Effects of Aging on Intramuscular Collagen-Related Factors After Injury to Mouse Tibialis Anterior Muscle
Abstract
1. Introduction
2. Results
2.1. Muscle Function
2.2. Body and Muscle Weight
2.3. Muscle Injury
2.4. Fiber Cross-Sectional Area
2.5. Collagen-Related Factors
2.6. Collagen I Localization
2.7. MMP2 and MMP9 Expression Levels
2.8. LOX Expression
2.9. LOX Localization
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Grip Strength Test
4.3. Muscle Injury and Sampling
4.4. Histochemical Analysis
4.5. Quantitative PCR
4.6. IHC
4.7. Morphological Analysis
4.8. WB
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Takala, T.E.; Virtanen, P. Biochemical composition of muscle extracellular matrix: The effect of loading. Scand. J. Med. Sci. Sports 2000, 10, 321–325. [Google Scholar] [CrossRef]
- Halper, J.; Kjaer, M. Basic components of connective tissues and extracellular matrix: Elastin, fibrillin, fibulins, fibrinogen, fibronectin, laminin, tenascins and thrombospondins. Adv. Exp. Med. Biol. 2014, 802, 31–47. [Google Scholar] [CrossRef] [PubMed]
- Csapo, R.; Gumpenberger, M.; Wessner, B. Skeletal muscle extracellular matrix—What do we know about its composition, regulation, and physiological roles? A narrative review. Front. Physiol. 2020, 11, 253. [Google Scholar] [CrossRef] [PubMed]
- Kanazawa, Y.; Miyachi, R.; Higuchi, T.; Sato, H. Effects of aging on collagen in the skeletal muscle of mice. Int. J. Mol. Sci. 2023, 24, 13121. [Google Scholar] [CrossRef] [PubMed]
- Sanes, J.R. The basement membrane/basal lamina of skeletal muscle. J. Biol. Chem. 2003, 278, 12601–12604. [Google Scholar] [CrossRef] [PubMed]
- Kanazawa, Y.; Ikegami, K.; Sujino, M.; Koinuma, S.; Nagano, M.; Oi, Y.; Onishi, T.; Sugiyo, S.; Takeda, I.; Kaji, H.; et al. Effects of aging on basement membrane of the soleus muscle during recovery following disuse atrophy in rats. Exp. Gerontol. 2017, 98, 153–161. [Google Scholar] [CrossRef] [PubMed]
- Calve, S.; Odelberg, S.J.; Simon, H.G. A transitional extracellular matrix instructs cell behavior during muscle regeneration. Dev. Biol. 2010, 344, 259–271. [Google Scholar] [CrossRef]
- Urciuolo, A.; Quarta, M.; Morbidoni, V.; Gattazzo, F.; Molon, S.; Grumati, P.; Montemurro, F.; Tedesco, F.S.; Blaauw, B.; Cossu, G.; et al. Collagen VI regulates satellite cell self-renewal and muscle regeneration. Nat. Commun. 2013, 4, 1964. [Google Scholar] [CrossRef] [PubMed]
- Kuo, H.J.; Maslen, C.L.; Keene, D.R.; Glanville, R.W. Type VI collagen anchors endothelial basement membranes by interacting with type IV collagen. J. Biol. Chem. 1997, 272, 26522–26529. [Google Scholar] [CrossRef] [PubMed]
- Street, S.F. Lateral transmission of tension in frog myofibers: A myofibrillar network and transverse cytoskeletal connections are possible transmitters. J. Cell. Physiol. 1983, 114, 346–364. [Google Scholar] [CrossRef] [PubMed]
- Gillies, A.R.; Lieber, R.L. Structure and function of the skeletal muscle extracellular matrix. Muscle Nerve 2011, 44, 318–331. [Google Scholar] [CrossRef] [PubMed]
- McKee, T.J.; Perlman, G.; Morris, M.; Komarova, S.V. Extracellular matrix composition of connective tissues: A systematic review and meta-analysis. Sci. Rep. 2019, 9, 10542. [Google Scholar] [CrossRef] [PubMed]
