Next Article in Journal
The Mitigating Effect and Mechanism of Polydeoxyribonucleotide Against Zoledronic Acid-Induced Growth Suppression of Human Gingival Fibroblasts
Previous Article in Journal
Correlation Between Intrafollicular IL-10, Progesterone, and Bovine Oocyte Developmental Competence
Previous Article in Special Issue
Juvenile Hormone and Ecdysteroids Facilitate the Adult Reproduction Through the Methoprene-Tolerant Gene and Ecdysone Receptor Gene in the Female Spodoptera frugiperda
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 23
10.3390/ijms262311366
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Glutathione S-Transferase (GST) Activities and Gene Expression Patterns of Different GST Classes in Musca domestica L. Depending on Sex and Stage of Development

by
Vladislava Garbaly
,
Kseniya Krestonoshina
,
Anna Kinareikina
,
Svetlana Bobreshova
,
Anastasiya Avdeeva
,
Juliya Ismagilova
,
Ivan Zaitsev
and
Elena Silivanova
*
All-Russian Scientific Research Institute of Veterinary Entomology and Arachnology—Branch of Federal State Institution Federal Research Centre Tyumen Scientific Centre of Siberian Branch of the Russian Academy of Sciences (ASRIVEA—Branch of Tyumen Scientific Centre SB RAS), Institutskaya St. 2, Tyumen 625041, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(23), 11366; https://doi.org/10.3390/ijms262311366
Submission received: 29 September 2025 / Revised: 5 November 2025 / Accepted: 21 November 2025 / Published: 24 November 2025
(This article belongs to the Special Issue Molecular Ecology, Physiology and Biochemistry of Insects, 5th Edition)
Browse Figures
Versions Notes

Abstract

Insecticide resistance in insects poses a serious problem in population control of arthropod vectors and spreaders of human and animal diseases. Metabolic resistance to insecticides is facilitated by detoxification system enzymes, including glutathione-S-transferases (GSTs) involved in phase II of xenobiotic biotransformation. The aim of this study was to analyze the glutathione-S-transferase activity and the expression level of different class GST genes in Musca domestica. The test subjects were larvae and 3–5-day-old adults of a laboratory susceptible strain (LabTY) and a field deltamethrin-tolerant population (Nik). Based on the LC50 values, the Nik strain showed sensitivity to chlorpyrifos and chlorfenapyr and tolerance to deltamethrin with a remarkable increase in the level of resistance in males compared to females. Expression analysis of eight GST genes revealed that the expression of the GST-E12 gene (Epsilon class) was significantly elevated and the GST-S1 gene (Sigma class) was significantly decreased in the Nik strain across all groups (larvae, females, and males), with the most pronounced difference in females. A pronounced sexual dimorphism was observed: the expression of most GST genes was significantly higher in males than in females in both strains. For the first time, a consistent male-specific overexpression of multiple GST genes has been demonstrated in M. domestica.

1. Introduction

Glutathione-S-transferases (GSTs) (EC 2.5.1.18) are a diverse family of enzymes [1] in which three subfamilies of isoforms are identified: cytosolic, mitochondrial and microsomal [2]. The cytosolic GST form is a superfamily of multifunctional dimeric isoenzymes, which are found in almost all organisms, from microbes to higher animals [2,3,4,5]. In the nucleophilic substitution reaction, GST catalyzes the conjugation of a reduced glutathione (GSH) by its thiol group to various electrophilic chemical substrates [3,6,7]. The mechanism of catalytic action of GST is to reduce the pK of the sulfhydryl group of GSH and convert it into the thiolate (GS−) anionic state at neutral pH, which accelerates its conjugation with substrates [8]. The glutathione conjugates formed are generally less reactive and therefore less toxic [3], as well as more soluble than the parent compounds, which facilitates their exocytic release [2,3,4,5].
Arthropod cytosolic GSTs are mainly involved in adaptation to xenobiotics [2], i.e., they are phase II detoxification enzymes [6]. GST substrates can be both endogenous natural compounds (peroxides, organic hydroperoxides, activated alkenes) and electrophilic xenobiotics [2], such as pesticides [3]. Insecticides can be metabolized either by reductive dehydrochlorination, promoted by GST, or by conjugation reactions with GSH. Additionally, GSTs help to eliminate dangerous types of oxygen-free radicals generated by insecticides [4], providing protection against oxidative stress [2].
Insects possess many different GST isoenzymes [2,3]. For example, about 30 GST genes from different subfamilies have been identified in mosquitoes [6]. It is also hypothesized that additional isoenzymes may occur through posttranslational modifications [3]. A mammalian GST nomenclature system has been adopted for insect enzymes, which categorizes them based on amino acid sequences [5] into six classes: delta, epsilon, theta, omega, sigma, and zeta [2,9,10]. The delta and epsilon classes are unique to insects [2,5,11].
The delta and epsilon classes are thought to be involved in neutralizing toxins in insects [1,10]. Epsilon-GST overexpression is often associated with insecticide resistance in insects [4,12,13,14,15]. For example, a single treatment with insecticides (chlorpyrifos [12], xanthotoxin [13], permethrin, DDT (1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane)) [14], chlorantraniliprole [15]) promotes increased expression of epsilon-GST isoforms in insect species such as Cnaphalocrocis medinalis (Lepidoptera: Crambidae) [12], Spodoptera litura (Lepidoptera: Noctuidae) [13], Bombyx mori (Lepidoptera: Bombycidae) [14], Pieris rapae (Lepidoptera: Pieridae) [15]. In Aedes aegypti (Diptera: Culicidae), partial suppression of GSTe7 and GSTe2 genes increased insect sensitivity to the pyrethroid deltamethrin that suggests the epsilon-class GST genes’ contribution to insecticide resistance [16]. A number of studies have examined the involvement of delta-class GSTs in insecticide resistance [17,18]. A notable example of delta-class GST involvement is the enzyme agGSTd1-6 from the malaria mosquito Anopheles gambiae (Diptera: Culicidae) [17]. Its elevated activity is directly associated with resistance to DDT, and structural analysis has revealed a specialized hydrophobic active site capable of accommodating the insecticide’s metabolites. Furthermore, in the codling moth Cydia pomonella (Lepidoptera: Tortricidae), resistance to the pyrethroid lambda-cyhalothrin is linked to the overexpression of CpGSTd1 and CpGSTd3, with the recombinant CpGSTd3 protein demonstrating a high capacity to bind this insecticide, implicating the delta class in resistance mechanisms [18]. Additionally, increased expression of 9 out of 15 delta-class GST genes was found in the malathion- and propoxur-resistant population of psocids Liposcelis entomophila (Enderlein) (Psocoptera: Liposcelididae) from China and several of these genes responded with different expression patterns to malathion, propoxur or deltamethrin exposure [19]. The sigma-class GST is also important for insects. For example, it was shown that the sigma-class GST identified in the honeybee Apis cerana cerana (AcGSTS1) was significantly activated in response to various abiotic stresses (cold, heat, UV, H2O2, HgCl2, and insecticides), but with different levels of induction. These results indicated that AccGSTS1 is a critical antioxidant enzyme involved in cellular antioxidant defense and honeybee survival [20].
The house fly Musca domestica L. (Diptera: Muscidae) is a global pest of public health and agriculture [21,22,23]. This synanthropic insect is a transmitter for over 100 different diseases in animals and humans, including typhoid fever, dysentery, diphtheria, leprosy, tuberculosis, cholera, anthrax and intestinal parasites [21,23,24]. M. domestica L. reproduces at an extremely high rate and develops rapidly [21,25]. The population of this insect species is controlled by humans mainly through insecticides [22,25]. However, the house fly, like other insect species, is able to form resistance to different classes of insecticides [26] (organophosphates, organohalogenides [3], pyrethroids [6], carbamates, organochlorine compounds [4], etc.), which jeopardizes the effectiveness of chemical control strategies [22]. One of the mechanisms for tolerance to insecticides is the enhancement of their metabolism by changing the activity and expression level of certain isoforms of detoxification enzymes [4], including glutathione-S-transferases [2,5]. However, since not all isoenzymes of the GST superfamily are associated with insecticide resistance, it is often difficult to identify specific isoforms involved in this process in M. domestica [3]. Two cDNA MdGST genes, MdGST-6A and -6B, which are involved in the development of insecticide resistance [3], were isolated in the ultra-resistant Cornell-HR strain of the house fly. In addition, Sue et al. [27] found that GST-6A plays a central role in the development of resistance to organophosphates of the O-alkylphosphate type in organophosphate-resistant strain Yachiyo M. domestica L. However, the main role of GST-6B that the authors noted was the activation of prothiofos and its increased toxicity in the same house fly strain. The house fly has been shown to possess several delta-class GST genes (MdGST1–MdGST4) [28]. Previously, Fournier demonstrated that MdGST1 detoxifies organophosphorus insecticides [29].
In this study, the total GST activity and expression levels of different GST classes were assessed in house flies of a field population. While several studies have examined GST expression in females, data on males remain limited. However, existing sex-specific analyses suggest that males exhibit a wide range of responses to insecticide stress, from high susceptibility to high tolerance, even within the same population. This variation may be attributed to the polygenic nature of resistance and its potential for sex-linked inheritance [30,31]. Consequently, males may serve as a “reservoir” of resistance to insecticides or new xenobiotics, which can be activated under selection pressure. Studies that exclude males are thus biologically incomplete, as they may lead to an underestimation of resistant alleles in the population. The present study evaluated the GST activity in larvae and adults, both females and males, of a field M. domestica population in comparison to a laboratory strain. The field population was collected from a livestock farm with a history of pyrethroid use for fly control, prompting an assessment of adults’ sensitivity to deltamethrin and potential cross-resistance to chlorpyrifos and chlorfenapyr. The expression levels of different GST classes were determined by focusing on genes encoding GST isoforms with the highest potential contribution to insecticide resistance in the house fly, due to their practical relevance for resistance monitoring. Comparative analysis of the expression levels of these selected genes among larvae, females, and males of the field and laboratory strains identified a potential marker of adaptation to regular insecticide exposure that was independent of developmental stage and sex. This may be useful to specify the possible role of GSTs in the development of insecticide resistance in the house fly, as well as in other species of Diptera insects of economic, medical, and veterinary importance.

