Ban, M.; Makino, K.; Katsumata, H.; Hu, W.; Ando, H.; Fukuwaka, M.A.; Azumaya, T.; Urano, A. Changes in gene expression for GH/PRL/SL family hormones in the pituitaries of homing chum salmon during ocean migration through upstream migration. Gen. Comp. Endocrinol. 2010, 166, 537–548. [Google Scholar] [CrossRef]
  13. Ocampo Daza, D.; Larhammar, D. Evolution of the growth hormone, prolactin, prolactin 2 and somatolactin family. Gen. Comp. Endocrinol. 2018, 264, 94–112. [Google Scholar] [CrossRef]
  14. Li, C.H.; Evans, H.M. The Isolation of Pituitary Growth Hormone. Science 1944, 99, 183–184. [Google Scholar] [CrossRef]
  15. Chang, C.W.; Sung, Y.W.; Hsueh, Y.W.; Chen, Y.Y.; Ho, M.; Hsu, H.C.; Yang, T.C.; Lin, W.C.; Chang, H.M. Growth hormone in fertility and infertility: Mechanisms of action and clinical applications. Front. Endocrinol. 2022, 13, 1040503. [Google Scholar] [CrossRef]
  16. Ipsa, E.; Cruzat, V.F.; Kagize, J.N.; Yovich, J.L.; Keane, K.N. Growth Hormone and Insulin-Like Growth Factor Action in Reproductive Tissues. Front. Endocrinol. 2019, 10, 777. [Google Scholar] [CrossRef]
  17. Baumann, G.P. Growth hormone isoforms. Growth Horm. IGF Res. 2009, 19, 333–340. [Google Scholar] [CrossRef]
  18. Ber, R.; Daniel, V. Sequence analysis suggests a recent duplication of the growth hormone-encoding gene in Tilapia nilotica. Gene 1993, 125, 143–150. [Google Scholar] [CrossRef]
  19. Oscar, R.; Bates, R.W.; Dykshorn, S.W. The Preparation, Identification and Assay of Prolactin—A Hormone of the Anterior Pituitary. Am. J. Physiol. Leg. Content 1933, 105, 191–216. [Google Scholar]
  20. Freeman, M.E.; Kanyicska, B.; Lerant, A.; Nagy, G. Prolactin: Structure, Function, and Regulation of Secretion. Physiol. Rev. 2000, 80, 1523–1631. [Google Scholar] [CrossRef]
  21. Horseman, N.D. Prolactin and mammary gland development. J. Mammary Gland Biol. Neoplasia 1999, 4, 79–88. [Google Scholar] [CrossRef] [PubMed]
  22. Kawauchi, H.; Abe, K.-I.; Takahashi, A.; Hirano, T.; Hasegawa, S.; Naito, N.; Nakai, Y. Isolation and properties of chum salmon prolactin. Gen. Comp. Endocrinol. 1983, 49, 446–458. [Google Scholar] [CrossRef] [PubMed]
  23. Huang, X.; Hui, M.N.; Liu, Y.; Yuen, D.S.; Zhang, Y.; Chan, W.Y.; Lin, H.R.; Cheng, S.H.; Cheng, C.H. Discovery of a novel prolactin in non-mammalian vertebrates: Evolutionary perspectives and its involvement in teleost retina development. PLoS ONE 2009, 4, e6163. [Google Scholar] [CrossRef]
  24. Rand-Weaver, M.; Baker, B.J.; Kawauchi, H. Cellular localization of somatolactin in the pars intermedia of some teleost fishes. Cell Tissue Res. 1991, 263, 207–215. [Google Scholar] [CrossRef]
  25. Zhu, Y.; Stiller, J.W.; Shaner, M.P.; Baldini, A.; Scemama, J.L.; Capehart, A.A. Cloning of somatolactin alpha and beta cDNAs in zebrafish and phylogenetic analysis of two distinct somatolactin subtypes in fish. J. Endocrinol. 2004, 182, 509–518. [Google Scholar] [CrossRef]
  26. Benedet, S.; Björnsson, B.T.; Taranger, G.L.; Andersson, E. Cloning of somatolactin alpha, beta forms and the somatolactin receptor in Atlantic salmon: Seasonal expression profile in pituitary and ovary of maturing female broodstock. Reprod. Biol. Endocrinol. 2008, 6, 42. [Google Scholar] [CrossRef]
  27. Fukamachi, S.; Sugimoto, M.; Mitani, H.; Shima, A. Somatolactin selectively regulates proliferation and morphogenesis of neural-crest derived pigment cells in medaka. Proc. Natl. Acad. Sci. USA 2004, 101, 10661–10666. [Google Scholar] [CrossRef]
  28. Jiang, Q.; Ko, W.K.; Wong, A.O. Insulin-like growth factor as a novel stimulator for somatolactin secretion and synthesis in carp pituitary cells via activation of MAPK cascades. Am. J. Physiol. Endocrinol. Metab. 2011, 301, E1208–E1219. [Google Scholar] [CrossRef]
  29. Pantel, J.; Machinis, K.; Sobrier, M.L.; Duquesnoy, P.; Goossens, M.; Amselem, S. Species-specific alternative splice mimicry at the growth hormone receptor locus revealed by the lineage of retroelements during primate evolution. J. Biol. Chem. 2000, 275, 18664–18669. [Google Scholar] [CrossRef]
  30. Jiao, B.; Huang, X.; Chan, C.B.; Zhang, L.; Wang, D.; Cheng, C.H. The co-existence of two growth hormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonal regulation of expression in seabream. J. Mol. Endocrinol. 2006, 36, 23–40. [Google Scholar] [CrossRef]
  31. Saera-Vila, A.; Calduch-Giner, J.A.; Pérez-Sánchez, J. Duplication of growth hormone receptor (GHR) in fish genome: Gene organization and transcriptional regulation of GHR type I and II in gilthead sea bream (Sparus aurata). Gen. Comp. Endocrinol. 2005, 142, 193–203. [Google Scholar] [CrossRef] [PubMed]
  32. Sandra, O.; Sohm, F.; de Luze, A.; Prunet, P.; Edery, M.; Kelly, P.A. Expression cloning of a cDNA encoding a fish prolactin receptor. Proc. Natl. Acad. Sci. USA 1995, 92, 6037–6041. [Google Scholar] [CrossRef] [PubMed]
  33. Tse, D.L.; Chow, B.K.; Chan, C.B.; Lee, L.T.; Cheng, C.H. Molecular cloning and expression studies of a prolactin receptor in goldfish (Carassius auratus). Life Sci. 2000, 66, 593–605. [Google Scholar] [CrossRef]
  34. Santos, C.R.; Ingleton, P.M.; Cavaco, J.E.; Kelly, P.A.; Edery, M.; Power, D.M. Cloning, characterization, and tissue distribution of prolactin receptor in the sea bream (Sparus aurata). Gen. Comp. Endocrinol. 2001, 121, 32–47. [Google Scholar] [CrossRef]
  35. Rentier-Delrue, F.; Swennen, D.; Prunet, P.; Lion, M.; Martial, J.A. Tilapia prolactin: Molecular cloning of two cDNAs and expression in Escherichia coli. DNA 1989, 8, 261–270. [Google Scholar] [CrossRef]
  36. Fukamachi, S.; Meyer, A. Evolution of receptors for growth hormone and somatolactin in fish and land vertebrates: Lessons from the lungfish and sturgeon orthologues. J. Mol. Evol. 2007, 65, 359–372. [Google Scholar] [CrossRef]
  37. Moroki, Y.; Komori, M.; Ogawa, Y.; Nagumo, E.; Ohno, H.; Fukamachi, S. An Attempt to Identify the Medaka Receptor for Somatolactin Alpha Using a Reverse Genetics Approach. Genes 2023, 14, 796. [Google Scholar] [CrossRef]
  38. Pfab, A.; Bruckmann, A.; Nazet, J.; Merkl, R.; Grasser, K.D. The Adaptor Protein ENY2 Is a Component of the Deubiquitination Module of the Arabidopsis SAGA Transcriptional Co-activator Complex but not of the TREX-2 Complex. J. Mol. Biol. 2018, 430, 1479–1494. [Google Scholar] [CrossRef]
  39. Yao, R.W.; Xu, G.; Wang, Y.; Shan, L.; Luan, P.F.; Wang, Y.; Wu, M.; Yang, L.Z.; Xing, Y.H.; Yang, L.; et al. Nascent Pre-rRNA Sorting via Phase Separation Drives the Assembly of Dense Fibrillar Components in the Human Nucleolus. Mol. Cell 2019, 76, 767–783.e711. [Google Scholar] [CrossRef]