- Kovanen, V. Intramuscular extracellular matrix: Complex environment of muscle cells. Exerc. Sport Sci. Rev. 2002, 30, 20–25. [Google Scholar] [CrossRef]
- Kanazawa, Y.; Nagano, M.; Koinuma, S.; Sujino, M.; Minami, Y.; Sugiyo, S.; Takeda, I.; Shigeyoshi, Y. Basement membrane recovery process in rat soleus muscle after exercise-induced muscle injury. Connect. Tissue Res. 2021, 62, 519–530. [Google Scholar] [CrossRef] [PubMed]
- Kanazawa, Y.; Nagano, M.; Koinuma, S.; Sugiyo, S.; Shigeyoshi, Y. Effects of aging on basement membrane of tibialis anterior muscle during recovery following muscle injury in rats. Microscopy 2022, 71, 245–248. [Google Scholar] [CrossRef]
- Chen, X.; Li, Y. Role of matrix metalloproteinases in skeletal muscle: Migration, differentiation, regeneration and fibrosis. Cell Adh. Migr. 2009, 3, 337–341. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Wang, X.; Yao, F.; Huang, C. Lysyl oxidase family proteins: Prospective therapeutic targets in cancer. Int. J. Mol. Sci. 2022, 23, 12270. [Google Scholar] [CrossRef] [PubMed]
- Laczko, R.; Csiszar, K. Lysyl oxidase (LOX): Functional contributions to signaling pathways. Biomolecules 2020, 10, 1093. [Google Scholar] [CrossRef]
- Kutchuk, L.; Laitala, A.; Soueid-Bomgarten, S.; Shentzer, P.; Rosendahl, A.H.; Eilot, S.; Grossman, M.; Sagi, I.; Sormunen, R.; Myllyharju, J.; et al. Muscle composition is regulated by a Lox-TGFβ feedback loop. Development 2015, 142, 983–993. [Google Scholar] [CrossRef] [PubMed]
- Smith, L.R.; Hammers, D.W.; Sweeney, H.L.; Barton, E.R. Increased collagen cross-linking is a signature of dystrophin-deficient muscle. Muscle Nerve 2016, 54, 71–78. [Google Scholar] [CrossRef]
- Ge, X.; Cho, A.; Ciol, M.A.; Pettan-Brewer, C.; Snyder, J.; Rabinovitch, P.; Ladiges, W. Grip strength is potentially an early indicator of age-related decline in mice. Pathobiol. Aging Age Relat. Dis. 2016, 6, 32981. [Google Scholar] [CrossRef]
- Rahman, F.A.; Angus, S.A.; Stokes, K.; Karpowicz, P.; Krause, M.P. Impaired ECM remodeling and macrophage activity define necrosis and regeneration following damage in aged skeletal muscle. Int. J. Mol. Sci. 2020, 21, 4575. [Google Scholar] [CrossRef] [PubMed]
- Mahdy, M.A.A. Skeletal muscle fibrosis: An overview. Cell Tissue Res. 2019, 375, 575–588. [Google Scholar] [CrossRef]
- Pessina, P.; Cabrera, D.; Morales, M.G.; Riquelme, C.A.; Gutiérrez, J.; Serrano, A.L.; Brandan, E.; Muñoz-Cánoves, P. Novel and optimized strategies for inducing fibrosis in vivo: Focus on Duchenne muscular dystrophy. Skelet. Muscle 2014, 4, 7. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Lu, J.; Liu, Y. Skeletal muscle regeneration in cardiotoxin-induced muscle injury models. Int. J. Mol. Sci. 2022, 23, 13380. [Google Scholar] [CrossRef] [PubMed]
- Pittayapruek, P.; Meephansan, J.; Prapapan, O.; Komine, M.; Ohtsuki, M. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. Int. J. Mol. Sci. 2016, 17, 868. [Google Scholar] [CrossRef] [PubMed]
- Kherif, S.; Lafuma, C.; Dehaupas, M.; Lachkar, S.; Fournier, J.G.; Verdière-Sahuqué, M.; Fardeau, M.; Alameddine, H.S. Expression of matrix metalloproteinases 2 and 9 in regenerating skeletal muscle: A study in experimentally injured and mdx muscles. Dev. Biol. 1999, 205, 158–170. [Google Scholar] [CrossRef] [PubMed]
- Quan, T.; Qin, Z.; Xia, W.; Shao, Y.; Voorhees, J.J.; Fisher, G.J. Matrix-degrading metalloproteinases in photoaging. J. Investig. Dermatol. Symp. Proc. 2009, 14, 20–24. [Google Scholar] [CrossRef] [PubMed]
- Parkinson, L.G.; Toro, A.; Zhao, H.; Brown, K.; Tebbutt, S.J.; Granville, D.J. Granzyme B mediates both direct and indirect cleavage of extracellular matrix in skin after chronic low-dose ultraviolet light irradiation. Aging Cell 2015, 14, 67–77. [Google Scholar] [CrossRef] [PubMed]
- Chiang, H.M.; Chen, H.C.; Chiu, H.H.; Chen, C.W.; Wang, S.M.; Wen, K.C. Neonauclea reticulata (havil.) Merr stimulates skin regeneration after UVB exposure via ROS scavenging and modulation of the MAPK/MMPs/collagen pathway. Evid. Based Complement. Alternat. Med. 2013, 2013, 324864. [Google Scholar] [CrossRef] [PubMed]
- Freitas-Rodríguez, S.; Folgueras, A.R.; López-Otín, C. The role of matrix metalloproteinases in aging: Tissue remodeling and beyond. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 2015–2025. [Google Scholar] [CrossRef] [PubMed]
- Szauter, K.M.; Cao, T.; Boyd, C.D.; Csiszar, K. Lysyl oxidase in development, aging and pathologies of the skin. Pathol. Biol. 2005, 53, 448–456. [Google Scholar] [CrossRef] [PubMed]
- Ding, H.; Gray, S.D. Senescent expression of genes coding tropoelastin, elastase, lysyl oxidase, and tissue inhibitors of metalloproteinases in rat vocal folds: Comparison with skin and lungs. J. Speech Lang. Hear. Res. 2001, 44, 317–326. [Google Scholar] [CrossRef] [PubMed]
- Fornieri, C.; Quaglino, D., Jr.; Mori, G. Correlations between age and rat dermis modifications. Ultrastructural-morphometric evaluations and lysyl oxidase activity. Aging 1989, 1, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Behmoaras, J.; Slove, S.; Seve, S.; Vranckx, R.; Sommer, P.; Jacob, M.-P. Differential expression of lysyl oxidases LOXL1 and LOX during growth and aging suggests specific roles in elastin and collagen fiber remodeling in rat aorta. Rejuvenation Res. 2008, 11, 883–889. [Google Scholar] [CrossRef]
- Cox, T.R.; Bird, D.; Baker, A.M.; Barker, H.E.; Ho, M.W.; Lang, G.; Erler, J.T. LOX-mediated collagen crosslinking is responsible for fibrosis-enhanced metastasis. Cancer Res. 2013, 73, 1721–1732. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.J.; Jeng, J.H.; Chang, H.H.; Huang, M.Y.; Tsai, F.F.; Yao, C.C. Differential regulation of collagen, lysyl oxidase and MMP-2 in human periodontal ligament cells by low- and high-level mechanical stretching. J. Periodontal Res. 2013, 48, 466–474. [Google Scholar] [CrossRef]
- Hong, H.H.; Trackman, P.C. Cytokine regulation of gingival fibroblast lysyl oxidase, collagen, and elastin. J. Periodontol. 2002, 73, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Gomatam, C.K.; Ingale, P.; Rodriguez, G.; Munger, S.; Pomeranets, R.; Krishna, S.; Lowe, J.; Howard, Z.M.; Rafael-Fortney, J.A. Cell-type specific effects of mineralocorticoid receptor gene expression suggest intercellular communication regulating fibrosis in skeletal muscle disease. Front. Physiol. 2024, 15, 1322729. [Google Scholar] [CrossRef] [PubMed]
- Gabay Yehezkely, R.; Zaffryar-Eilot, S.; Kaganovsky, A.; Fainshtain Malka, N.; Aviram, R.; Livneh, I.; Hasson, P. Intracellular role for the matrix-modifying enzyme lox in regulating transcription factor subcellular localization and activity in muscle regeneration. Dev. Cell. 2020, 53, 406–417.e5. [Google Scholar] [CrossRef]
- Chanoki, M.; Ishii, M.; Kobayashi, H.; Fushida, H.; Yashiro, N.; Hamada, T.; Ooshima, A. Increased expression of lysyl oxidase in skin with scleroderma. Br. J. Dermatol. 1995, 133, 710–715. [Google Scholar] [CrossRef]
- Voloshenyuk, T.G.; Landesman, E.S.; Khoutorova, E.; Hart, A.D.; Gardner, J.D. Induction of cardiac fibroblast lysyl oxidase by TGF-β1 requires PI3K/Akt, Smad3, and MAPK signaling. Cytokine 2011, 55, 90–97. [Google Scholar] [CrossRef] [PubMed]
- Alcudia, J.F.; Martinez-Gonzalez, J.; Guadall, A.; Gonzalez-Diez, M.; Badimon, L.; Rodriguez, C. Lysyl oxidase and endothelial dysfunction: Mechanisms of lysyl oxidase down-regulation by pro-inflammatory cytokines. Front. Biosci. 2008, 13, 2721–2727. [Google Scholar] [CrossRef] [PubMed]
- You, J.S.; Barai, P.; Chen, J. Sex differences in skeletal muscle size, function, and myosin heavy chain isoform expression during post-injury regeneration in mice. Physiol. Rep. 2023, 11, e15791. [Google Scholar] [CrossRef] [PubMed]
- Tarnutzer, K.; Siva Sankar, D.; Dengjel, J.; Ewald, C.Y. Collagen constitutes about 12% in females and 17% in males of the total protein in mice. Sci. Rep. 2023, 13, 4490. [Google Scholar] [CrossRef]
- Hardy, D.; Besnard, A.; Latil, M.; Jouvion, G.; Briand, D.; Thépenier, C.; Pascal, Q.; Guguin, A.; Gayraud-Morel, B.; Cavaillon, J.M.; et al. Comparative study of injury models for studying muscle regeneration in mice. PLoS ONE 2016, 11, e0147198. [Google Scholar] [CrossRef] [PubMed]
- Wynn, T.A.; Ramalingam, T.R. Mechanisms of fibrosis: Therapeutic translation for fibrotic disease. Nat. Med. 2012, 18, 1028–1040. [Google Scholar] [CrossRef] [PubMed]
- Garg, K.; Corona, B.T.; Walters, T.J. Therapeutic strategies for preventing skeletal muscle fibrosis after injury. Front. Pharmacol. 2015, 6, 87. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, S.; Inaoka, P.T.; Yano, A.; Nakagawa, T.; Yamazaki, T. Fast repetitive stretch suppresses denervation-induced muscle fibrosis. Muscle Nerve 2020, 62, 746–756. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed]
- Pizza, F.X.; Buckley, K.H. Regenerating myofibers after an acute muscle injury: What do we really know about them? Int. J. Mol. Sci. 2023, 24, 12545. [Google Scholar] [CrossRef] [PubMed]
- Beitzel, F.; Gregorevic, P.; Ryall, J.G.; Plant, D.R.; Sillence, M.N.; Lynch, G.S. Beta2-adrenoceptor agonist fenoterol enhances functional repair of regenerating rat skeletal muscle after injury. J. Appl. Physiol. 2004, 96, 1385–1392. [Google Scholar] [CrossRef] [PubMed]
- Plant, D.R.; Colarossi, F.E.; Lynch, G.S. Notexin causes greater myotoxic damage and slower functional repair in mouse skeletal muscles than bupivacaine. Muscle Nerve 2006, 34, 577–585. [Google Scholar] [CrossRef] [PubMed]
- Crowe, A.R.; Yue, W. Semi-quantitative determination of protein expression using immunohistochemistry staining and analysis: An integrated protocol. Bio Protoc. 2019, 9, 3465. [Google Scholar] [CrossRef] [PubMed]
- Kanda, Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow Transpl. 2013, 48, 452–458. [Google Scholar] [CrossRef] [PubMed]









| Genes | Direction | Nucleotide Positions and Sequence (5′-3′) | Sequence ID |
|---|---|---|---|
| Col1a1 | Forward | 2916 GATCTCCTGGTGCTGATG 2933 | NM_007742.4 |
| Reverse | 3028 GAAGCCTCTTTCTCCTCTCTGA 3007 | NM_007742.4 | |
| Col3a1 | Forward | 3587 CAGGTCCTAGAGGAAACAGA 3606 | BC052398.1 |
| Reverse | 3728 TCACCTCCAACTCCAACAATG 3708 | BC052398.1 | |
| Mmp2 | Forward | 2120 AAGAAAATGGACCCCGGTTT 2139 | NM_008610.3 |
| Reverse | 2251 CTTCAGGTAATAAGCACCCTTG 2230 | NM_008610.3 | |
| Mmp9 | Forward | 969 CAGCCAACTATGACCAGGAT 988 | NM_013599.5 |
| Reverse | 1217 CTGCCACCAGGAACAGG 1201 | NM_013599.5 | |
| Lox | Forward | 890 GTGCCCGACCCCTACTACAT 909 | M65142.1 |
| Reverse | 1007 TGACATCCGCCCTATATGCT 988 | M65142.1 | |
| Loxl1 | Forward | 2280 GGCCTCAGGGAGTGAACATG 2299 | NM_010729.3 |
| Reverse | 2339 AAGACAGGGTCTGGCATCCA 2320 | NM_010729.3 | |
| Loxl2 | Forward | 3257 CCTCCCTCCCGCTTTCA 3273 | NM_033325.2 |
| Reverse | 3313 CAAGTGTGCAGTCCTGGGTTT 3293 | NM_033325.2 | |
| Loxl3 | Forward | 2603 CCCCAGCAACAGACAGAACA 2622 | NM_013586.5 |
| Reverse | 2661 GAGCTGCTGCCATCCTGTGT 2642 | NM_013586.5 | |
| Loxl4 | Forward | 3501 GCAGCTTCCACTGCACTACACT 3522 | NM_001164311.1 |
| Reverse | 3561 TGTTCCGAGCGTCATCCA 3544 | NM_001164311.1 | |
| Rn18s | Forward | 1617 GCAATTATTCCCCATGAACG 1636 | NR_003278.3 |
| Reverse | 1739 GGCCTCACTAAACCATCCAA 1720 | NR_003278.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kanazawa, Y.; Takahashi, T.; Inoue, T.; Nagano, M.; Koinuma, S.; Eiyo, H.; Tamura, Y.; Miyachi, R.; Iida, N.; Miyahara, K.; et al. Effects of Aging on Intramuscular Collagen-Related Factors After Injury to Mouse Tibialis Anterior Muscle. Int. J. Mol. Sci. 2025, 26, 801. https://doi.org/10.3390/ijms26020801
Kanazawa Y, Takahashi T, Inoue T, Nagano M, Koinuma S, Eiyo H, Tamura Y, Miyachi R, Iida N, Miyahara K, et al. Effects of Aging on Intramuscular Collagen-Related Factors After Injury to Mouse Tibialis Anterior Muscle. International Journal of Molecular Sciences. 2025; 26(2):801. https://doi.org/10.3390/ijms26020801
Chicago/Turabian StyleKanazawa, Yuji, Tatsuo Takahashi, Takao Inoue, Mamoru Nagano, Satoshi Koinuma, Haruki Eiyo, Yuma Tamura, Ryo Miyachi, Naoya Iida, Kenichiro Miyahara, and et al. 2025. "Effects of Aging on Intramuscular Collagen-Related Factors After Injury to Mouse Tibialis Anterior Muscle" International Journal of Molecular Sciences 26, no. 2: 801. https://doi.org/10.3390/ijms26020801
APA StyleKanazawa, Y., Takahashi, T., Inoue, T., Nagano, M., Koinuma, S., Eiyo, H., Tamura, Y., Miyachi, R., Iida, N., Miyahara, K., & Shigeyoshi, Y. (2025). Effects of Aging on Intramuscular Collagen-Related Factors After Injury to Mouse Tibialis Anterior Muscle. International Journal of Molecular Sciences, 26(2), 801. https://doi.org/10.3390/ijms26020801