2. Results

2.1. No-Choice Feeding Bioassay

For the correct interpretation of the enzymatic activity and GST gene expression results, a toxicological characterization of M. domestica strains (Nik, a field population, and Lab TY, a laboratory susceptible strain) with different insecticide sensitivity phenotypes was performed. According to the lethal concentrations for 50% mortality (LC50) and the resistance ratio (RR) values (Table 1), the M. domestica adults of the Nik strain were tolerant to the pyrethroid deltamethrin and showed no resistance to the organophosphate chlorpyrifos and the pyrrole chlorfenapyr. It is noteworthy that the LC50 values for most insecticides in males were almost half those for females, with the exception of deltamethrin for the Nik individuals. For the Nik strain, based on the RR, males (RR = 6.73) were more resistant to deltamethrin than females (RR = 2.75).

2.2. Glutathione-S-Transferase Activities

To identify the biochemical mechanisms underlying the observed toxicological differences, glutathione S-transferase (GST) activity was analyzed. The GST activity values did not differ depending on sex in the LabTY and Nik strains (Figure 1). In the Nik population, the mean value of the GST activity in larvae was 1.24-times statistically significantly lower than that of the males.

2.3. Gene Expression Levels of GST Isoforms

To assess which specific isoforms could influence the activity of GST enzymes, and to what extent these differences are due to the origin of the strain and the stage of development, the expression of several GST genes was analyzed. Given the limited transcriptomic and functional data available for M. domestica GSTs, a comparative genomic approach with the well-annotated and extensively studied model organism Drosophila melanogaster provides a valuable strategy for the identification and initial characterization of putative resistance-associated GST isoforms. Genomic prediction in M. domestica yielded 33 glutathione S-transferase (GST) genes alongside three splice variants. This predicted GST repertoire is of a similar scale to that of D. melanogaster, which possesses 36 genes and 11 splice variants [32]. Phylogenetic assessment of the cytosolic GSTs from both species indicated that the M. domestica genes are integrated within the canonical class structure—comprising epsilon, omega, theta, sigma, and zeta—observed in D. melanogaster. In addition to the cytosolic forms, four microsomal GST genes were identified in M. domestica, closely resembling the complement of three genes (producing four isoforms) found in D. melanogaster [24]. Based on data from Scott et al. (2014) [24], a table of orthologs of the GST genes in D. melanogaster and M. domestica was compiled (Table 2). To further prioritize candidates with a high potential for involvement in insecticide resistance, we analyzed public RNA-Seq datasets from insecticide-exposed Diptera (including D. melanogaster, Culex pipiens, and M. domestica). The eight GSTs were chosen because they represent key classes and are orthologs of genes associated with the resistance in other Diptera, making them the strongest candidates for a focused investigation into metabolic resistance in M. domestica populations.
Expression analysis of eight GST genes in larvae, males, and females of two strains of the housefly M. domestica (LabTY and Nik) revealed significant differences dependent on developmental stage, sex, and genetic background. Statistically significant differences between groups (larvae, males, females) were observed for 7 out of 8 genes (87.5%), while between-strain differences (LabTY vs. Nik) were significant for only two genes (25%) (Figure 2).
Between-strain comparisons revealed significant differences for GST-E12 (p = 0.017) and GST-S1 (p = 0.0004). Expression of GST-E12 in larvae, males and females of the Nik strain was 2.4-, 2.5- and 14.5- times, respectively, higher compared to the LabTY strain. For GST-S1, on the contrary, the expression level in larvae, males and females of the Nik strain was 3.3- (p = 0.076), 3.7, and 8.9- times lower, respectively, than in the LabTY individuals. For the remaining genes, the differences did not reach significance (p > 0.05), although a trend was observed for GST-6B (p = 0.0934). Detailed analyses with the Kruskal–Wallis and the nonparametric Dunn’s test within strains showed that in LabTY larvae, GST-S1 expression was 47.4 times higher than GST-2 (p = 0.023). In Nik larvae, GST-E12 expression was 222.1 times higher than GST-6A (p = 0.008). In Nik males, GST-E3 expression was 35.2 times higher than GST-2 (p = 0.042). In Nik females, GST-E3 expression was 28.6 times higher than GST-E2 (p = 0.042). In LabTY females, the GST-S1 expression was 84.9- and 121.3-times higher than that of GST-2 (p = 0.028) and GST-6A (p = 0.034), respectively.
After pairwise comparison of the expression levels of certain genes between all insect groups, the following statistically significant differences were noted: GST-6B expression was 31.2 times higher in Nik males compared to LabTY larvae (p = 0.009); GST-S1 and GST-E2 were 11.4- (p = 0.009) and 16.7-times (p = 0.009), respectively, higher in LabTY males compared to Nik females; GST-E3 was 29.7 times higher in Nik males compared to LabTY larvae (p = 0.009); GST-E12 and GST-T1 was 60.7- and 33.8-times, respectively, higher in Nik males compared to LabTY females (respectively, p = 0.009 and p = 0.011).
In the present study, gene expression of GST-E12 and GST-S1 isoforms showed statistically significant differences between strains: GST-E12 expression was elevated in Nik strain across all stages (up to 14.5-fold in females), while GST-S1 was significantly higher in LabTY strain (up to 8.9-fold in females). Moreover, GST-S1 exhibits strain-specific expression patterns without sexual dimorphism, with significantly higher expression in the susceptible LabTY strain compared to the resistant Nik strain, whereas GST-E12 expression depends on both strain and sex factors (Figure 3). However, no consistent inter-strain expression pattern was observed for the remaining six GST genes analyzed. The obtained results suggest that in M. domestica, specific GST isoforms exhibit strain-specific regulation patterns, which may reflect differential adaptation mechanisms between laboratory and field populations.

3. Discussion

This study was conducted to evaluate the GST activity and the expression level of eight GST genes in two different strains of the house fly: the susceptible laboratory-derived LabTY strain and the field deltamethrin-tolerant Nik population. The obtained results were compared, firstly, in terms of differences between two populations (field populations versus laboratory susceptible), secondly, for differences in the expression level of GST-class genes, and thirdly, the presence of sex-dependent differences in the GST activity and the expression level of genes in insects of both strains was analyzed.
It is known that the level of the GST activity in pyrethroid-resistant insects may not vary [33,34] or could be elevated compared to sensitive specimens [34,35,36]. Kristensen (2005) found a 1.58-fold increase in CDNB-GST activity in females of a field population of house fly resistant to organophosphates and pyrethroids (791a), compared to females of a susceptible strain (WHO) [35]. Elevated levels of GST activity (2.9–5.2 times) were also detected in females of extensively pyrethroid-resistant populations of M. domestica from livestock farms in Iran relative to control specimens [36]. Interestingly, after a single exposure to the pyrethroid lambda-cyhalothrin, El Sherif et al. (2022) found no significant changes in GST activity in M. domestica larvae of the field population compared to sensitive specimens [25]. These observations are also consistent with the results of other authors who studied the dynamics of resistance development to pyrethroids in M. domestica. In the studies by Wang et al. (2012) [37] and Sokolyanskaya (2014) [38] after long-term selection (up to the G30 generation) with pyrethroids (deltamethrin, fenvalerate), higher GST activity in selected specimens of the house fly was observed. And vice versa, a decrease in GST activity in larvae of pyrethroid-resistant field population of M. domestica was observed when the exposure to pyrethroids ceased for 25 generations, and as a result, the insect tolerance decreased [39]. In this study, the GST activity of M. domestica males of the deltamethrin-tolerant Nik population not differed compared to the susceptible strain (Figure 1). It is noteworthy that females and males of the field population did not differ in GST activity, despite the fact that the Nik males (RR = 6.73) were more resistant to deltamethrin than females (RR = 2.75) of this strain. As mentioned in the review by Enayati et al., 2005 [1], the role of GSTs in insect defense against pyrethroids may involve not only direct catalysis of insecticides via conjugation, but also the sequestration of insecticide molecules and the manifestation of peroxidase activity to neutralize the effects of oxidative stress caused by pyrethroids. However, catalytic activity towards CDNB may not differ between pyrethroid-resistant and sensitive insects. Recent experimental confirmation of the involvement of GSTs in lambda-cyhalothrin resistance via sequestration was provided for C. pomonella [18].
Previous studies by other authors have already demonstrated the increased expression of epsilon class GST isoforms in pyrethroid-resistant insect populations [16,40,41,42,43]. The studies were mainly focused on insect vectors of medical and veterinary importance—mosquitoes of genera Culex, Aedes and Anopheles. In Aedes aegypti, Anopheles funestus, and Anopheles sinensis (Diptera: Culicidae) mosquitoes resistant to DDT and the pyrethroids (permethrin, deltamethrin) researchers have observed increased expression of GSTe2, GSTe3, GSTe4, GSTe5, and GSTe6 genes [16,40,41,43]. For other pyrethroid resistant insect species, such as Rhynchophorus ferrugineus (Coleoptera: Curculionidae), high expression of GSTd1-4 and GSTe1-8 has been reported [42]. In the study by Chen et al. (2023) on a field population of Diaphorina citri (Hemiptera: Liviidae) resistant to the pyrethroid fenpropathrin, most of the GST isoforms in adult insects without sex separation did not change transcript levels or there was even a decrease in transcript levels [44].
Analysis of GST gene expression revealed pronounced sexual dimorphism across both strains studied. Male-specific overexpression was observed for multiple GST genes: GST2 expression was 20.5-fold higher in LabTY males compared to LabTY females, while GST-E12 showed 4.2-fold higher expression in Nik males than in Nik females. Similar male-biased patterns were detected for GST-E3, GST-E2, GST-6A, and GST-6B, indicating a consistent trend across different GST classes. The represented data suggest a predominant influence of sexual dimorphism and developmental stage on GST gene expression, with peak levels in males, which may be related to their enhanced role in xenobiotic detoxification in the gonads or during mating. This sexual dimorphism in GST expression aligns with previous findings in other insect species. Studies in Ae. aegypti reported higher expression of epsilon class GSTs in males of pesticide-resistant populations [16]. Similarly, research on D. melanogaster demonstrated significantly higher GST activity in males compared to females under both control and pesticide-exposure conditions [45]. These observations suggest that sexual dimorphism in detoxification enzyme expression may be a widespread phenomenon in insects. The biological significance of male-biased GST expression in M. domestica requires further investigation. While the specific functional implications for insecticide resistance remain to be fully elucidated, the consistent overexpression of multiple GST genes in males across both laboratory and wild strains suggests potential differences in detoxification capacity between sexes. This pattern may reflect underlying physiological or ecological factors influencing GST regulation in male and female houseflies.
The pronounced male-biased expression of multiple GST genes observed in the present study represents a contrasting pattern to previously reported female-specific detoxification mechanisms in M. domestica. The probability of sex differences in mechanisms of insecticide resistance in M. domestica was previously demonstrated using spinosad as an example [46,47,48]. For instance, the study results of CYP6A1, CYP6D1 and CYP6D3 expression levels in males and females of spinosad-, fipronil- and imidacloprid-resistant strains of M. domestica indicated that the involvement of cytochromes P450 in the development of resistance to spinosad is more specific for females than for males [46]. In another study, the expression levels of CYP4G2, CYP6A5v2 and MdαE7 genes were statistically significantly higher in spinosad-resistant M. domestica females than in susceptible females, while the expression levels of these genes were lower in spinosad-resistant males than in susceptible males [47,48]. This divergence suggests that sexual dimorphism in insecticide resistance mechanisms may be compound-specific and involve different detoxification enzyme families. The coexistence of both male-biased (GST) and female-biased (P450) resistance mechanisms within the same species highlights the complexity of metabolic adaptation in M. domestica and suggests potential sex-specific evolutionary trajectories in response to different insecticide selection pressures.

4. Materials and Methods

4.1. Insects

The research was carried out with individuals of two Musca domestica strains, namely the LabTY and the Nik. The LabTY is the laboratory susceptible strain obtained in 2009 from Novosibirsk Agrarian University (Russian Federation). The Nik is the field population that was captured in May–September 2023 in livestock houses of the Tyumen Region (Russian Federation), where pyrethroid deltamethrin-based formulations were used against houseflies for several seasons. The 18–19th generation of the Nik population was used in this study. The Lab TY and the Nik strains are kept in insectariums of the ASRIVEA—Branch of Tyumen Scientific Centre SB RAS without contact to insecticides.
The larvae of M. domestica were kept in 800 cm3 glass beakers and reared on an artificial diet consisting of 55 g of bran and 150 mL of water until the pupation stage. Following eclosion, adult flies were kept in nylon cages with metal frames measuring 25 cm × 25 cm × 25 cm. They were provided with a diet of dry baby food products and water, and were maintained under standard conditions at 24–28 °C, 60–80% relative humidity and a 12 h/12 h (light/dark) photoperiod.

4.2. No-Choice Feeding Bioassay

The no-choice feeding bioassay was used for laboratory tests of the chlorpyrifos technical substance (technical substance, 97%, Jiangsu Inter-China Group Corporation, Zhenjiang, China), deltamethrin (Delcid, 4%, AVZ S-P) and chlorfenapyr (Pyrafen EC, 360 g/L, AgroServer.ru, Moscow, Russia) toxicity against adults of M. domestica. Flies starved for 12 h prior to the tests. Acetone solutions of insecticides (30 µL) were used to soak the sugar (0.1 g) in glass cups, and in the control test, the sugar was treated with pure acetone in the same volume. After the acetone evaporated, 10 flies of each sex (separated by sex) of 3–5 days old were placed in each cup. The cups were sealed with mesh pistons from the top and supplied with water drinkers. The mortality of the flies was recorded after 48 h for chlorpyrifos and deltamethrin and 72 h for chlorfenapyr. Insecticides were tested at 6–8 concentrations that led to insect mortality from 0% to 100%. Each concentration was tested at least three times and the tests were carried out on different days.

4.3. Glutathione-S-Transferase Activity

Homogenates were prepared from 45 insect abdomens of each strain, which were pooled into 15 separate samples both for females and males. From each larva, at least 15 individual homogenate samples were prepared for both the LabTY and the Nik strain. Homogenates were prepared from insects on a Bioprep-24 homogenizer (Hangzhou All-sheng Instruments Co., Ltd., Hangzhou, China) at +4 °C with the addition of 0.1 M phosphate buffer pH 7.6, 1 mM EDTA (ethylenediaminetetraacetic acid), 1 mM PTU (N-phenylthiourea), 1 mM PMSF (phenylmethylsulfonyl fluoride), 1 mM DTE (1,4-dithioerythritol). The supernatant obtained after centrifugation (7000× g, 2 min, 4 °C) was used to determine the enzymatic activity of GST [49] and the quantitative protein content by the Lowry protein assay with using bovine serum albumin for the calibration curve. For the LabTY strain, the protein content in homogenates was (mean ± standard deviation) 4.14 ± 0.74 mg/mL, 3.82 ± 0.33 mg/mL and 4.44 ± 0.60 mg/mL for larvae, females and males, respectively. For the Nik strain, the protein content in homogenates was (mean ± standard deviation) 3.81 ± 0.41 mg/mL, 3.21 ± 0.36 mg/mL and 3.35 ± 0.57 mg/mL for larvae, females and males, respectively. Activity towards 1-chloro-2,4-dinitrobenzene (CDNB) was monitored at 340 nm in the kinetic mode for 20 min at intervals of 1 min intervals at 25 °C. The reaction mixture contained 15 µL of homogenate and 195 µL of 100 mM potassium phosphate buffer (pH = 6.5) with 9 mM of GSH in 1 mM of CDNB. To account for the non-enzymatic conjugation, 15 µL of water was added to the reaction mixture instead of a homogenate. Specific enzyme activity was calculated considering non-enzymatic substrate conversion, absorption coefficient (9.6 mM−1 cm−1), assay volume, homogenate volume, dilution factor, path length, and protein content of the sample, and it was expressed as mM CDNB conjugated in 1 min per mg of protein (mM CDNB conjugated/min/mg protein). Two analytical replicates were performed for each homogenate sample.

4.4. Gene Expression Levels of GST Isoforms

The selection of candidate glutathione S-transferase (GST) genes for this study was based on a comprehensive analysis of public transcriptomic data and established orthology. To identify GST genes with a high potential for involvement in insecticide detoxification, relevant RNA-Seq datasets from the NCBI SRA database were analyzed. The present research specifically focused on experiments involving the exposure of Diptera species to various insecticides, including: D. melanogaster treated with chlorfenapyr (SRA accessions: SRR16043570-SRR16043572), Culex pipiens treated with deltamethrin (SRA accessions: SRR1645076, SRR1645095), M. domestica treated with spinosad (SRA accessions: SRR1802194-201). Differential expression analysis of these datasets allowed us to compile a list of GST genes that were consistently and significantly upregulated in response to insecticide challenge across these different species (Table 3). This list was then integrated with orthology data from a published whole-genome study of M. domestica [24].
Larvae and the abdominal section of adult insects (at least 15 males and 15 females of each strain) were sampled to investigate gene expression levels. Total RNA was isolated using RiZol (diaGene, Moscow, Russia), additionally treated with DNAase I. The quantity and quality of total RNA were evaluated spectrophotometrically on a Nano-300 device (Allsheng, Hangzhou, China) according to the ratio of the optical density at 260/280 nm wavelength (absorbance ratio 1.9–2.1). The integrity of the total RNA fractions was verified by using 1% agarose gel electrophoresis. The first strand of cDNA was synthesized using the MMLV RT kit (Evrogen, Moscow, Russia) according to the manufacturer’s instructions. Primers were developed using Primer3Plus 3.3.0 software. Real-time PCR was performed using 5X qPCRmix-HS SYBR mix (Evrogen, Moscow, Russia) on a Gentier 96E amplifier (Tianlong, Xi’an, China). EF-1 and RP49 genes were used as reference genes [50,51]. Each reaction was repeated at least three times; non-templated and negative controls were used to detect reagent contamination.
The primer specificity testing for RT-qPCR was performed in several steps: primer sequence alignment in BLAST NCBI 2.17.0; PCR product melting-curve analysis (Table S1); electrophoresis of PCR product in 1.5% agarose gel (Figure S1). Except for the annealing temperature, the amplification conditions were identical for each gene: initial denaturation at 95 °C (5 min), denaturation—40 cycles at 94 °C (1 min), annealing according to primer temperature (20 s), elongation at 72 °C (20 s), and final elongation at 72 °C (5 min) (Table 3).

4.5. Statistical Analysis

The dose–response mortality in no-choice feeding bioassays was analyzed by probit regression analysis to calculate lethal concentrations for 50% (LC50) and 95% (LC95) mortality for 95% confidence interval (CI) [52]. The resistance ratio (RR) was calculated as the ratio of LC50 of the insecticide for flies of the Nik strain to LC50 for Lab TY flies. Susceptibility of the field population to the insecticides was determined based on the following criteria: RR < 1—high susceptibility to the insecticide, RR = 1–2—absence of resistance (the population is sensitive to the insecticide), RR = 3–10—very low resistance (the insects are tolerant to the insecticide), RR = 11–30—medium resistance (the insects are moderately resistant), R = 31–100—high resistance (the insects are resistant to the insecticide), RR > 100—very high resistance (the insects are highly resistant to the insecticide). Relative gene expression data (ddCt values) were analyzed using Python (version 3.9) with the pandas, matplotlib, seaborn, and scikit-learn libraries. Pivot tables were generated by aggregating mean ddCt values for each GST gene across developmental stages and sexes (larvae, females, males) separately for the LabTY and Nik strains, followed by visualization as heat maps. Statistical analysis of the results was performed using StatSoft Academic Analyst 2.5 and Statistica Academic 13 to calculate descriptive statistics (means, standard deviations) and to assess the statistical significance of differences. For the GST enzymatic activity results, one-way analysis of variance (ANOVA) with Tukey test for multiple comparisons was applied. Gene expression results were analyzed using the Kruskal–Wallis test followed by pairwise comparison using the nonparametric rank test (Dann’s test for analysis within a strain or within a single gene, Mann–Whitney test for analysis between strains) that is appropriate for small samples and does not assume normal data distribution. All p-values were corrected for multiple comparisons where applicable, with a significance level of α = 0.05.

5. Conclusions

The present study provides a comprehensive analysis of the glutathione S-transferase (GST) system in the house fly, Musca domestica, comparing a susceptible laboratory strain (LabTY) with a field population (Nik). Toxicological profiling confirmed that the Nik population exhibits sensitivity to chlorpyrifos and chlorfenapyr and tolerance to deltamethrin (RR = 2.75–6.73) with a remarkable increase in the level of resistance in males despite the absence of differences in enzyme activity by sex in adults. Among eight genes studied, only GST-E12 (Epsilon class) showed a consistent and significant upregulation in the Nik strain across all developmental stages and sexes, making it a promising candidate biomarker for pyrethroid resistance in M. domestica. In contrast, GST-S1 (Sigma class) was significantly more expressed in the LabTY strain, suggesting its role may be more related to basal metabolic functions than to insecticide-specific resistance.
To conclude, the integrated analysis reveals that pyrethroid tolerance in the house fly is characterized by the specific upregulation of key isoforms like GST-E12. Crucially, the detoxification landscape is profoundly influenced by sex, with males exhibiting a consistently heightened expression of multiple GST genes. For a more complete and in-depth understanding of the specific mechanisms of resistance to pyrethroids in female and male house flies and the contribution of different classes of GSTs, additional studies are needed on the level of expression and activity of GSTs in insecticide-treated individuals. This research provides not only specific molecular targets for resistance monitoring but also fundamentally advances the understanding of the complex, sex-biased nature of metabolic adaptation in M. domestica.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms262311366/s1.

Author Contributions

Conceptualization, E.S.; methodology, E.S. and K.K.; bioinformatic analyses, V.G.; validation, E.S. and K.K.; investigation, E.S., A.K. and V.G.; data curation, K.K. and E.S.; writing—original draft preparation, A.K., K.K., V.G., S.B., A.A., J.I., I.Z. and E.S.; writing—review and editing, E.S., K.K., A.K., A.A., S.B., J.I., I.Z. and V.G.; visualization, V.G. and E.S.; supervision, E.S.; project administration, K.K.; funding acquisition, E.S. and K.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was carried out at the All-Russian Scientific Research Institute of Veterinary Entomology and Arachnology of the Tyumen Scientific Centre of Siberian Branch of the Russian Academy of Sciences within the framework of the state assignment of the Ministry of Science and Higher Education of the Russian Federation (theme No. FWRZ-2025-0001).

Institutional Review Board Statement

Ethical review and approval were waived for this study due to its compliance with the ethical guidelines of the All-Russian Scientific Research Institute of Veterinary Entomology and Arachnology.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
GSTsGlutathione-S-transferases
LC50Lethal concentrations for 50% mortality
LC95Lethal concentrations for 95% mortality
RRResistance ratio
CIConfidence intervals
WHOWorld Health Organization
ddCtRelative quantity of gene expression