  40. Williams, T.M.; Carroll, S.B. Genetic and molecular insights into the development and evolution of sexual dimorphism. Nat. Rev. Genet. 2009, 10, 797–804. [Google Scholar] [CrossRef]
  41. Ji, X.-S.; Chen, S.-L.; Jiang, Y.-L.; Xu, T.-J.; Yang, J.-F.; Tian, Y.-S. Growth differences and differential expression analysis of pituitary adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing hormone (GHRH) between the sexes in half-smooth tongue sole Cynoglossus semilaevis. Gen. Comp. Endocrinol. 2011, 170, 99–109. [Google Scholar] [CrossRef] [PubMed]
  42. Wang, N.; Tian, Y.; Zhang, J.; Li, Z.; Cheng, M.; Wu, Y. Involvement of glycolysis activation in flatfish sexual size dimorphism: Insights from transcriptomic analyses of Platichthys stellatus and Cynoglossus semilaevis. Comp. Biochem. Physiol. Part D: Genom. Proteom. 2021, 39, 100832. [Google Scholar] [CrossRef] [PubMed]
  43. Hall, J.C. Control of male reproductive behavior by the central nervous system of Drosophila: Dissection of a courtship pathway by genetic mosaics. Genetics 1979, 92, 437–457. [Google Scholar] [CrossRef]
  44. Tompkins, L.; Hall, J.C. Identification of Brain Sites Controlling Female Receptivity in Mosaics of Drosophila melanogaster. Genetics 1983, 103, 179–195. [Google Scholar] [CrossRef]
  45. Yamaguchi, Y.; Takagi, W.; Kuraku, S.; Moriyama, S.; Bell, J.D.; Seale, A.P.; Lerner, D.T.; Grau, E.G.; Hyodo, S. Discovery of conventional prolactin from the holocephalan elephant fish, Callorhinchus milii. Gen. Comp. Endocrinol. 2015, 224, 216–227. [Google Scholar] [CrossRef]
  46. Gong, N.; Ferreira-Martins, D.; Norstog, J.L.; McCormick, S.D.; Sheridan, M.A. Discovery of prolactin-like in lamprey: Role in osmoregulation and new insight into the evolution of the growth hormone/prolactin family. Proc. Natl. Acad. Sci. USA 2022, 119, e2212196119. [Google Scholar] [CrossRef]
  47. Ocampo Daza, D.; Sundström, G.; Larsson, T.A.; Larhammar, D. Evolution of the growth hormone-prolactin-somatolactin system in relation to vertebrate tetraploidizations. Ann. NY Acad. Sci. 2009, 1163, 491–493. [Google Scholar] [CrossRef]
  48. Ma, Q.; Liu, S.; Zhuang, Z.; Lin, L.; Sun, Z.; Liu, C.; Ma, H.; Su, Y.; Tang, Q. Genomic structure, polymorphism and expression analysis of the growth hormone (GH) gene in female and male Half-smooth tongue sole (Cynoglossus semilaevis). Gene 2012, 493, 92–104. [Google Scholar] [CrossRef]
  49. Dias, C.; Elzein, S.; Sladek, R.; Goodyer, C.G. Sex-specific effects of a microsatellite polymorphism on human growth hormone receptor gene expression. Mol. Cell. Endocrinol. 2019, 492, 110442. [Google Scholar] [CrossRef]
  50. Li, Y.C.; Korol, A.B.; Fahima, T.; Nevo, E. Microsatellites within genes: Structure, function, and evolution. Mol. Biol. Evol. 2004, 21, 991–1007. [Google Scholar] [CrossRef]
  51. Fukada, H.; Ozaki, Y.; Pierce, A.L.; Adachi, S.; Yamauchi, K.; Hara, A.; Swanson, P.; Dickhoff, W.W. Identification of the salmon somatolactin receptor, a new member of the cytokine receptor family. Endocrinology 2005, 146, 2354–2361. [Google Scholar] [CrossRef] [PubMed]
  52. Di Prinzio, C.M.; Botta, P.; Barriga, E.H.; Rios, E.A.; Reyes, A.E.; Arranz, S.E. Growth hormone receptors in zebrafish (Danio rerio): Adult and embryonic expression patterns. Gene Expr. Patterns 2010, 10, 214–225. [Google Scholar] [CrossRef] [PubMed]
  53. Xu, J.; Sun, D.; Jiang, J.; Deng, L.; Zhang, Y.; Yu, H.; Bahl, D.; Langenheim, J.F.; Chen, W.Y.; Fuchs, S.Y.; et al. The Role of Prolactin Receptor in GH Signaling in Breast Cancer Cells. Mol. Endocrinol. 2013, 27, 266–279. [Google Scholar] [CrossRef]
  54. Wang, D.; Qin, J.; Jia, J.; Yan, P.; Li, W. Pou1f1, the key transcription factor related to somatic growth in tilapia (Orechromis niloticus), is regulated by two independent post-transcriptional regulation mechanisms. Biochem. Biophys. Res. Commun. 2017, 483, 559–565. [Google Scholar] [CrossRef]
  55. Gozes, I.; Brenneman, D.E. VIP: Molecular biology and neurobiological function. Mol. Neurobiol. 1989, 3, 201–236. [Google Scholar] [CrossRef]
  56. Ruberg, M.; Rotsztejn, W.H.; Arancibia, S.; Besson, J.; Enjalbert, A. Stimulation of prolactin release by vasoactive intestinal peptide (VIP). Eur. J. Pharmacol. 1978, 51, 319–320. [Google Scholar] [CrossRef]
  57. Quaresma, P.G.F.; Teixeira, P.D.S.; Furigo, I.C.; Wasinski, F.; Couto, G.C.; Frazão, R.; List, E.O.; Kopchick, J.J.; Donato, J., Jr. Growth hormone/STAT5 signaling in proopiomelanocortin neurons regulates glucoprivic hyperphagia. Mol. Cell. Endocrinol. 2019, 498, 110574. [Google Scholar] [CrossRef] [PubMed]
  58. Liu, Z.; Ma, A.; Zhang, J.; Yang, S.; Cui, W.; Xia, D.; Qu, J. Cloning and molecular characterization of PRL and PRLR from turbot (Scophthalmus maximus) and their expressions in response to short-term and long-term low salt stress. Fish Physiol. Biochem. 2020, 46, 501–517. [Google Scholar] [CrossRef]
  59. Shu, Y.; Lou, Q.; Dai, Z.; Dai, X.; He, J.; Hu, W.; Yin, Z. The basal function of teleost prolactin as a key regulator on ion uptake identified with zebrafish knockout models. Sci. Rep. 2016, 6, 18597. [Google Scholar] [CrossRef]
  60. Rubin, D.A.; Specker, J.L. In vitro effects of homologous prolactins on testosterone production by testes of tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol. 1992, 87, 189–196. [Google Scholar] [CrossRef]
  61. Singh, H.; Griffith, R.W.; Takahashi, A.; Kawauchi, H.; Thomas, P.; Stegeman, J.J. Regulation of gonadal steroidogenesis in Fundulus heteroclitus by recombinant salmon growth hormone and purified salmon prolactin. Gen. Comp. Endocrinol. 1988, 72, 144–153. [Google Scholar] [CrossRef] [PubMed]
  62. Chen, M.; Huang, X.; Yuen, D.S.; Cheng, C.H. A study on the functional interaction between the GH/PRL family of polypeptides with their receptors in zebrafish: Evidence against GHR1 being the receptor for somatolactin. Mol. Cell. Endocrinol. 2011, 337, 114–121. [Google Scholar] [CrossRef] [PubMed]
  63. Yang, B.Y.; Arab, M.; Chen, T.T. Cloning and characterization of rainbow trout (Oncorhynchus mykiss) somatolactin cDNA and its expression in pituitary and nonpituitary tissues. Gen. Comp. Endocrinol. 1997, 106, 271–280. [Google Scholar] [CrossRef]
  64. Ashcom, G.; Gurland, G.; Schwartz, J. Growth hormone synergizes with serum growth factors in inducing c-fos transcription in 3T3-F442A cells. Endocrinology 1992, 131, 1915–1921. [Google Scholar] [CrossRef]
  65. Wang, Z.Q.; Ovitt, C.; Grigoriadis, A.E.; Möhle-Steinlein, U.; Rüther, U.; Wagner, E.F. Bone and haematopoietic defects in mice lacking c-fos. Nature 1992, 360, 741–745. [Google Scholar] [CrossRef]
  66. Accorsi, P.A.; Pacioni, B.; Pezzi, C.; Forni, M.; Flint, D.J.; Seren, E. Role of Prolactin, Growth Hormone and Insulin-Like Growth Factor 1 in Mammary Gland Involution in the Dairy Cow. J. Dairy Sci. 2002, 85, 507–513. [Google Scholar] [CrossRef]
  67. Koouman, R.; Hooghe-Peters, E.L.; Hooghe, R. Prolactin, Growth Hormone, and Insulin-like Growth Factor-I in the Immune System. In Advances in Immunology; Dixon, F.J., Ed.; Academic Press: Cambridge, MA, USA, 1996; Volume 63, pp. 377–454. [Google Scholar]
Figure 1. Phylogenetic analysis for gh/prl/sl family members and their receptors. (A) Phylogenetic tree of gh/prl/sl family member from Cynoglossus semilaevis (Cs), Homo sapiens (Hs), Danio rerio (Dr), Mus musculus (Mm), Gallus gallus (Gg), Oncorhynchus mykiss (Om), Oreochromis niloticus (On), Sparus aurate (Sa), Poecilia latipinna (Pl), Takifugu rubripes (Tr), Thunnus maccoyii (Tm), Salmao salar (Ss), Hippoglossus stenolepis (Ht), Scophthalmus maximus (Sm), and Oryzias latipes (Ol). A phylogenetic tree with a bootstrap value of 1000 was constructed using MEGA 11.0, using the neighbor-joining method. The 5 sub-clusters are represented in different colors. The gh, prl and sl of C. semilaevis are marked with red stars. (B) Phylogenetic tree of gh/prl/sl receptor family member from Cynoglossus semilaevis (Cs), Homo sapiens (Hs), Danio rerio (Dr), Mus musculus (Mm), Hippoglossus hippoglossus (Hh), Sole senegalensis (Se), Paralichthys olivaceus (Po), Gallus gallus (Gg), Oncorhynchus mykiss (Om), Sparus aurate (Sa), Scophthalmus maximus (Sm), and Oryzias latipe (Ol). The ghra, ghrb, prlra, prlrb, prlr-like of C. semilaevis are marked red stars. The five sub-clusters are represented in different colors.
Figure 1. Phylogenetic analysis for gh/prl/sl family members and their receptors. (A) Phylogenetic tree of gh/prl/sl family member from Cynoglossus semilaevis (Cs), Homo sapiens (Hs), Danio rerio (Dr), Mus musculus (Mm), Gallus gallus (Gg), Oncorhynchus mykiss (Om), Oreochromis niloticus (On), Sparus aurate (Sa), Poecilia latipinna (Pl), Takifugu rubripes (Tr), Thunnus maccoyii (Tm), Salmao salar (Ss), Hippoglossus stenolepis (Ht), Scophthalmus maximus (Sm), and Oryzias latipes (Ol). A phylogenetic tree with a bootstrap value of 1000 was constructed using MEGA 11.0, using the neighbor-joining method. The 5 sub-clusters are represented in different colors. The gh, prl and sl of C. semilaevis are marked with red stars. (B) Phylogenetic tree of gh/prl/sl receptor family member from Cynoglossus semilaevis (Cs), Homo sapiens (Hs), Danio rerio (Dr), Mus musculus (Mm), Hippoglossus hippoglossus (Hh), Sole senegalensis (Se), Paralichthys olivaceus (Po), Gallus gallus (Gg), Oncorhynchus mykiss (Om), Sparus aurate (Sa), Scophthalmus maximus (Sm), and Oryzias latipe (Ol). The ghra, ghrb, prlra, prlrb, prlr-like of C. semilaevis are marked red stars. The five sub-clusters are represented in different colors.
Ijms 26 01585 g001
Figure 2. Gene structure and conserved domain analysis of growth hormone/prolactin ligand and receptor family members. (A) Gene structure. The yellow and blue rectangles represent the exons and UTR regions, respectively, the gray line represents the introns. (B) Conserved domain of gh/prl/sl ligand family. Different colored boxes represent the conserved domains and motifs. (C) Conserved domain of gh/prl/sl receptor family. Different colored boxes represent the conserved domains and motifs.
Figure 2. Gene structure and conserved domain analysis of growth hormone/prolactin ligand and receptor family members. (A) Gene structure. The yellow and blue rectangles represent the exons and UTR regions, respectively, the gray line represents the introns. (B) Conserved domain of gh/prl/sl ligand family. Different colored boxes represent the conserved domains and motifs. (C) Conserved domain of gh/prl/sl receptor family. Different colored boxes represent the conserved domains and motifs.
Ijms 26 01585 g002
Figure 3. Protein–protein interaction (PPI) network analysis and tissue distribution of gh/prl/sl family and their receptors in the C. semilaevis. (A). Interaction network of gh/prl/sl family member. Nodes indicated the interactive proteins; lines indicated both functional and physical protein associations. Different colors of nodes reflect the number of interactions, with intense red indicating more interactions than pale red. (B). Heatmap of gh/prl/sl family members and their receptors, mRNA abundances in different tissues of healthy female and male Chinese tongue sole. FP: female pituitary; MP: male pituitary; FB: female brain; MB: male brain; FG: female gonad; MG: male gonad; FL: female liver; ML: male liver. The expression levels were quantified as FPKM based on RNA-Seq. Gene expression levels were color coded from low (blue) to high (red). Each row represented one gene (listed on the right).
Figure 3. Protein–protein interaction (PPI) network analysis and tissue distribution of gh/prl/sl family and their receptors in the C. semilaevis. (A). Interaction network of gh/prl/sl family member. Nodes indicated the interactive proteins; lines indicated both functional and physical protein associations. Different colors of nodes reflect the number of interactions, with intense red indicating more interactions than pale red. (B). Heatmap of gh/prl/sl family members and their receptors, mRNA abundances in different tissues of healthy female and male Chinese tongue sole. FP: female pituitary; MP: male pituitary; FB: female brain; MB: male brain; FG: female gonad; MG: male gonad; FL: female liver; ML: male liver. The expression levels were quantified as FPKM based on RNA-Seq. Gene expression levels were color coded from low (blue) to high (red). Each row represented one gene (listed on the right).
Ijms 26 01585 g003
Figure 4. The spatiotemporal expression patterns of gh, prl, and sl transcripts. (AC) Relative expression detected by qPCR of gh, prl and sl mRNA, respectively, in liver (L), brain (B), gonad (G), kidney (K), heart (H), skin (SK), spleen (SP), intestine (IN), gills (GI), pituitary (PI), muscle (M), and blood (BL) of different genders. Values with different letters differ significantly (p < 0.05) and using one-way ANOVA and multiple comparison by Wohler and Duncan methods. (DF) represented the relative expression patterns of gh and prl, sl mRNA in 4 Months, 7 Months, 1 Year, 1.5 Years. The dark-gray and gray separately represented female, male C. semilaevis. (GI) showed the relative expression levels of gh, prl, and sl genes in embryonic development stages which is cleavage period, blastocyst period, gastrula period, segmentation period, and pharyngula period. The data were analyzed with SPSS 25.0 (IBM Corp., Armonk, NY, USA) using one-way ANOVA and multiple comparisons by Wohler and Duncan methods, and p-value < 0.05 was considered the threshold for statistical significance.
Figure 4. The spatiotemporal expression patterns of gh, prl, and sl transcripts. (AC) Relative expression detected by qPCR of gh, prl and sl mRNA, respectively, in liver (L), brain (B), gonad (G), kidney (K), heart (H), skin (SK), spleen (SP), intestine (IN), gills (GI), pituitary (PI), muscle (M), and blood (BL) of different genders. Values with different letters differ significantly (p < 0.05) and using one-way ANOVA and multiple comparison by Wohler and Duncan methods. (DF) represented the relative expression patterns of gh and prl, sl mRNA in 4 Months, 7 Months, 1 Year, 1.5 Years. The dark-gray and gray separately represented female, male C. semilaevis. (GI) showed the relative expression levels of gh, prl, and sl genes in embryonic development stages which is cleavage period, blastocyst period, gastrula period, segmentation period, and pharyngula period. The data were analyzed with SPSS 25.0 (IBM Corp., Armonk, NY, USA) using one-way ANOVA and multiple comparisons by Wohler and Duncan methods, and p-value < 0.05 was considered the threshold for statistical significance.
Ijms 26 01585 g004
Figure 5. Comparison diagram of the gh genomes of males, females, and pseudo-males. (A) It is the multiple sequence alignment diagram, with yellow shading indicating a 100% similarity, blue indicating a similarity greater than 50%, and microsatellite differences highlighted in red boxes. (B) It represents the expression of gh in the pituitary glands of females (FP), males (MP), and pseudo-males (PMP) of 2 years old. Significant differences (p < 0.05) are marked by different lowercase letters (a,b,c), based on one-way ANOVA followed by Tukey’s post hoc test.
Figure 5. Comparison diagram of the gh genomes of males, females, and pseudo-males. (A) It is the multiple sequence alignment diagram, with yellow shading indicating a 100% similarity, blue indicating a similarity greater than 50%, and microsatellite differences highlighted in red boxes. (B) It represents the expression of gh in the pituitary glands of females (FP), males (MP), and pseudo-males (PMP) of 2 years old. Significant differences (p < 0.05) are marked by different lowercase letters (a,b,c), based on one-way ANOVA followed by Tukey’s post hoc test.
Ijms 26 01585 g005
Figure 6. The knock-down effect of gh, prl, and sl on the female C. semilaevis pituitary cells. (A) Interference efficiency of gh, prl and sl siRNA. (B) The expression patterns of genes in female pituitary cells after transfection with gh, sl, and prl siRNA. Dark gray represents the gene knockout site, and light gray represents the NC negative control. The data were analyzed with SPSS 25.0 (IBM Corp., Armonk, NY, USA) using t-test. The data of each downstream gene were compared with NC and p-value < 0.05 was considered the threshold for statistical significance and indicated by *. (**, p < 0.01).
Figure 6. The knock-down effect of gh, prl, and sl on the female C. semilaevis pituitary cells. (A) Interference efficiency of gh, prl and sl siRNA. (B) The expression patterns of genes in female pituitary cells after transfection with gh, sl, and prl siRNA. Dark gray represents the gene knockout site, and light gray represents the NC negative control. The data were analyzed with SPSS 25.0 (IBM Corp., Armonk, NY, USA) using t-test. The data of each downstream gene were compared with NC and p-value < 0.05 was considered the threshold for statistical significance and indicated by *. (**, p < 0.01).
Ijms 26 01585 g006
Table 1. Sequence features of growth hormone/prolactin ligand and receptor family members.
Table 1. Sequence features of growth hormone/prolactin ligand and receptor family members.
NameGene IDGene Length (bp)ORF Length (bp)Amino Length (aa)MW
(kDa)
pIChrLocationNo. of Exons
gh103387754235860320023.157.041216,479,910–16,482,2676
sl103377636333469923226.735.7641,102,903–1,106,2365
prl103393669120565421723.668.321715,922,112–15,923,3165
prl2a103383000206170823527.196.62828,798,050–28,800,1105
prl2b103380354199376225328.727.65614,399,000–14,400,9925
ghra10339768024,333190263370.714.69Z6,180,207–6,204,5399
ghrb10338909214,280168656162.414.76141,970,750–1,985,0299
prlra10339027414,542186061969.585.341425,242,433–25,256,9749
prlr-like10338968913,111153651157.995.941412,848,157–12,861,26710
prlrb1033975456636133444349.036.64Z4,468,207–4,474,8429
Table 2. The fluorescence resonance energy transfer efficiency for the binding relationship between sl and ghra, ghrb.
Table 2. The fluorescence resonance energy transfer efficiency for the binding relationship between sl and ghra, ghrb.
sl + ghrasl + ghrbgh + ghragh + ghrb
Donor Pre927199547.11556
Donor Post976.7205578.34577
Acceptor Pre272.6721.04160.74817.76
Acceptor Post159.6573.4857455.22
Efficiency0.0508860.0292680.05340.036
Note: The terms Donor post and Donor pre refer to the fluorescence intensity of the donor after and before quenching, respectively. sl + ghra represents the change in fluorescence intensity resulting from the co-transfection of pcDNA3.1-n-sl and pcDNA3.1-s-ghra. Similarly, sl + ghrb denotes the change in fluorescence intensity observed following the co-transfection of pcDNA3.1-n-sl and pcDNA3.1-s-ghrb. gh + ghra indicates the fluorescence intensity change before and after quenching for the co-transfection of pcDNA3.1-n-gh and pcDNA3.1-s-ghra. Lastly, gh + ghrb represents the fluorescence intensity change following the co-transfection of pcDNA3.1-n-gh and pcDNA3.1-s-ghrb. Efficiency is F R E T e f f = D p o s t D p r e D p o s t .
Table 3. The primers used in the present study.
Table 3. The primers used in the present study.
PrimerSequences (5′–3′)Information
gh-FATCCACGCAGCCGGTTATAGqPCR
gh-RCTCATGCTTGTTGTCGGGGAqPCR
prl-FATTCCAAGAGTCTGGGCGACqPCR
prl -RCGATCTTGTGGGAATCCCGTqPCR
sl-FCTGCTTGTTTACCGTGAGCGqPCR
sl-RGGAGACGCAGTGGAAAAGGAqPCR
gh-DNA-FGTCAGAATCAGAACCAAACCADNA
gh-DNA-RACATATGCCGACAGAATGACADNA
βactin-FTTCCAGCCTTCCTTCCTTqPCR
βactin-RTACCTCCAGACAGCACAGqPCR
gh-cds-FTAGCGTTTAAACTTAAGCTTATGGACAAACTTGTTTTACTGTFRET
gh-cds-RGAACCGTTGCCAGAGGATCCGGCGGTGCTTCCCTACAGGGTACAGTTAGCTTCTFRET
sl-cds-FTAGCGTTTAAACTTAAGCTTATGCATGCAATGATGACAGTAFRET
sl-cds-RGAACCGTTGCCAGAGGATCCGGCGGTGCTTCCTTATGCACAGTTGTACTTGTCFRET
ghra-cds-FTAGCGTTTAAACTTAAGCTTATGGCTATCCACTCACTCTCFRET
ghra-cds-RGAACCGTTGCCAGAGGATCCGGCGGTGCTTCCGCAAATTTCATGGTGAGAGFRET
ghrb-cds-FTAGCGTTTAAACTTAAGCTTATGGTTGCTGCAGGACTCGGFRET
ghrb-cds-RGAACCGTTGCCAGAGGATCCGGCGGTGCTTCCGGAGATAGAGCTGATTTATGGTGFRET
gh-site1GCUCAGUCCUGAAUCUCUUTTRNAi site1
gh-site2GGACAUGCACAAGGUGGAATTRNAi site2
gh-site3GCACAAGGUGGAAACAUAUTTRNAi site3
prl-site1CCGUACAUGUGUCACACCUTTRNAi site1
prl-site2GACGGGAUUCCCACAAGAUTTRNAi site2
prl-site3GAUCGACAGCUUCCUGAAATTRNAi site3
sl-site1CCAUCCAAGAUGCCAGUAATTRNAi site1
sl-site2GGAUCGAGCCUCUGAUCUATTRNAi site2
sl-site3GCACCAGACCUGUUGGAAUTTRNAi site3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, M.; Shi, Y.; Wang, Z.; Chen, Z.; Li, X.; Xu, W.; Wang, N. Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis. Int. J. Mol. Sci. 2025, 26, 1585. https://doi.org/10.3390/ijms26041585

AMA Style

Zhang M, Shi Y, Wang Z, Chen Z, Li X, Xu W, Wang N. Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis. International Journal of Molecular Sciences. 2025; 26(4):1585. https://doi.org/10.3390/ijms26041585

Chicago/Turabian Style

Zhang, Min, Yuhong Shi, Zhe Wang, Zhangfan Chen, Xihong Li, Wenteng Xu, and Na Wang. 2025. "Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis" International Journal of Molecular Sciences 26, no. 4: 1585. https://doi.org/10.3390/ijms26041585

APA Style

Zhang, M., Shi, Y., Wang, Z., Chen, Z., Li, X., Xu, W., & Wang, N. (2025). Genome-Wide Identification and Characterization of gh/prl/sl Family in Cynoglossus semilaevis. International Journal of Molecular Sciences, 26(4), 1585. https://doi.org/10.3390/ijms26041585

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop