MicroRNA-21 Promotes the Viability, Proliferation and Milk Fat Synthesis of Ovine Mammary Epithelial Cells by Targeting PDCD4
Abstract
1. Introduction
2. Results
2.1. Detection of Transfection Efficiency of miR-21 and PDCD4 into OMECs
2.2. The miR-21 Promotes the Proliferation and Viability of OMECs
2.3. The miR-21 Increases Triglyceride Content
2.4. PDCD4 Is a Target Gene of miR-21
2.5. miR-21 Down-Regulates the Expression of PDCD4
2.6. PDCD4 Inhibits Proliferation and Viability of OMECs
2.7. PDCD4 Decreases Triglyceride Content
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Cell Transfection and Real-Time Fluorescence Quantification (RT-qPCR)
4.3. Determination of Cell Proliferation and Viability
4.4. Validation of the Target Genes for miR-21 Using a Dual-Luciferase Reporter Assay
4.5. Triglyceride Content Detection
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Akers, R.M. A 100-Year Review: Mammary development and lactation. J. Dairy Sci. 2017, 100, 10332–10352. [Google Scholar] [CrossRef] [PubMed]
- Ashraf, A.; Imran, M. Causes, types, etiological agents, prevalence, diagnosis, treatment, prevention, effects on human health and future aspects of bovine mastitis. Anim. Health Res. Rev. 2020, 21, 36–49. [Google Scholar] [CrossRef] [PubMed]
- Nowak, R.; Poindron, P. From birth to colostrum: Early steps leading to lamb survival. Reprod. Nutr. Dev. 2006, 46, 431–446. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef]
- Krol, J.; Loedige, I.; Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet. 2010, 11, 597–610. [Google Scholar] [CrossRef]
- Jonas, S.; Izaurralde, E. Towards a molecular understanding of microRNA-mediated gene silencing. Nat. Rev. Genet. 2015, 16, 421–433. [Google Scholar] [CrossRef] [PubMed]
- Nagaoka, K.; Zhang, H.; Watanabe, G.; Taya, K. Epithelial cell differentiation regulated by MicroRNA-200a in mammary glands. PLoS ONE 2013, 8, e65127. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Luo, J.; Zhang, L.; Wang, W.; Gou, D. MiR-103 controls milk fat accumulation in goat (Capra hircus) mammary gland during lactation. PLoS ONE 2013, 8, e79258. [Google Scholar] [CrossRef]
- Li, X.; Jiang, P.; Yu, H.; Yang, Y.; Xia, L.; Yang, R.; Fang, X.; Zhao, Z. miR-21-3p Targets Elovl5 and Regulates Triglyceride Production in Mammary Epithelial Cells of Cow. DNA Cell Biol. 2019, 38, 352–357. [Google Scholar] [CrossRef]
- Zennami, K.; Choi, S.M.; Liao, R.; Li, Y.; Dinalankara, W.; Marchionni, L.; Rafiqi, F.H.; Kurozumi, A.; Hatano, K.; Lupold, S.E. PDCD4 Is an Androgen-Repressed Tumor Suppressor that Regulates Prostate Cancer Growth and Castration Resistance. Mol. Cancer Res. 2019, 17, 618–627. [Google Scholar] [CrossRef] [PubMed]
- Fujita, S.; Ito, T.; Mizutani, T.; Minoguchi, S.; Yamamichi, N.; Sakurai, K.; Iba, H. miR-21 Gene expression triggered by AP-1 is sustained through a double-negative feedback mechanism. J. Mol. Biol. 2008, 378, 492–504. [Google Scholar] [CrossRef]
- Gu, J.B.; Bao, X.B.; Ma, Z. Effects of miR-21 on proliferation and apoptosis in human gastric adenocarcinoma cells. Oncol. Lett. 2018, 15, 618–622. [Google Scholar] [CrossRef]
- Feuermann, Y.; Kang, K.; Shamay, A.; Robinson, G.W.; Hennighausen, L. MiR-21 is under control of STAT5 but is dispensable for mammary development and lactation. PLoS ONE 2014, 9, e85123. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Wu, H.; Wu, F.; Nie, D.; Sheng, S.; Mo, Y.Y. MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008, 18, 350–359. [Google Scholar] [CrossRef]
- Song, M.J.; Lee, E.J.; Yang, Y.; Sung, M.K. Luteolin supplementation modulates mammary tumor growth in C3H mice fed diet with high- and low-fat content. Nutr. Cancer 2014, 66, 523–530. [Google Scholar] [CrossRef]
- Han, D.X.; Sun, X.L.; Xu, M.Q.; Chen, C.Z.; Jiang, H.; Gao, Y.; Yuan, B.; Zhang, J.B. Roles of differential expression of microRNA-21-3p and microRNA-433 in FSH regulation in rat anterior pituitary cells. Oncotarget 2017, 8, 36553–36565. [Google Scholar] [CrossRef]
- Shibahara, K.; Asano, M.; Ishida, Y.; Aoki, T.; Koike, T.; Honjo, T. Isolation of a novel mouse gene MA-3 that is induced upon programmed cell death. Gene 1995, 166, 297–301. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Du, L.; Ren, Y.; Liu, X.; Jiao, Q.; Cui, D.; Wen, M.; Wang, C.; Wei, G.; Wang, Y.; et al. SKP2 promotes breast cancer tumorigenesis and radiation tolerance through PDCD4 ubiquitination. J. Exp. Clin. Cancer Res. 2019, 38, 76. [Google Scholar] [CrossRef] [PubMed]
- Hua, R.; Zhang, X.; Li, W.; Lian, W.; Liu, Q.; Gao, D.; Wang, Y.; Lei, M. Ssc-miR-21-5p regulates endometrial epithelial cell proliferation, apoptosis and migration via the PDCD4/AKT pathway. J. Cell Sci. 2020, 133, jcs248898. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Xin, S.; He, Z.; Che, X.; Wang, J.; Xiao, X.; Chen, J.; Song, X. MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor PDCD4 and promotes cell transformation, proliferation, and metastasis in renal cell carcinoma. Cell Physiol. Biochem. 2014, 33, 1631–1642. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Hao, Z.; Hu, J.; Liu, X.; Li, S.; Wang, J.; Shen, J.; Song, Y.; Ke, N.; Luo, Y. Small RNA deep sequencing reveals the expressions of microRNAs in ovine mammary gland development at peak-lactation and during the non-lactating period. Genomics 2021, 113, 637–646. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Cheng, Z.; Wang, L.; Jiao, B.; Yang, H.; Wang, X. MiR-21-3p Centric Regulatory Network in Dairy Cow Mammary Epithelial Cell Proliferation. J. Agric. Food. Chem. 2019, 67, 11137–11147. [Google Scholar] [CrossRef] [PubMed]
- Si, M.L.; Zhu, S.; Wu, H.; Lu, Z.; Wu, F.; Mo, Y.Y. miR-21-mediated tumor growth. Oncogene 2007, 26, 2799–2803. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Liao, B.; Xiang, X.; Ke, S. miR-21-5p promotes cell proliferation and G1/S transition in melanoma by targeting CDKN2C. FEBS Open Bio 2020, 10, 752–760. [Google Scholar] [CrossRef] [PubMed]
- Lankat-Buttgereit, B.; Göke, R. The tumour suppressor Pdcd4: Recent advances in the elucidation of function and regulation. Biol. Cell 2009, 101, 309–317. [Google Scholar] [CrossRef]
- Ozpolat, B.; Akar, U.; Steiner, M.; Zorrilla-Calancha, I.; Tirado-Gomez, M.; Colburn, N.; Danilenko, M.; Kornblau, S.; Berestein, G.L. Programmed cell death-4 tumor suppressor protein contributes to retinoic acid-induced terminal granulocytic differentiation of human myeloid leukemia cells. Mol. Cancer Res. 2007, 5, 95–108. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, Z.; Zha, Y.; Hu, W.; Huang, Z.; Gao, Z.; Zang, Y.; Chen, J.; Dong, L.; Zhang, J. The autoregulatory feedback loop of microRNA-21/programmed cell death protein 4/activation protein-1 (MiR-21/PDCD4/AP-1) as a driving force for hepatic fibrosis development. J. Biol. Chem. 2013, 288, 37082–37093. [Google Scholar] [CrossRef]
- Xiao, J.; Pan, Y.; Li, X.H.; Yang, X.Y.; Feng, Y.L.; Tan, H.H.; Jiang, L.; Feng, J.; Yu, X.Y. Cardiac progenitor cell-derived exosomes prevent cardiomyocytes apoptosis through exosomal miR-21 by targeting PDCD4. Cell Death Dis. 2016, 7, e2277. [Google Scholar] [CrossRef]
- Feng, M.G.; Liu, C.F.; Chen, L.; Feng, W.B.; Liu, M.; Hai, H.; Lu, J.M. MiR-21 attenuates apoptosis-triggered by amyloid-β via modulating PDCD4/PI3K/AKT/GSK-3β pathway in SH-SY5Y cells. Biomed. Pharmacother. 2018, 101, 1003–1007. [Google Scholar] [CrossRef]
- Xia, H.; Zhao, Y. miR-155 is high-expressed in polycystic ovarian syndrome and promotes cell proliferation and migration through targeting PDCD4 in KGN cells. Artif. Cells Nanomed. Biotechnol. 2020, 48, 197–205. [Google Scholar] [CrossRef]
- Lawlor, M.A.; Alessi, D.R. PKB/Akt: A key mediator of cell proliferation, survival and insulin responses? J. Cell Sci. 2001, 114, 2903–2910. [Google Scholar] [CrossRef] [PubMed]
- Brunet, A.; Bonni, A.; Zigmond, M.J.; Lin, M.Z.; Juo, P.; Hu, L.S.; Anderson, M.J.; Arden, K.C.; Blenis, J.; Greenberg, M.E. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 1999, 96, 857–868. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Wang, J.; Mao, X.; Xu, H.; Zhu, Z. PDCD4 regulates apoptosis in human peritoneal mesothelial cells and promotes gastric cancer peritoneal metastasis. Histol. Histopathol. 2021, 36, 447–457. [Google Scholar] [PubMed]
- Wei, N.; Liu, S.S.; Chan, K.K.; Ngan, H.Y. Tumour suppressive function and modulation of programmed cell death 4 (PDCD4) in ovarian cancer. PLoS ONE 2012, 7, e30311. [Google Scholar] [CrossRef]
- Cheng, Y.; Xiang, G.; Meng, Y.; Dong, R. MiRNA-183-5p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting the PDCD4. Reprod. Biol. 2016, 16, 225–233. [Google Scholar] [CrossRef]
- Fu, X.; He, Y.; Wang, X.; Peng, D.; Chen, X.; Li, X.; Wang, Q. Overexpression of miR-21 in stem cells improves ovarian structure and function in rats with chemotherapy-induced ovarian damage by targeting PDCD4 and PTEN to inhibit granulosa cell apoptosis. Stem Cell Res. Ther. 2017, 8, 187. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Rouel, J.; Leroux, C.; Ferlay, A.; Faulconnier, Y.; Legrand, P.; Chilliard, Y. Mammary lipid metabolism and milk fatty acid secretion in alpine goats fed vegetable lipids. J. Dairy Sci. 2005, 88, 1478–1489. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Wei, W.; Pei, D.; Zhang, F.; Duan, Y.; Guo, Y.; Jiang, Y.; Xia, S.; Han, J.; Hou, J.; et al. Effects of PDCD4 on the apoptosis of dairy goat mammary epithelial cells and the synthesis of β-casein and TG. Acta Vet. Zootech. Sin. 2023, 54, 1429–1440. [Google Scholar]
- Wang, W.; Zhao, J.; Wang, H.; Sun, Y.; Peng, Z.; Zhou, G.; Fan, L.; Wang, X.; Yang, S.; Wang, R.; et al. Programmed cell death 4 (PDCD4) mediates the sensitivity of gastric cancer cells to TRAIL-induced apoptosis by down-regulation of FLIP expression. Exp. Cell Res. 2010, 316, 2456–2464. [Google Scholar] [CrossRef] [PubMed]
- Hao, Z.; Wang, J.; Luo, Y.; Hu, J.; Liu, X.; Li, S.; Li, M.; Shi, B.; Hu, L.; Liu, Y.; et al. MicroRNA-200c Affects Milk Fat Synthesis by Targeting PANK3 in Ovine Mammary Epithelial Cells. Int. J. Mol. Sci. 2022, 23, 15601. [Google Scholar] [CrossRef]
- Xia, L.; Zhao, Z.; Yu, X.; Lu, C.; Jiang, P.; Yu, H.; Li, X.; Yu, X.; Liu, J.; Fang, X.; et al. Integrative analysis of miRNAs and mRNAs revealed regulation of lipid metabolism in dairy cattle. Funct. Integr. Genom. 2021, 21, 393–404. [Google Scholar] [CrossRef] [PubMed]
- Hao, Z.; Luo, Y.; Wang, J.; Hickford, J.G.H.; Zhou, H.; Hu, J.; Liu, X.; Li, S.; Shen, J.; Ke, N.; et al. MicroRNA-432 inhibits milk fat synthesis by targeting SCD and LPL in ovine mammary epithelial cells. Food Funct. 2021, 12, 9432–9442. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
miRNAs/Genes | Sequence Information | Purpose | Fragment Length and Annealing Temperature | |
---|---|---|---|---|
Forward (5′–3′) | Reverse (5′–3″) | |||
miR-21 | CGCGTAGCTTATCAGACTGATGTTGAC | mRQ 3′ primer | RT-qPCR | 60 °C |
PDCD4 | GATGATGACCAGGAGAAC | TCCAACGCTAAGGACACT | 200 bp, 58 °C | |
18sRNA | GTGGTGTTGAGGAAAGCAGACA | TGATCACACGTTCCACCTCATC | 79 bp, 60 °C | |
U6 | ACGGACAGGATTGACAGATT | TCGCTCCACCAACTAAGAA | 80 bp, 58 °C | |
GAPDH | ATCTCGCTCCTGGAAGATG | TCGGAGTGAACGGATTCG | 173 bp, 58 °C | |
PDCD4 (WT) | CCGctcgagAGGGTGTAAAGGAGGGAC | ATTTgcggccgcGAAAGGAGTGGCAGTCAG | Construction of dual luciferase reporter vectors | 356 bp, 60 °C |
PDCD4 (Mut) | TTCTCtattcgaACCTTTTGTAAGTGCCATGTTTATG | AAGGTtcgaataGAGAATATCCCACTTAAGAAGTGGTTAC | 368 bp, 60 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, L.; Wang, J.; Hao, Z.; Guo, X.; Li, M.; Wu, X.; Zhen, H.; Ren, C.; Zhao, Y.; Yang, P.; et al. MicroRNA-21 Promotes the Viability, Proliferation and Milk Fat Synthesis of Ovine Mammary Epithelial Cells by Targeting PDCD4. Int. J. Mol. Sci. 2025, 26, 1460. https://doi.org/10.3390/ijms26041460
Hu L, Wang J, Hao Z, Guo X, Li M, Wu X, Zhen H, Ren C, Zhao Y, Yang P, et al. MicroRNA-21 Promotes the Viability, Proliferation and Milk Fat Synthesis of Ovine Mammary Epithelial Cells by Targeting PDCD4. International Journal of Molecular Sciences. 2025; 26(4):1460. https://doi.org/10.3390/ijms26041460
Chicago/Turabian StyleHu, Liyan, Jiqing Wang, Zhiyun Hao, Xian Guo, Mingna Li, Xinmiao Wu, Huimin Zhen, Chunyan Ren, Yuan Zhao, Pan Yang, and et al. 2025. "MicroRNA-21 Promotes the Viability, Proliferation and Milk Fat Synthesis of Ovine Mammary Epithelial Cells by Targeting PDCD4" International Journal of Molecular Sciences 26, no. 4: 1460. https://doi.org/10.3390/ijms26041460
APA StyleHu, L., Wang, J., Hao, Z., Guo, X., Li, M., Wu, X., Zhen, H., Ren, C., Zhao, Y., Yang, P., & Wang, X. (2025). MicroRNA-21 Promotes the Viability, Proliferation and Milk Fat Synthesis of Ovine Mammary Epithelial Cells by Targeting PDCD4. International Journal of Molecular Sciences, 26(4), 1460. https://doi.org/10.3390/ijms26041460