References

  1. Enayati, A.A.; Ranson, H.; Hemingway, J. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 2005, 14, 3–8. [Google Scholar] [CrossRef]
  2. Koirala, B.K.S.; Moural, T.; Zhu, F. Functional and structural diversity of insect glutathione S-transferases in xenobiotic adaptation. Int. J. Biol. Sci. 2022, 18, 5713–5723. [Google Scholar] [CrossRef] [PubMed]
  3. Wei, S.H.; Clark, A.G.; Syvanen, M. Identification and cloning of a key insecticide-metabolizing glutathione S-transferase (MdGST-6A) from a hyper insecticide-resistant strain of the housefly Musca domestica. Insect Biochem. Mol. Biol. 2001, 31, 1145–1153. [Google Scholar] [CrossRef] [PubMed]
  4. Siddiqui, J.A.; Fan, R.; Naz, H.; Bamisile, B.S.; Hafeez, M.; Ghani, M.I.; Wei, Y.; Xu, Y.; Chen, X. Insights into insecticide-resistance mechanisms in invasive species: Challenges and control strategies. Front. Physiol. 2023, 13, 1112278. [Google Scholar] [CrossRef]
  5. Nakamura, C.; Yajima, S.; Miyamoto, T.; Sue, M. Structural analysis of an epsilon-class glutathione transferase from housefly, Musca domestica. Biochem. Biophys. Res. Commun. 2013, 430, 1206–1211. [Google Scholar] [CrossRef] [PubMed]
  6. Nkya, T.E.; Akhouayri, I.; Kisinza, W.; David, J.P. Impact of environment on mosquito response to pyrethroid insecticides: Facts, evidences and prospects. Insect Biochem. Mol. Biol. 2013, 43, 407–416. [Google Scholar] [CrossRef]
  7. Scian, M.; Le Trong, I.; Mazari, A.M.; Mannervik, B.; Atkins, W.M.; Stenkamp, R.E. Comparison of epsilon- and delta-class glutathione S-transferases: The crystal structures of the glutathione S-transferases DmGSTE6 and DmGSTE7 from Drosophila melanogaster. Acta Crystallogr. D Biol. Crystallogr. 2015, 71, 2089–2098. [Google Scholar] [CrossRef]
  8. Aloke, C.; Onisuru, O.O.; Achilonu, I. Glutathione S-transferase: A versatile and dynamic enzyme. Biochem. Biophys. Res. Commun. 2024, 734, 150774. [Google Scholar] [CrossRef]
  9. Venu, V.; Alias, Z. Substrate specificities and kinetic parameters of recombinant Drosophila melanogaster glutathione S-transferases E6 and E7. In Drosophila melanogaster—Model for Recent Advances in Genetics and Therapeutics; Perveen, F., Ed.; IntechOpen: London, UK, 2018; pp. 227–239. [Google Scholar] [CrossRef]
  10. Fang, S. Insect glutathione S-transferase: A review of comparative genomic studies and response to xenobiotics. Bull. Insectol. 2012, 65, 265–271. [Google Scholar]
  11. Friedman, R. Genomic organization of the glutathione S-transferase family in insects. Mol. Phylogenet. Evol. 2011, 61, 924–932. [Google Scholar] [CrossRef]
  12. Liu, S.; Rao, X.J.; Li, M.Y.; Feng, M.F.; He, M.Z.; Li, S.G. Glutathione S-transferase genes in the rice leaffolder, Cnaphalocrocis medinalis (Lepidoptera: Pyralidae): Identi-fication and expression profiles. Arch. Insect Biochem. Physiol. 2015, 90, 1–13. [Google Scholar] [CrossRef]
  13. Huang, Y.; Xu, Z.; Lin, X.; Feng, Q.; Zheng, S. Structure and expression of glutathione S-transferase genes from the midgut of the Common cutworm, Spodoptera litura (Noctuidae) and their response to xenobiotic compounds and bacteria. J. Insect Physiol. 2011, 57, 1033–1044. [Google Scholar] [CrossRef]
  14. Yamamoto, K.; Aso, Y.; Yamada, N. Catalytic function of an ε-class glutathione S-transferase of the silkworm. Insect Mol. Biol. 2013, 22, 523–531. [Google Scholar] [CrossRef]
  15. Liu, S.; Zhang, Y.X.; Wang, W.L.; Zhang, B.X.; Li, S.G. Identification and characterisation of seventeen glutathione S-transferase genes from the cabbage white butterfly Pieris rapae. Pestic. Biochem. Physiol. 2017, 143, 102–110. [Google Scholar] [CrossRef] [PubMed]
  16. Lumjuan, N.; Rajatileka, S.; Changsom, D.; Wicheer, J.; Leelapat, P.; Prapanthadara, L.A.; Somboon, P.; Lycett, G.; Ranson, H. The role of the Aedes aegypti Epsilon glutathione transferases in conferring resistance to DDT and pyrethroid insecticides. Insect Biochem. Mol. Biol. 2011, 41, 203–209. [Google Scholar] [CrossRef] [PubMed]
  17. Chen, L.; Hall, P.; Zhou, X.; Ranson, H.; Hemingway, J.; Meehan, E. Structure of an insect delta-class glutathione S-transferase from a DDT-resistant strain of the malaria vector Anopheles gambiae. Acta Crystallogr. D Biol. Crystallogr. 2003, 59, 2211–2217. [Google Scholar] [CrossRef] [PubMed]
  18. Hu, C.; Liu, J.; Wang, W.; Mota-Sanchez, D.; He, S.; Shi, Y.; Yang, X. Glutathione S-transferase genes are involved in lambda-cyhalothrin resistance in Cydia pomonella via sequestration. J. Agric. Food Chem. 2022, 70, 2265–2279. [Google Scholar] [CrossRef]
  19. Jing, T.-X.; Wu, Y.-X.; Li, T.; Wei, D.-D.; Smagghe, G.; Wang, J.-J. Identification and expression profiles of fifteen delta-class glutathione S-transferase genes from a stored-product pest, Liposcelis entomophila (Enderlein) (Psocoptera: Liposcelididae). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2017, 206, 35–41. [Google Scholar] [CrossRef]
  20. Yan, H.; Jia, H.; Gao, H.; Guo, X.; Xu, B. Identification, genomic organization, and oxidative stress response of a sigma class glutathione S-transferase gene (AccGSTS1) in the honey bee, Apis cerana cerana. Cell Stress Chaperones. 2013, 18, 415–426. [Google Scholar] [CrossRef]
  21. Geden, C.J.; Nayduch, D.; Scott, J.G.; Burgess, E.R., IV; Gerry, A.C.; Kaufman, P.E.; Thomson, J.; Pickens, V.; Machtinger, E.T. House fly (Diptera: Muscidae): Biology, pest status, current management prospects, and research needs. J. Integr. Pest Manag. 2021, 12, 39. [Google Scholar] [CrossRef]
  22. You, C.; Li, Z.; Yin, Y.; Na, N.; Gao, X. Time of day-specific changes in metabolic detoxification and insecticide tolerance in the house fly, Musca domestica L. Front. Physiol. 2022, 12, 803682. [Google Scholar] [CrossRef]
  23. Nayduch, D.; Neupane, S.; Pickens, V.; Purvis, T.; Olds, C. House flies are underappreciated yet important reservoirs and vectors of microbial threats to animal and human health. Microorganisms 2023, 11, 583. [Google Scholar] [CrossRef]
  24. Scott, J.G.; Warren, W.C.; Beukeboom, L.W.; Bopp, D.; Clark, A.G.; Giers, S.D.; Hediger, M.; Jones, A.K.; Kasai, S.; Leichter, C.A.; et al. Genome of the house fly, Musca domestica L., a global vector of diseases with adaptations to a septic environment. Genome Biol. 2014, 15, 466. [Google Scholar] [CrossRef] [PubMed]
  25. El Sherif, D.F.; Soliman, N.H.; Alshallash, K.S.; Ahmed, N.; Ibrahim, M.A.R.; Al-Shammery, K.A.; Al-Khalaf, A.A. The binary mixtures of lambda-cyhalothrin, chlorfenapyr, and abamectin, against the house fly larvae, Musca domestica L. Molecules 2022, 27, 3084. [Google Scholar] [CrossRef] [PubMed]
  26. Scott, J.G. Evolution of resistance to pyrethroid insecticides in Musca domestica. Pest Manag. Sci. 2017, 73, 716–722. [Google Scholar] [CrossRef] [PubMed]
  27. Sue, M.; Mikawa, T.; Ueda, T.; Nomoto, Y.; Miyamoto, T. A novel function of housefly glutathione S-transferase 6B—Its effect on the retention and increase of insecticidal activity of the insecticide prothiofos. J. Pestic. Sci. 2006, 31, 139–145. [Google Scholar] [CrossRef]
  28. Sue, M.; Yajima, S. Crystal structure of the delta-class glutathione transferase in Musca domestica. Biochem. Biophys. Res. Commun. 2018, 502, 345–350. [Google Scholar] [CrossRef]
  29. Fournier, D.; Bride, J.M.; Poirie, M.; Bergé, J.B.; Plapp, F.W., Jr. Insect glutathione S-transferases. Biochemical characteristics of the major forms from houseflies susceptible and resistant to insecticides. J. Biol. Chem. 1992, 267, 1840–1845. [Google Scholar] [CrossRef]
  30. Zhang, Y.; Li, J.; Ma, Z.; Shan, C.; Gao, X. Multiple mutations and overexpression of the MdaE7 carboxylesterase gene associated with male-linked malathion resistance in housefly, Musca domestica (Diptera: Muscidae). Sci. Rep. 2018, 8, 224. [Google Scholar] [CrossRef]
  31. Denlinger, D.S.; Hudson, S.B.; Keweshan, N.S.; Gompert, Z.; Bernhardt, S.A. Standing genetic variation in laboratory populations of insecticide-susceptible Phlebotomus papatasi and Lutzomyia longipalpis (Diptera: Psychodidae: Phlebotominae) for the evolution of resistance. Evol. Appl. 2021, 14, 1248–1262. [Google Scholar] [CrossRef]
  32. St Pierre, S.E.; Ponting, L.; Stefancsik, R.; McQuilton, P.; FlyBase Consortium. FlyBase 102--advanced approaches to interrogating FlyBase. Nucleic Acids Res. 2014, 42, 780–788. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, L.; Gao, X.; Liang, P. Beta-cypermethrin resistance associated with high carboxylesterase activities in a strain of house fly, Musca domestica (Diptera: Muscidae). Pestic. Biochem. Physiol. 2007, 89, 65–72. [Google Scholar] [CrossRef]
  34. Aponte, A.; Penilla, R.P.; Rodríguez, A.D.; Ocampo, C.B. Mechanisms of pyrethroid resistance in Aedes (Stegomyia) aegypti from Colombia. Acta Trop. 2019, 191, 146–154. [Google Scholar] [CrossRef] [PubMed]
  35. Kristensen, M. Glutathione S-transferase and insecticide resistance in laboratory strains and field populations of Musca domestica. J. Econ. Entomol. 2005, 98, 1341–1348. [Google Scholar] [CrossRef]
  36. Ahmadi, E.; Khajehali, J.; Rameshgar, F. Evaluation of resistance to permethrin, cypermethrin and deltamethrin in different populations of Musca domestica (L.), collected from the Iranian dairy cattle farms. J. Asia Pac. Entomol. 2020, 23, 277–284. [Google Scholar] [CrossRef]
  37. Wang, K.Y.; Zhang, Y.; Wang, H.Y.; Xia, X.M. Role of glutathione-S-transferases in the resistance forming to insecticides of three different classes in housefly (Musca domestica). Resist. Pest Manag. Newsl. 2012, 21, 28. [Google Scholar]
  38. Sokolyanskaya, M.P. Development of pyrethroid resistance in larvae of housefly Musca domestica. Agrohimija 2014, 3, 54–59. [Google Scholar]
  39. Ramadan, M.M.; Selem, G.; Khater, K.S.; Elsobki, A. Monitoring of development of resistance to pyrethroids in Musca domestica L. population, using toxicological and biochemical features. Sci. J. Agric. Sci. 2021, 3, 219–229. [Google Scholar] [CrossRef]
  40. Kouamo, M.F.M.; Ibrahim, S.S.; Hearn, J.; Riveron, J.M.; Kusimo, M.; Tchouakui, M.; Ebai, T.; Tchapga, W.; Wondji, M.J.; Irving, H.; et al. Genome-wide transcriptional analysis and functional validation linked a cluster of epsilon glutathione S-transferases with insecticide resistance in the major malaria vector Anopheles funestus across Africa. Genes 2021, 12, 561. [Google Scholar] [CrossRef]
  41. Tao, F.; Si, F.L.; Hong, R.; He, X.; Li, X.Y.; Qiao, L.; He, Z.B.; Yan, Z.T.; He, S.L.; Chen, B. Glutathione S-transferase (GST) genes and their function associated with pyrethroid resistance in the malaria vector Anopheles sinensis. Pest Manag. Sci. 2022, 78, 4127–4139. [Google Scholar] [CrossRef] [PubMed]
  42. Waheibi, N.S. GST Detoxifying Enzymes and Pyrethroid Insecticide Resistance Evaluation in the Red Palm Weevil in the UAE. Master of Science Thesis, United Arab Emirates University, Al Ain, United Arab Emirates, 2019. [Google Scholar]
  43. Lumjuan, N.; McCarroll, L.; Prapanthadara, L.A.; Hemingway, J.; Ranson, H. Elevated activity of an Epsilon class glutathione transferase confers DDT resistance in the dengue vector, Aedes aegypti. Insect Biochem. Mol. Biol. 2005, 35, 861–871. [Google Scholar] [CrossRef]
  44. Chen, X.D.; Sandoval-Mojica, A.F.; Bonilla, S.I.; Ebert, T.A.; Gossett, H.; Pelz-Stelinski, K.S.; Stelinski, L.L. Fenpropathrin resistance in Asian citrus psyllid, Diaphorina citri Kuwayama: Risk assessment and changes in expression of CYP and GST genes associated with resistance. Int. J. Pest Manag. 2023, 69, 54–63. [Google Scholar] [CrossRef]
  45. Thornton, B.J. Sex-Dependent Changes in Activity of Detoxification Enzymes, Insecticide Susceptibility, and Alterations in Protein Expression Induced by Atrazine in Drosophila melanogaster. Ph.D. Dissertation, The University of Nebraska-Lincoln, Lincoln, NE, USA, 2009. [Google Scholar]
  46. Markussen, M.D.; Kristensen, M. Spinosad resistance in female Musca domestica L. from a field-derived population. Pest Manag. Sci. 2012, 68, 75–82. [Google Scholar] [CrossRef] [PubMed]
  47. Zhang, Y.; Wang, Y.; Ma, Z.; Zhai, D.; Gao, X.; Shi, X. Cytochrome P450 monooxygenases-mediated sex differential spinosad resistance in house flies Musca domestica (Diptera: Muscidae). Pestic. Biochem. Physiol. 2019, 157, 178–185. [Google Scholar] [CrossRef]
  48. Zhang, Y.; Guo, M.; Ma, Z.; You, C.; Gao, X.; Shi, X. Esterase mediated spinosad resistance in house flies Musca domestica (Diptera: Muscidae). Ecotoxicology 2020, 29, 35–44. [Google Scholar] [CrossRef] [PubMed]
  49. Valle, D.; Montella, I.R.; Ribeiro, R.A.; Viana-Medeiros, P.F.; Martin, A.J., Jr.; Lima, J.B.P. Quantification Methodology for Enzyme Activity Related to Insecticide Resistance in Aedes aegypti; Ministry of Health of Brazil; Fundação Oswaldo Cruz: Brasília, Brazil, 2006; p. 128.
  50. Krestonoshina, K.; Melnichuk, A.; Kinareikina, A.; Maslakova, K.; Yangirova, L.; Silivanova, E. The P450-monooxygenase activity and CYP6D1 expression in the chlorfenapyr-resistant strain of Musca domestica L. Insects 2024, 15, 461. [Google Scholar] [CrossRef]
  51. Codd, V.; Dolezel, D.; Stehlik, J.; Piccin, A.; Garner, K.J.; Racey, S.N.; Straatman, K.R.; Louis, E.J.; Costa, R.; Sauman, I.; et al. Circadian rhythm gene regulation in the housefly Musca domestica. Genetics 2007, 177, 1539–1551. [Google Scholar] [CrossRef]
  52. Mekapogu, A.R. Finney’s Probit Analysis Spreadsheet Calculator (Version 2021). Available online: https://probitanalysis.wordpress.com/ (accessed on 29 September 2025).
Ijms 26 11366 g001
Figure 1. The glutathione-S-transferase activities in Musca domestica of the susceptible strain LabTY and the field population Nik. The mean values of the groups with different letters are statistically significant different according to Tukey test (p ≤ 0.05).
Figure 1. The glutathione-S-transferase activities in Musca domestica of the susceptible strain LabTY and the field population Nik. The mean values of the groups with different letters are statistically significant different according to Tukey test (p ≤ 0.05).
Ijms 26 11366 g001
Ijms 26 11366 g002
Figure 2. Heat maps of GST gene expression in the LabTY and Nik strains M. domestica. The maps show the average expression level (ddCt) values from three biological replicates of PCR analysis in different groups (larvae, males, females). Colors represent absolute ddCt values (red = high expression, yellow = low expression). Numbers show mean values from three replicates.
Figure 2. Heat maps of GST gene expression in the LabTY and Nik strains M. domestica. The maps show the average expression level (ddCt) values from three biological replicates of PCR analysis in different groups (larvae, males, females). Colors represent absolute ddCt values (red = high expression, yellow = low expression). Numbers show mean values from three replicates.
Ijms 26 11366 g002
Ijms 26 11366 g003
Figure 3. Statistical significance of differences in GST gene expression depending on strain and sex/developmental stage M. domestica. Red bars indicate genes with significant differences between strains; blue bars indicate genes with significant differences between sexes/developmental stages; gray bars indicate genes without significant differences between strains or sexes/developmental stages. The dotted line represents a significance level of p = 0.05. Bars above this line represent statistically significant differences.
Figure 3. Statistical significance of differences in GST gene expression depending on strain and sex/developmental stage M. domestica. Red bars indicate genes with significant differences between strains; blue bars indicate genes with significant differences between sexes/developmental stages; gray bars indicate genes without significant differences between strains or sexes/developmental stages. The dotted line represents a significance level of p = 0.05. Bars above this line represent statistically significant differences.
Ijms 26 11366 g003
Table 1. Toxicity of chlorpyrifos, deltamethrin, and chlorfenapyr to Musca domestica adults of the laboratory strain (Lab TY) and the field strain (Nik, G18-19).
Table 1. Toxicity of chlorpyrifos, deltamethrin, and chlorfenapyr to Musca domestica adults of the laboratory strain (Lab TY) and the field strain (Nik, G18-19).
InsecticideStrainNLC50 (95% CI) aLC50 (95% CI) aSlope (±SE)χ2RR (95% CI)
ChlorpyrifosLabTY ♀19512.227
(8.055–18.561)		84.627
(55.748–128.465)		2.19 (±0.09)0.21-
LabTY ♂1957.592
(5.479–10.520)		25.043
(18.073–34.702		3.21 (±0.07)0.32-
Nik ♀19514.962
(11.497–19.472)		32.653
(25.091–42.494)		4.89 (±0.06)0.521.22
(1.05–1.43)
Nik ♂1956.363
(4.794–8.445) #		15.659
(11.798–20.782)		4.27 (±0.06)0.850.84
(0.80–0.88)
DeltamethrinLabTY ♀2402.078
(1.295–3.334)		26.880
(16.755–43.123)		1.65 (±0.11)0.17-
LabTY ♂2331.004
(0.688–1.465)		5.240
(3.591–7.647)		2.40 (±0.08)0.61-
Nik ♀1955.707
(3.811–8.545) *		24.012
(16.037–35.953)		2.64 (±0.09)0.882.75
(2.56–2.95)
Nik ♂1956.730
(4.036–11.224) *		56.806
(34.065–94.728)		1.78 (±0.11)0.986.73
(5.85–7.68)
ChlorfenapyrLabTY ♀38423.625
(17.385–32.103)		96.306
(70.872–130.868)		2.72 (±0.06)0.05-
LabTY ♂4019.745
(7.320–12.975) #		58.781
(44.149–78.262)		1.64 (±0.10)0.72-
Nik ♀23027.609
(19.906–38.293)		139.574
(100.632–193.584)		2.44 (±0.07)0.551.17
(1.15–1.19)
Nik ♂23014.332
(10.526–19.513) #		55.686
(40.900–75.817)		2.84 (±0.07)0.871.47
(1.44–1.50)
a μg of active substance per one g of sugar; N—the number of adult flies used in bioassay including control; resistance ratio (RR) = LC50 of the Nik strain/LC50 of the Lab TY strain; ♀—females; ♂—males; * statistically significant differences compared to the LabTY strain based on non-overlapping confidence intervals (p ≤ 0.05); # statistically significant differences compared to the females of the same strain based on non-overlapping confidence intervals (p ≤ 0.05).
Table 2. Orthologues of the GST genes in D. melanogaster and M. domestica.
Table 2. Orthologues of the GST genes in D. melanogaster and M. domestica.
GST ClassD. melanogasterM. domestica
Protein AccessionGene IDmRNA AccessionGene Name
EpsilonDMGSTE4-8XP005185166LOC101895036XM_005185109.4GST-2
XP005185169LOC101895555XM_005185112.4GST-6B
XP005190027LOC101887250XM_005189970.4GST-1
NP_001295979.2-NM_001309050.2GST-6A
DMGSTE13A-BXP005179508LOC101900016XM_005179451.4GST-1
XP005179509LOC109611606XM_005179452.4GST-1
DMGSTE11XP005184662LOC101895316XM_005184605.4 (X1)GST-E11
XP005184663XM_005184606.4 (X2)
XP005184664LOC101895607XM_005184607.4 (X1)GST-1
DMGSTE14XP005180753LOC101888181XM_005180696.4GST1-like
XP005180754LOC101888349XM_005180697.4GST1-like
DeltaDMGSTD11A-BXP005180103LOC101897797XM_005180046.4 (X1)GST-D11
DMGSTD10, 1A-BXP005180099LOC101897094XM_005180042.4 (X1)GST4-like
NP_001295926.1LOC101897277NM_001308997.1GST-2
ThetaDMGSTT4XP005191555LOC101897781XM_005191498.4GST-T1
DMGSTT3A-BXP005177600LOC101900949XM_005177543.4GST-T3
SigmaDMGSTS1NP_001273827.1-NM_001286898.1GST
Table 3. Genes evaluated in the present study.
Table 3. Genes evaluated in the present study.
Gene NameGeneIDNucleotide Sequence (5′→3′) of Primers (Forward/Reverse)Ta, °Length of PCR Product (bp)GenBank ID
RP49 *LOC101894827GTTATGCCAAATTGTCGCACA
GGCGGGTACGTTTGTTGG		59.5123XM_020038490.2
EF-1LOC101899175TAAGGAAGGTAACGCTGAAGG
CAAGGGCAAACGCAAAGG		59.591XM_005181459.4
GST-6A101887423ATTCGACGACAAAATGGG
CCTTAGCCATCAAATTAACC		61.5131NM_001309050.2
GST-6BLOC131804118ACCTGTTCGTGCTTGTTTGC
CGAGTGTGGGCACTGTATGT		63.5137XM_059126509.1
GST-S1 (GST) 101890455TGGAAGTTAACGGCAAGCGT
CCGGCAAAGTAGACATCGGC		61.5313NM_001286898.1
GST-T1LOC101897781GTGTAGCCATATTCCGCCACT
GCATCGTACCATTTTGAGAGCT		59.5391XM_005191498.4
GST-E2 (GST-2)LOC101895036AAGCGATCACAACAGCCAAC
CATCGTCTTCCAGTGTAGGCA		61.5240XM_005185109.4
GST-E3 (GST-6B)LOC101895555ATCCCCAACATACAGTGCCC
TCCCTGAAATAAGACACCAGCT		61.5182XM_005185112.4
GST-2LOC101897277AGAACGGACAACAAGTAGCTCC
AATGGCACGAGATTCCCACA		59.5247NM_001308997.1
GST-E12LOC101900672GGTCACTTGTTTGCCCGTCT
GCACCCTCCTCGTTTGTATCC		61.5302XM_059131016.1
* also known as RPL32 gene.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Garbaly, V.; Krestonoshina, K.; Kinareikina, A.; Bobreshova, S.; Avdeeva, A.; Ismagilova, J.; Zaitsev, I.; Silivanova, E. Glutathione S-Transferase (GST) Activities and Gene Expression Patterns of Different GST Classes in Musca domestica L. Depending on Sex and Stage of Development. Int. J. Mol. Sci. 2025, 26, 11366. https://doi.org/10.3390/ijms262311366

AMA Style

Garbaly V, Krestonoshina K, Kinareikina A, Bobreshova S, Avdeeva A, Ismagilova J, Zaitsev I, Silivanova E. Glutathione S-Transferase (GST) Activities and Gene Expression Patterns of Different GST Classes in Musca domestica L. Depending on Sex and Stage of Development. International Journal of Molecular Sciences. 2025; 26(23):11366. https://doi.org/10.3390/ijms262311366

Chicago/Turabian Style

Garbaly, Vladislava, Kseniya Krestonoshina, Anna Kinareikina, Svetlana Bobreshova, Anastasiya Avdeeva, Juliya Ismagilova, Ivan Zaitsev, and Elena Silivanova. 2025. "Glutathione S-Transferase (GST) Activities and Gene Expression Patterns of Different GST Classes in Musca domestica L. Depending on Sex and Stage of Development" International Journal of Molecular Sciences 26, no. 23: 11366. https://doi.org/10.3390/ijms262311366

APA Style

Garbaly, V., Krestonoshina, K., Kinareikina, A., Bobreshova, S., Avdeeva, A., Ismagilova, J., Zaitsev, I., & Silivanova, E. (2025). Glutathione S-Transferase (GST) Activities and Gene Expression Patterns of Different GST Classes in Musca domestica L. Depending on Sex and Stage of Development. International Journal of Molecular Sciences, 26(23), 11366. https://doi.org/10.3390/ijms262311366

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop