Next Article in Journal
Polymorphisms Influence the Expression of the Fas and FasL Genes in COVID-19
Next Article in Special Issue
Understanding Deep Endometriosis: From Molecular to Neuropsychiatry Dimension
Previous Article in Journal
Photo-Crosslinking Hydrogel Based on Porcine Small Intestinal Submucosa Decellularized Matrix/Fish Collagen/GelMA for Culturing Small Intestinal Organoids and Repairing Intestinal Defects
Previous Article in Special Issue
Implications of Mineralization Biomarkers in Breast Cancer Outcomes Beyond Calcifications
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 2
10.3390/ijms26020664
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Energy Metabolism and Stemness and the Role of Lauric Acid in Reversing 5-Fluorouracil Resistance in Colorectal Cancer Cells

by
Rina Fujiwara-Tani
1,*,
Yi Luo
1,
Ruiko Ogata
1,
Kiyomu Fujii
1,
Takamitsu Sasaki
1,
Rika Sasaki
1,
Yukiko Nishiguchi
1,
Shiori Mori
1,2,
Hitoshi Ohmori
1 and
Hiroki Kuniyasu
1,*
1
Department of Molecular Pathology, Nara Medical University School of Medicine, Kashihara 634-8521, Japan
2
Department of Cancer Biology, Institute of Biomedical Science, Kansai Medical University, Osaka 573-1010, Japan
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(2), 664; https://doi.org/10.3390/ijms26020664
Submission received: 23 December 2024 / Revised: 12 January 2025 / Accepted: 13 January 2025 / Published: 14 January 2025
(This article belongs to the Collection Feature Papers in Molecular Pathology, Diagnostics, and Therapeutics)
Browse Figures
Versions Notes

Abstract

While 5-fluorouracil (5FU) plays a central role in chemotherapy for colorectal cancer (CRC), resistance to 5FU remains a major challenge in CRC treatment, and its underlying mechanisms remain unclear. In this study, we investigated the relationship between 5FU resistance acquisition, stemness, and energy metabolism. Among the two CRC cell lines, HT29 cells exhibited glycolytic and quiescent properties, while CT26 cells relied on oxidative phosphorylation (OXPHOS) for energy. In contrast, the 5FU-resistant sublines (HT29R and CT26R), developed through continuous exposure to low concentrations of 5FU, demonstrated enhanced stemness. This was associated with glycolytic dominance, low proliferation, and reduced reactive oxygen species (ROS) production. However, treatment with the medium-chain fatty acid lauric acid shifted the cells to OXPHOS, reducing stemness, increasing ROS levels, and inducing cell death, therefore reversing 5FU resistance. These findings suggest that an enhancement in stemness and the reprogramming of energy metabolism play key roles in acquiring 5FU resistance in CRC. While lauric acid reversed 5FU resistance, further clinical studies are required.

1. Introduction

Various anticancer drugs have been developed to treat solid cancers and their efficacy has improved steadily over time [1,2]. This progress has been driven by advancements in drug discovery, especially through genome analysis [3]. Molecular-targeted drugs have emerged, focusing on the environmental response mechanism of cancer cells, including hypoxia [4], interactions between cancer cells and the stroma [5,6], and the delivery systems of anticancer agents [7,8]. However, developing resistance to anticancer drugs by cancer cells remains a significant barrier to long-term drug efficacy [4].
In recent years, research on anticancer drug resistance has highlighted the role of energy metabolism and stemness in cancer cells [9,10,11,12,13,14]. Multidrug resistance in cancer is often linked to cancer stem cells (CSCs), which exhibit unique resistance mechanisms, including the expression of stem cell-specific factors such as adenine triphosphate (ATP)-binding cassette transporters and aldehyde dehydrogenase, changes in the CSC microenvironment, and epithelial–mesenchymal transition [15,16,17]. Energy metabolism is intricately linked to the maintenance of CSCs. Cancer cells predominantly rely on glycolysis for energy production through the Warburg effect, facilitated by enhanced sugar uptake [18]. This increased glycolytic activity supports rapid energy production and enhances stemness through metabolites produced during glycolysis [19].
CSCs maintain their stemness through a dual strategy involving glycolysis and oxidative phosphorylation (OXPHOS) [20,21,22]. CSCs are heterologous, comprising low-proliferative CSCs (dormant CSCs or quiescent CSCs) and high-proliferative CSCs, with the former being more resistant to treatment [22,23,24].
In colorectal cancer (CRC), approximately 50% of cases are diagnosed at stage III or higher, with a 5-year survival rate of <10% for metastatic CRC [25]. Consequently, chemotherapy plays a crucial role in treating advanced CRC, with 5-fluorouracil (5FU), a single agent or in combination with various anticancer drugs, playing a central role in CRC [25,26]. However, resistance to 5FU is a major clinical challenge. The key mechanisms contributing to 5FU resistance in CRC cells include overexpression of thymidylate synthase (TS), an enzyme targeted by 5FU [27,28]; degradation of 5FU by dihydropyrimidine dehydrogenase (DPD) [29,30]; downregulation of methylenetetrahydrofolate reductase (MTHFR) [30] and thymidine phosphorylase (TYMP) [29,31], and enhanced DNA damage repair [32,33].
Recently, the relationship between energy metabolism and stemness has gained attention as a contributor to 5FU resistance. Our previous studies on gemcitabine-resistant pancreatic cancer cell lines demonstrated that metabolic reprogramming from OXPHOS to glycolysis, combined with enhanced glutaminolysis, contributes to resistance. This shift reduces mitochondrial oxidative stress to promote drug resistance [34]. Furthermore, stabilization of hypoxia-inducible factor-1α (HIF1α) enhances stemness, further contributing to gemcitabine resistance [35]. These findings suggest that energy metabolism and stemness are interdependent factors in acquiring drug resistance. However, their specific roles in 5FU resistance in CRC remain poorly understood.
Lauric acid (LAA), a medium-chain fatty acid (MCFA), has been shown to overcome gemcitabine resistance in pancreatic cancer cell lines [35]. MCFAs have characteristic metabolic properties including faster intestinal absorption and tissue transport, compared with long-chain fatty acids [36,37,38]. Moreover, they promote OXPHOS through rapid β-oxidation by carnitine shuttle-independent mitochondrial transport [38,39]. In cancer cells with mitochondrial damage, MCFAs can induce excessive mitochondrial oxidative stress and cell death [35,40,41].
In this study, we investigated the roles of energy metabolism and stemness in 5FU resistance using two types of CRC cell lines. We further investigated the potential of LAA as a modulator of 5FU resistance.

2. Results

2.1. Differences in Proliferation, Differentiation, and Energy Metabolism

Examination of two CRC cell lines, HT29 and CT26, with stemness properties different from the cell lines we previously reported [42,43] showed higher proliferation of CT26 cells compared with HT29 cells under normal culture conditions (Figure 1A). Investigation of the degree of differentiation of the two cancer cell lines into the colonic mucosal epithelium revealed higher gene expression of alkaline phosphatase (ALP) and mucin 2 (MUC2), which are colonic mucosal epithelial markers, in CT26 cells compared with HT29 cells (Figure 1B). The assessment of OXPHOS demonstrated a higher basal oxygen consumption rate (OCR), maximum OCR, and ATP production in CT26 cells compared with HT29 cells (Figure 1C,D). In contrast, glycolysis was enhanced more in HT29 cells than in CT26 cells (Figure 1E). The energy metabolism profiles of the two cancer cell lines showed that HT29 cells tended to be more quiescent than CT26 cells (Figure 1F).

2.2. Differences in Oxidative Stress

Investigation of mitochondrial oxidative stress showed higher mitochondrial volume in HT29 cells than in CT26 cells and higher mitochondrial membrane potential (MMP) in CT26 cells than in HT29 cells (Figure 2A,B). The mitochondrial hydrogen peroxide, superoxide, and lipid peroxide (4-hydroxynonenal, 4HNE) levels were higher in CT26 cells than in HT29 cells (Figure 2C–E).

2.3. Differences in Stemness

Gene expression of leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5) and nucleostemin NS, CRC stemness markers expressed in both cell types, was higher in HT29 cells than in CT26 cells (Figure 3A). Sensitivity to 5FU was lower in HT29 cells than in CT26 cells (Figure 3B). Pluripotent stem cells showed naïve or prime stemness, with the latter demonstrating enhanced proliferation and differentiation [44,45]. The expression of naïve markers (Krüppel-like factor 4 [KLF4] [46] and proline dehydrogenase [PRODH]) [47] was high in HT29 cells, while the expression of markers for prime stemness, Lin28a [48], and DNA methyltransferase-3b (DNMT3B) [49] was high in CT29 cells.
These results suggest that HT29 cells are less proliferative and have a glycolysis-dominated energy metabolism, thus showing naïve-like stemness. In contrast, CT26 cells are highly proliferative and have OXPHOS-dominated energy metabolism, thus showing prime-like stemness.

2.4. Characterization of 5FU-Resistant Cell Lines

The IC50 values of the HT29R and CT26R 5FU-resistant cell lines increased from 9.5 to 14.1 and from 7.6 to 10.8, respectively (Figure 4A). The proliferation of both resistant cell lines was reduced compared to those of the parent cell lines (Figure 4B). The expression levels of known 5FU resistance-related genes (TS, DPD, MTHFR, and TYMP) did not differ significantly between the parent and resistant cell lines (Figure 4C). Assessment of OXPHOS revealed reduced basal OCR, maximum OCR, and ATP in both resistant cell lines compared with the parent cell lines (Figure 4D–F). In contrast, glycolysis was enhanced in both resistant cell lines compared with the parent cell lines (Figure 4G). The energy metabolism profiles of both resistant cell lines showed glycolytic changes (Figure 4H). Mitochondrial volume and MMP were lower in both resistant cell lines compared with the parent cell lines (Figure 4I,J). In contrast, oxidative stress was decreased in both resistant cell lines compared with the parent cell lines (Figure 4K–M). Furthermore, oxidative stress upon 5FU treatment decreased in the resistant cell lines (Figure 4N–P).
Both resistant cell lines showed decreased apoptosis compared with the parent cell lines (Figure 5A). Moreover, 5FU-induced apoptosis was also reduced (Figure 5B). Mitophagy was also increased in both resistant cell lines compared with the parent cell lines (Figure 5C). Gene expression of HIF1α [35], which promotes the development of drug resistance in pancreatic cancer cell lines, and cytosolic NADPH dehydrogenase 1 (malic enzyme 1, ME1) [50,51], which promotes glutaminolysis and is related to stemness in oral cancer cells, were increased in HT29R and CT26R cells, whereas only HIF1α showed increased expression in CT26R cells (Figure 5D). The sphere formation ability was increased in both resistant cell lines (Figure 5E). Furthermore, examination of the expression levels of the naïve-like stem cell-associated marker PRODH and prime-like stem cell-associated marker LIN28A showed increased PRODH expression in both resistant cell lines, whereas the expression of LIN28A observed in CT26 cells was almost completely lost in CT26R cells (Figure 5F).
Thus, the resistant cells established from the two CRC cell lines showed enhanced glycolysis due to the reprogramming of energy metabolism and the promotion of naïve-like changes in stemness.

2.5. Effect of LAA on 5FU-Resistant CRC Cell Lines

We previously demonstrated the effectiveness of LAA against drug resistance in pancreatic cancer cell lines [35]. Therefore, we examined the effect of LAA on the two 5FU-resistant cell lines established in the current study (Figure 6). LAA significantly inhibited cell proliferation in resistant cells treated with 5FU equivalent to the IC50 (Figure 6A). No change was observed in oxidative stress for treatment with 5FU alone, whereas a high degree of induction was observed early in LAA co-treatment (Figure 6B). Apoptosis increased in the middle phase for treatment with 5FU alone, whereas it increased early in LAA co-treatment (Figure 6C). LAA co-treatment enhanced ATP production, which decreased in the late phase (Figure 6D). In contrast, LAA co-treatment enhanced lactate concentration in the culture medium, a marker of glycolysis (Figure 6E). Treatment with 5FU alone increased HIF1α and ME1 protein levels, whereas those levels were suppressed by simultaneous treatment with LAA (Figure 6F,G). Finally, the sphere formation ability showed an early decrease during simultaneous treatment with LAA (Figure 6H).
Thus, simultaneous treatment with 5FU and LAA can overcome 5FU resistance by enhancing oxidative stress through forced promotion of OXPHOS and suppression of the expression of stemness-associated proteins.

3. Discussion

In this study, we used two colon cancer cell lines, HT29 and CT26, to examine changes in stem cell properties and energy metabolism during the acquisition of 5FU resistance. Compared with CT26 cells, which are OXPHOS-dominant and energetic, HT29 cells show glycolytic and quiescent properties. However, upon acquiring 5FU resistance, both cell lines exhibited enhanced stemness and changed to a state of low proliferative ability with glycolytic dominance and reduced reactive oxygen species (ROS) production. In contrast, LAA reversed 5FU resistance by inducing OXPHOS, increasing ROS levels, and inducing cell death.
The relationship between CSCs and normal stem cells has attracted considerable research attention. Compared with tissue stem cells, which are almost quiescent, pluripotent stem cells (PSCs) exhibit vigorous proliferation [52,53]. Therefore, CSCs resemble PSCs [54]. Unlike somatic cells, PSCs possess a unique metabolic pathway highly dependent on glycolysis [55]. In this respect, CSCs that exhibit the Warburg effect resemble PSCs. The crista morphology also shows immature and fragmented mitochondria in PSCs [56,57], resembling CSCs that exhibit the Warburg effect [55,58]. Conversely, enhanced OXPHOS is associated with a loss of pluripotency [59] and was correlated with higher colonocyte differentiation in CT26 cells than in HT29 cells in the current study.
Pluripotency is currently recognized in two distinct states: naïve and primed. The naïve state corresponds to the pre-implantation state, while the prime state corresponds to the post-implantation state, which is more mature and has a degree of differentiation bias [60]. To examine the correspondence between these two states and CRC cells, we investigated the expression of KLF4 [46] and PRODH [47] as markers of the naïve state and LIN28A [48] and DNMT3B [49] as markers of the prime state. We observed that HT29 cells predominantly expressed KLF4 and PRODH, which suggests that HT29 cells exhibit a naïve-like phenotype. In contrast, CT26 cells predominantly expressed LIN28A and DNMT3B and exhibited a prime-like phenotype. These findings correlated with the proliferation, energy metabolism, ROS production, and differentiation of both CRC cell lines. In contrast, after acquiring 5FU resistance, both CRC cell lines showed increased expression of naïve markers and decreased proliferation, MMP, and ROS production, suggesting a change to a naïve-like state. In particular, Lin28a expression was lost in CT26R cells, indicating that the stem cell phenotype changed from primed to naïve, suggesting that this may be due to reprogramming of energy metabolism. In CSCs, low MMP levels reduce mitochondrial ROS levels [61]. Thus, naïve-like stemness and changes in energy metabolism may be associated with 5FU resistance.
In this study, HIF1α and ME1 expression levels were higher in the 5FU-resistant cell lines. Although our experimental system was not hypoxic, increased ROS levels stabilized the HIF1α protein [62]. This suggests that 5FU-induced ROS production activated HIF1α in the 5FU-resistant cells. HIF1α increases dynamin-related protein 1-dependent mitochondrial fission and promotes the Warburg phenotype [63,64,65,66]. Hypoxia, which induces HIF1α, also causes resistance to anticancer drugs through HIF1α-dependent mitochondrial changes [67] and HIF1α-induced glycolytic flux [52,53,68]. Fission mitochondria are present in cells that do not require high respiratory activity [69]. HIF1α also suppresses mitochondrial biogenesis and PTEN-induced kinase 1 transcription [70]. Moreover, we previously showed that stabilization of HIF1α promotes energy metabolism reprogramming and induces early gemcitabine resistance [35].
ME1 directly converts the malate produced in the tricarboxylic acid (TCA) cycle to pyruvate, while increased pyruvate levels promote glutaminolysis [71]. Glutaminolysis is a metabolic phenotype associated with CSCs, especially those with KRAS mutations [72], and has attracted attention as a potential therapeutic target [73,74]. Glutaminolysis promotes stemness by activating Yes-associated proteins, transcriptional coactivators with PDZ-binding motifs, and WNT [72,75]. We previously demonstrated the correlation between increased ME1 expression and malignancy in oral squamous cell carcinomas, particularly invasiveness due to epithelial–mesenchymal transition at the cancer front [50,51].
In the current study, LAA promoted OXPHOS in the resistant cell lines, accompanied by increased mitochondrial ROS. This effect promotes apoptosis and may explain the antitumor effects of LAA. Similar results were reported in previous studies [36,37]. However, LAA does not increase mitochondrial ROS levels in normal cells [76,77,78]. Thus, the effects in cancer cells may be attributed to mitochondrial disorders in these cells [79,80,81]. Mitochondrial gene mutations are frequently observed in cancer and cancer cells by altering mitochondrial DNA copy number, energy metabolism, oxidative stress, nuclear–mitochondrial interactions, and the cancer microenvironment [82,83,84]. This may contribute to carcinogenicity [85]. Therefore, LAA may have different thresholds of cytotoxicity between cancer and normal cells and could be used as a cancer treatment that distinguishes between normal and cancer tissues.
In this study, we focused on a small molecule called LAA and clarified its antitumor effect, especially its ability to suppress anticancer drug resistance. In addition, small molecule compounds that are expected to overcome anticancer drug resistance are attracting attention. Thiocolchicoside has a muscle relaxant effect through inhibition of nicotinic acetylcholine receptors and GABA. Like LAA, thiocolchicoside also enhances skin permeability and improves drug delivery [86]. Salinomycin, an antibiotic, suppresses cancer stemness through autophagy and enhances drug sensitivity [87]. Beta-elemene is an extract of Curcuma wenyujin that inhibits the ATP-binding cassette subfamily B member 1 transporter and induces apoptosis and autophagy through the suppression of exosome transmission, promoting drug sensitivity [88]. Metformin, a type 2 diabetes drug, is expected to contribute to overcoming anticancer drug resistance by inducing apoptosis and ferroptosis in cancer cells through regulation of AMPK activity and effects on the immune system [89,90]. In addition, berberine, a Berberis extract, is expected to be effective against drug resistance because it suppresses cancer stem cell activity [91]. In addition, pterostilbene, a blueberry component, is expected to be effective against drug resistance because it promotes cell death in cancer stem cells through mitochondrial iron accumulation [92,93,94]. By combining such small molecule compounds with existing chemotherapy or molecular targeted drugs, it is expected to promote drug efficacy, suppress the acquisition of resistance, and reduce side effects. The results of this study demonstrated that CRCs develop resistance to 5FU due to changes in stemness accompanied by the reprogramming of energy metabolism, similar to the development of gemcitabine resistance in pancreatic cancer cell lines. Moreover, we showed that LAA is effective against developing 5FU resistance. However, the molecular mechanisms underlying these alterations in stemness have not yet been fully elucidated. Additional studies are needed to elucidate this mechanism and develop strategies for preventing resistance to anticancer drugs. In addition, in this and our previous studies, we investigated key anticancer drugs used in chemotherapy: gemcitabine for pancreatic cancers and 5FU for CRCs. Further studies are needed to examine the role of alterations in stemness and reprogramming of energy metabolism in the mechanism of resistance acquisition for other anticancer drugs used in various tumors and whether LAA is effective in overcoming these other drug resistances. Ultimately, its efficacy must be established in humans through therapeutic experiments in animal models as well as clinical studies.

4. Materials and Methods

4.1. Cell Lines

HT29 human CRC cell lines were purchased from Dainihon Pharmacy Co. (Tokyo, Japan). The CT26 murine CRC cell line was a gift from Professor I. J. Fidler (MD Anderson Cancer Center, Houston, TX, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum at 37 °C in 5% CO2. The cells were treated with 5FU (Sigma-Aldrich, St. Louis, MO, USA) and/or LAA (40 μg/mL, Wako Pure Chemical Corporation, Osaka, Japan). The 5FU-resistant cell lines were derived from HT29 and CT26 cells by continuous low-dose 5FU treatment (IC5) for 50 passages. Apoptosis was assessed via the examination of 1000 cells, which were stained with Hoechst 33342 dye (Life Technologies, Carlsbad, CA, USA) and viewed using a fluorescent microscope.

4.2. [3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) Assay

MTS assays were performed using a CellTiter 96 aqueous one-solution cell proliferation assay kit (Promega Biosciences Inc., San Luis Obispo, CA, USA). The plates were read using a Multiskan FC (Thermo Fisher Scientific, Waltham, MA, USA) microplate photometer at a wavelength of 490 nm. The MTS value of cells cultured with the control oligonucleotide was used as the control.

4.3. Mitochondrial Imaging

Mitochondrial function was examined using fluorescent probes. After treatment with or without LAA (40 μg/mL), the cells were incubated with the probes for 30 min at 37 °C and then photographed using an All-in-One fluorescence microscope (KEYENCE, Osaka, Japan). We used dihydrorhodamine 123 (DHR123) (100 μM, Dojindo, Kumamoto, Japan) to measure mitochondrial H2O2, MitoSOX (mitochondrial superoxide) (10 μM, AAT Bioquest Inc., Sunnyvale, CA, USA) to assess oxidative stress, MitoGreen (100 nM, PromoCell GmbH, Heidelberg, Germany) to assess mitochondrial volume, and tetramethylrhodamine ethyl ester (TMRE) (200 nM, Sigma-Aldrich) to assess mitochondrial membrane potential. Mitophagy was detected using the Mitophagy Detection Kit (Dojindo) according to the manufacturer’s instructions.

4.4. Protein Extraction

Whole-cell lysates were prepared as previously described using radioimmunoprecipitation assay buffer containing 0.1% sodium dodecyl sulfate (Thermo Fisher Scientific, Tokyo, Japan) [95]. Protein assays were performed using the Protein Assay Rapid Kit (Wako).

4.5. Enzyme-Linked Immunosorbent Assay (ELISA) and Fluorometric Assay

We used an ELISA kit to measure the concentrations of 4HNE, lactate, ALP, MUC2, ATP, HIF1α, and ME1 in whole-cell lysates (Table 1). The assay was performed according to the manufacturer’s instructions.

4.6. Sphere Assay

Cells (1000 cells/well) were seeded on uncoated bacteriological 35 mm dishes (Corning Inc., Corning, NY, USA) with 3D Tumorsphere Medium XF (Sigma-Aldrich) and cultured with or without LAA (40 μg/mL). After seven days, sphere images were captured using a computer and the sphere numbers were measured using NIH ImageJ software (version 1.52, Bethesda, MD, USA).

4.7. Mitochondrial Stress Test

To analyze mitochondrial respiration and ATP production, we used a Seahorse XF Analyzer (Agilent Technologies, Santa Clara, CA, USA) to measure extracellular flux in live cells. The cells were collected immediately after LAA treatment (40 µg/mL, 48 h), transferred to an XF plate at densities of 2 × 104 cells/well, and incubated overnight. The following day, the medium on the XF plate was replaced with XF DMEM, 1 h before the assay. Mito Stress Test (Seahorse XF Cell Mito Stress Test, Agilent Technologies) was performed according to the manufacturer’s protocol. The OCR was measured under the following conditions: 2 µM oligomycin, 0.5 µM carbonyl cyanide-p-trifluoromethoxyphenylhydrazone, and 0.5 µM rotenone/antimycin A. The OCR was normalized to the total cellular protein concentration, which was determined after protein extraction from the analyzed cells.

4.8. Glycolytic Stress Test

The extracellular acidification rate (ECAR) of CRC cells was measured using a modified glycolytic stress test on a Seahorse XFe24 Extracellular Flux Analyzer instrument with Seahorse XF24 FluxPaks (Agilent Technologies, Santa Clara, CA, USA). CRC cells were cultured in growth medium in six-well plates with ascites or culture medium before the Seahorse experiments. CRC cells (1 × 104 cells/well) were plated in XF base medium (Agilent Technologies, Santa Clara, CA, USA) containing 200 mM L-glutamine and 5 mM HEPES, as recommended by the manufacturer for glycolytic assays. The sensor cartridge apparatus was rehydrated one day in advance by adding 1 mL XF Calibrant to each well and incubating at 37 °C until needed. The injection ports of the sensor cartridge apparatus were then loaded with the following drugs, in chronological order of four injections, to meet the indicated final concentrations in the wells: 10 mM glucose, 1 µM oligomycin, 1 µM rotenone and 5 µM antimycin A (combined injection), and 50 mM 2-deoxyglucose. Treatment with the rotenone/antimycin combination allowed the assessment of the impact of electron transport on ECAR by respiratory acidification coupled with the passage of some glycolytic pyruvate through the TCA cycle to supply respiration.

4.9. Reverse Transcription Polymerase Chain Reaction (RT-PCR)

To assess human and murine mRNA expression, RT-PCR was performed using 0.5 µg of total RNA extracted from the three cell lines using an RNeasy kit (Qiagen, Germantown, MD, USA). The primer sets are listed in Table 1 and were synthesized by Sigma Genosys (Ishikari, Japan). The PCR products were electrophoresed on a 2% agarose gel and stained with ethidium bromide. β-Actin mRNA was amplified and used as the internal control.

4.10. Statistical Analysis

Statistical significance was calculated using a two-tailed Fisher exact test, ordinary analysis of variance, and InStat software version 3.1 (GraphPad, San Diego, CA, USA). Two-sided p < 0.05 was considered statistically significant.

Author Contributions

Study concept and design: R.F.-T. and H.K. Data investigation: R.F.-T., Y.L., R.O., Y.N., R.S. and S.M. Data analysis: K.F., T.S. and H.O. Drafting of the manuscript: R.F.-T. Editing of the manuscript: R.F.-T. and H.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by MEXT KAKENHI, grant numbers 19K16564 (RFT), 23K19900 (RO), 23K10481 (HO), 21K11223 (KF), 22K16497 (YN), 21K06926 (YL), and 20K21659 (HK).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors thank Tomomi Nitta for expert assistance with the preparation of this manuscript.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Abbreviations

5FU5-fluorouracil
CRCcolorectal cancer
OXPHOSoxidative phosphorylation
ROSreactive oxygen species
CSCcancer stem cell
TSthymidylate synthase
DPDdihydropyrimidine dehydrogenase
MTHFRmethylenetetrahydrofolate reductase
TYMPthymidine phosphorylase
HIF1αhypoxia-inducible factor-1α
LAAlauric acid
MCFAmedium-chain fatty acid
ALPalkaline phosphatase
MUC2mucin 2
MMPmitochondrial membrane potential
4HNE4-hydroxynonenal
LGR5leucine-rich repeat-containing G-protein coupled receptor 5
NSNucleostemin
KLF4Krüppel-like factor 4
PRODHproline dehydrogenase
Dnmt3bDNA methyltransferase-3b
ME1cytosolic NADPH dehydrogenase 1 (malic enzyme 1)
PSCpluripotent stem cell

References

  1. Li, J.; Yang, B.; Teng, Z.; Liu, Y.; Li, D.; Qu, X. Efficacy and safety of first-line treatments for advanced hepatocellular carcinoma patients: A systematic review and network meta-analysis. Front. Immunol. 2024, 15, 1430196. [Google Scholar] [CrossRef]
  2. Orillard, E.; Adhikari, A.; Malouf, R.S.; Calais, F.; Marchal, C.; Westeel, V. Immune checkpoint inhibitors plus platinum-based chemotherapy compared to platinum-based chemotherapy with or without bevacizumab for first-line treatment of older people with advanced non-small cell lung cancer. Cochrane Database Syst. Rev. 2024, 8, CD015495. [Google Scholar] [CrossRef] [PubMed]
  3. Matsuoka, T.; Yashiro, M. Molecular Mechanism for Malignant Progression of Gastric Cancer Within the Tumor Microenvironment. Int. J. Mol. Sci. 2024, 25, 11735. [Google Scholar] [CrossRef] [PubMed]
  4. Mustafa, M.; Rashed, M.; Winum, J.Y. Novel Anticancer Drug Discovery Strategies Targeting Hypoxia-Inducible factors. Expert Opin. Drug Discov. 2024, 20, 103–121. [Google Scholar] [CrossRef] [PubMed]
  5. Rastegar-Pouyani, N.; Abdolvahab, M.H.; Farzin, M.A.; Zare, H.; Kesharwani, P.; Sahebkar, A. Targeting cancer-associated fibroblasts with pirfenidone: A novel approach for cancer therapy. Tissue Cell 2024, 91, 102624. [Google Scholar] [CrossRef] [PubMed]
  6. Mittal, V.; El Rayes, T.; Narula, N.; McGraw, T.E.; Altorki, N.K.; Barcellos-Hoff, M.H. The Microenvironment of Lung Cancer and Therapeutic Implications. Adv. Exp. Med. Biol. 2016, 890, 75–110. [Google Scholar] [CrossRef] [PubMed]
  7. Yoo, H.; Kim, Y.; Kim, J.; Cho, H.; Kim, K. Overcoming Cancer Drug Resistance with Nanoparticle Strategies for Key Protein Inhibition. Molecules 2024, 29, 3994. [Google Scholar] [CrossRef] [PubMed]
  8. Kirtane, A.R.; Kalscheuer, S.M.; Panyam, J. Exploiting nanotechnology to overcome tumor drug resistance: Challenges and opportunities. Adv. Drug Deliv. Rev. 2013, 65, 1731–1747. [Google Scholar] [CrossRef] [PubMed]
  9. Liu, Z.; Parveen, N.; Rehman, U.; Aziz, A.; Sheikh, A.; Abourehab, M.A.S.; Guo, W.; Huang, J.; Wang, Z.; Kesharwani, P. Unravelling the enigma of siRNA and aptamer mediated therapies against pancreatic cancer. Mol. Cancer 2023, 22, 8. [Google Scholar] [CrossRef] [PubMed]
  10. Niharika; Garg, M. Understanding the autophagic functions in cancer stem cell maintenance and therapy resistance. Expert Rev. Mol. Med. 2024, 26, e23. [Google Scholar] [CrossRef] [PubMed]
  11. Jamroze, A.; Liu, X.; Tang, D.G. Treatment-induced stemness and lineage plasticity in driving prostate cancer therapy resistance. Cancer Heterog. Plast. 2024, 1, 0005. [Google Scholar] [CrossRef] [PubMed]
  12. Chen, L.; Zhang, H.; Shang, C.; Hong, Y. The Role and Applied Value of Mitochondria in Glioma-Related Research. CNS Neurosci. Ther. 2024, 30, e70121. [Google Scholar] [CrossRef]
  13. Hu, Y.; Liu, W.; Fang, W.; Dong, Y.; Zhang, H.; Luo, Q. Tumor energy metabolism: Implications for therapeutic targets. Mol. Biomed. 2024, 5, 63. [Google Scholar] [CrossRef] [PubMed]
  14. Li, J.; Zhang, W.; Chen, L.; Wang, X.; Liu, J.; Huang, Y.; Qi, H.; Wang, T.; Li, Q. Targeting extracellular matrix interaction in gastrointestinal cancer: Immune modulation, metabolic reprogramming, and therapeutic strategies. Biochim. Biophys. Acta Rev. Cancer 2024, 1879, 189225. [Google Scholar] [CrossRef]
  15. Monzer, A.; Ghamlouche, F.; Wakimian, K.; Ballout, F.; Al Bitar, S.; Yehya, A.; Kanso, M.; Saheb, N.; Tawil, A.; Doughan, S.; et al. ONC206, an imipridone derivative, demonstrates anti-colorectal cancer activity against stem/progenitor cells in 3D cell cultures and in patient-derived organoids. Pharmacol. Rep. 2024. online ahead of print. [Google Scholar] [CrossRef] [PubMed]
  16. Di, C.; Zhao, Y. Multiple drug resistance due to resistance to stem cells and stem cell treatment progress in cancer (Review). Exp. Ther. Med. 2015, 9, 289–293. [Google Scholar] [CrossRef]
  17. Saha, T.; Lukong, K.E. Breast Cancer Stem-Like Cells in Drug Resistance: A Review of Mechanisms and Novel Therapeutic Strategies to Overcome Drug Resistance. Front. Oncol. 2022, 12, 856974. [Google Scholar] [CrossRef] [PubMed]
  18. Warburg, O.; Wind, F.; Negelein, E. The Metabolism of tumors in the body. J. Gen. Physiol. 1927, 8, 519–530. [Google Scholar] [CrossRef]
  19. Cordani, M.; Michetti, F.; Zarrabi, A.; Zarepour, A.; Rumio, C.; Strippoli, R.; Marcucci, F. The role of glycolysis in tumorigenesis: From biological aspects to therapeutic opportunities. Neoplasia 2024, 58, 101076. [Google Scholar] [CrossRef] [PubMed]
  20. Sancho, P.; Burgos-Ramos, E.; Tavera, A.; Bou Kheir, T.; Jagust, P.; Schoenhals, M.; Barneda, D.; Sellers, K.; Campos-Olivas, R.; Graña, O.; et al. MYC/PGC-1α Balance Determines the Metabolic Phenotype and Plasticity of Pancreatic Cancer Stem Cells. Cell Metab. 2015, 22, 590–605. [Google Scholar] [CrossRef]
  21. Elhinnawi, M.A.; Boushra, M.I.; Hussien, D.M.; Hussein, F.H.; Abdelmawgood, I.A. Mitochondria’s Role in the Maintenance of Cancer Stem Cells in Hepatocellular Carcinoma. Stem Cell Rev. Rep. 2024. online ahead of print. [Google Scholar] [CrossRef] [PubMed]
  22. Uslu, C.; Kapan, E.; Lyakhovich, A. Cancer resistance and metastasis are maintained through oxidative phosphorylation. Cancer Lett. 2024, 587, 216705. [Google Scholar] [CrossRef] [PubMed]
  23. Friess, D.; Brauer, S.; Pöysti, A.; Choudhury, C.; Harris, L. Tools to study neural and glioma stem cell quiescence. Trends Neurosci. 2024, 47, 736–748. [Google Scholar] [CrossRef]
  24. Du, Y.; Gupta, P.; Qin, S.; Sieber, M. The role of metabolism in cellular quiescence. J. Cell. Sci. 2023, 136, 325880. [Google Scholar] [CrossRef]
  25. McQuade, R.M.; Stojanovska, V.; Bornstein, J.C.; Nurgali, K. Colorectal Cancer Chemotherapy: The Evolution of Treatment and New Approaches. Curr. Med. Chem. 2017, 24, 1537–1557. [Google Scholar] [CrossRef]
  26. Vodenkova, S.; Buchler, T.; Cervena, K.; Veskrnova, V.; Vodicka, P.; Vymetalkova, V. 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future. Pharmacol. Ther. 2020, 206, 107447. [Google Scholar] [CrossRef] [PubMed]
  27. Gmeiner, W.H.; Okechukwu, C.C. Review of 5-FU resistance mechanisms in colorectal cancer: Clinical significance of attenuated on-target effects. Cancer Drug Resist. 2023, 6, 257–272. [Google Scholar] [CrossRef]
  28. Kumar, A.; Singh, A.K.; Singh, H.; Thareja, S.; Kumar, P. Regulation of thymidylate synthase: An approach to overcome 5-FU resistance in colorectal cancer. Med. Oncol. 2022, 40, 3. [Google Scholar] [CrossRef]
  29. Zhang, Y.H.; Luo, D.D.; Wan, S.B.; Qu, X.J. S1PR2 inhibitors potently reverse 5-FU resistance by downregulating DPD expression in colorectal cancer. Pharmacol. Res. 2020, 155, 104717. [Google Scholar] [CrossRef] [PubMed]
  30. Xie, P.; Mo, J.L.; Liu, J.H.; Li, X.; Tan, L.M.; Zhang, W.; Zhou, H.H.; Liu, Z.Q. Pharmacogenomics of 5-fluorouracil in colorectal cancer: Review and update. Cell. Oncol. 2020, 43, 989–1001. [Google Scholar] [CrossRef] [PubMed]
  31. Ibrahim, S.; Li, G.; Hu, F.; Hou, Z.; Chen, Q.; Luo, X.; Hu, J.; Feng, Y. PIK3R3 promotes chemotherapeutic sensitivity of colorectal cancer through PIK3R3/NF-kB/TP pathway. Cancer Biol. Ther. 2018, 19, 222–229. [Google Scholar] [CrossRef]
  32. Baba, H.; Watanabe, M.; Okabe, H.; Miyamoto, Y.; Sakamoto, Y.; Baba, Y.; Iwatsuki, M.; Chikamoto, A.; Beppu, T. Upregulation of ERCC1 and DPD expressions after oxaliplatin-based first-line chemotherapy for metastatic colorectal cancer. Br. J. Cancer 2012, 107, 1950–1955. [Google Scholar] [CrossRef] [PubMed]
  33. Sreekumar, R.; Al-Saihati, H.; Emaduddin, M.; Moutasim, K.; Mellone, M.; Patel, A.; Kilic, S.; Cetin, M.; Erdemir, S.; Navio, M.S.; et al. The ZEB2-dependent EMT transcriptional programme drives therapy resistance by activating nucleotide excision repair genes ERCC1 and ERCC4 in colorectal cancer. Mol. Oncol. 2021, 15, 2065–2083. [Google Scholar] [CrossRef] [PubMed]
  34. Fujiwara-Tani, R.; Sasaki, T.; Bhawal, U.K.; Mori, S.; Ogata, R.; Sasaki, R.; Ikemoto, A.; Kishi, S.; Fujii, K.; Ohmori, H.; et al. Nuclear MAST4 Suppresses FOXO3 through Interaction with AKT3 and Induces Chemoresistance in Pancreatic Ductal Carcinoma. Int. J. Mol. Sci. 2024, 25, 4056. [Google Scholar] [CrossRef]
  35. Takagi, T.; Fujiwara-Tani, R.; Mori, S.; Kishi, S.; Nishiguchi, Y.; Sasaki, T.; Ogata, R.; Ikemoto, A.; Sasaki, R.; Ohmori, H.; et al. Lauric Acid Overcomes Hypoxia-Induced Gemcitabine Chemoresistance in Pancreatic Ductal Adenocarcinoma. Int. J. Mol. Sci. 2023, 24, 7506. [Google Scholar] [CrossRef] [PubMed]
  36. Scheig, R. Absoption of dietary fat: Use of medium-chain triglycerides in malabsorption. Am. J. Clin. Nutr. 1968, 21, 300–304. [Google Scholar] [CrossRef] [PubMed]
  37. Hagenfeldt, L.; Wahren, J.; Pernow, B.; Räf, L. Uptake of individual free fatty acids by skeletal muscle and liver in man. J. Clin. Investig. 1972, 51, 2324–2330. [Google Scholar] [CrossRef]
  38. Papamandjaris, A.A.; MacDougall, D.E.; Jones, P.J. Medium chain fatty acid metabolism and energy expenditure: Obesity treatment implications. Life Sci 1998, 62, 1203–1215. [Google Scholar] [CrossRef]
  39. Fauser, J.K.; Matthews, G.M.; Cummins, A.G.; Howarth, G.S. Induction of apoptosis by the medium-chain length fatty acid lauric acid in colon cancer cells due to induction of oxidative stress. Chemotherapy 2013, 59, 214–224. [Google Scholar] [CrossRef]
  40. Metges, C.C.; Wolfram, G. Medium- and long-chain triglycerides labeled with 13C: A comparison of oxidation after oral or parenteral administration in humans. J. Nutr. 1991, 121, 31–36. [Google Scholar] [CrossRef]
  41. Kadochi, Y.; Mori, S.; Fujiwara-Tani, R.; Luo, Y.; Nishiguchi, Y.; Kishi, S.; Fujii, K.; Ohmori, H.; Kuniyasu, H. Remodeling of energy metabolism by a ketone body and medium-chain fatty acid suppressed the proliferation of CT26 mouse colon cancer cells. Oncol. Lett. 2017, 14, 673–680. [Google Scholar] [CrossRef] [PubMed]
  42. Ogata, R.; Mori, S.; Ohmori, H.; Kishi, S.; Fujiwara-Tani, R.; Sasaki, T.; Nishiguchi, Y.; Nakashima, C.; Goto, K.; Kawahara, I.; et al. Suppressive GLI2 fragment enhances liver metastasis in colorectal cancer. Oncotarget 2022, 13, 122–135. [Google Scholar] [CrossRef]
  43. Kita, M.; Fujiwara-Tani, R.; Kishi, S.; Mori, S.; Ohmori, H.; Nakashima, C.; Goto, K.; Sasaki, T.; Fujii, K.; Kawahara, I.; et al. Role of creatine shuttle in colorectal cancer cells. Oncotarget 2023, 14, 485–501. [Google Scholar] [CrossRef]
  44. Du, P.; Wu, J. Hallmarks of totipotent and pluripotent stem cell states. Cell Stem Cell 2024, 31, 312–333. [Google Scholar] [CrossRef]
  45. Varzideh, F.; Gambardella, J.; Kansakar, U.; Jankauskas, S.S.; Santulli, G. Molecular Mechanisms Underlying Pluripotency and Self-Renewal of Embryonic Stem Cells. Int. J. Mol. Sci. 2023, 24, 8386. [Google Scholar] [CrossRef] [PubMed]
  46. Yoneyama, Y.; Zhang, R.R.; Kimura, M.; Cai, Y.; Adam, M.; Parameswaran, S.; Masaki, H.; Mizuno, N.; Bhadury, J.; Maezawa, S.; et al. Inter-cellular mRNA Transfer Alters Human Pluripotent Stem Cell State. bioRxiv 2024. [Google Scholar] [CrossRef]
  47. Chen, C.; Liu, Q.; Chen, W.; Gong, Z.; Kang, B.; Sui, M.; Huang, L.; Wang, Y.J. PRODH safeguards human naive pluripotency by limiting mitochondrial oxidative phosphorylation and reactive oxygen species production. EMBO Rep. 2024, 25, 2015–2044. [Google Scholar] [CrossRef] [PubMed]
  48. Chen, B.; Jia, M.; Zhao, G.; Liu, Y.; Song, Y.; Sun, M.; Chi, W.; Wang, X.; Jiang, Q.; Xin, G.; et al. STAG2 promotes naive-primed transition via activating Lin28a transcription in mouse embryonic stem cells. J. Biol. Chem. 2024, 300, 107958. [Google Scholar] [CrossRef] [PubMed]
  49. Zhao, B.; Yu, X.; Shi, J.; Ma, S.; Li, S.; Shi, H.; Xia, S.; Ye, Y.; Zhang, Y.; Du, Y.; et al. A stepwise mode of TGFβ-SMAD signaling and DNA methylation regulates naïve-to-primed pluripotency and differentiation. Nat. Commun. 2024, 15, 10123. [Google Scholar] [CrossRef] [PubMed]
  50. Nakashima, C.; Yamamoto, K.; Fujiwara-Tani, R.; Luo, Y.; Matsushima, S.; Fujii, K.; Ohmori, H.; Sasahira, T.; Sasaki, T.; Kitadai, Y.; et al. Expression of cytosolic malic enzyme (ME1) is associated with disease progression in human oral squamous cell carcinoma. Cancer Sci. 2018, 109, 2036–2045. [Google Scholar] [CrossRef]
  51. Nakashima, C.; Kirita, T.; Yamamoto, K.; Mori, S.; Luo, Y.; Sasaki, T.; Fujii, K.; Ohmori, H.; Kawahara, I.; Mori, T.; et al. Malic Enzyme 1 Is Associated with Tumor Budding in Oral Squamous Cell Carcinomas. Int. J. Mol. Sci. 2020, 21, 7149. [Google Scholar] [CrossRef]
  52. Ishihara, N.; Nomura, M.; Jofuku, A.; Kato, H.; Suzuki, S.O.; Masuda, K.; Otera, H.; Nakanishi, Y.; Nonaka, I.; Goto, Y.; et al. Mitochondrial fission factor Drp1 is essential for embryonic development and synapse formation in mice. Nat. Cell Biol. 2009, 11, 958–966. [Google Scholar] [CrossRef] [PubMed]
  53. Wakabayashi, J.; Zhang, Z.; Wakabayashi, N.; Tamura, Y.; Fukaya, M.; Kensler, T.W.; Iijima, M.; Sesaki, H. The dynamin-related GTPase Drp1 is required for embryonic and brain development in mice. J. Cell Biol. 2009, 186, 805–816. [Google Scholar] [CrossRef]
  54. Abdel-Haleem, A.M.; Lewis, N.E.; Jamshidi, N.; Mineta, K.; Gao, X.; Gojobori, T. The Emerging Facets of Non-Cancerous Warburg Effect. Front. Endocrinol. 2017, 8, 279. [Google Scholar] [CrossRef]
  55. Folmes, C.D.; Nelson, T.J.; Martinez-Fernandez, A.; Arrell, D.K.; Lindor, J.Z.; Dzeja, P.P.; Ikeda, Y.; Perez-Terzic, C.; Terzic, A. Somatic oxidative bioenergetics transitions into pluripotency-dependent glycolysis to facilitate nuclear reprogramming. Cell Metab. 2011, 14, 264–271. [Google Scholar] [CrossRef]
  56. Kawano, I.; Bazila, B.; Ježek, P.; Dlasková, A. Mitochondrial Dynamics and Cristae Shape Changes During Metabolic Reprogramming. Antioxid. Redox Signal 2023, 39, 684–707. [Google Scholar] [CrossRef]
  57. Kondadi, A.K.; Anand, R.; Reichert, A.S. Cristae Membrane Dynamics—A Paradigm Change. Trends Cell Biol. 2020, 30, 923–936. [Google Scholar] [CrossRef]
  58. Chung, S.; Dzeja, P.P.; Faustino, R.S.; Perez-Terzic, C.; Behfar, A.; Terzic, A. Mitochondrial oxidative metabolism is required for the cardiac differentiation of stem cells. Nat. Clin. Pract. Cardiovasc. Med. 2007, 4 (Suppl. S1), S60–S67. [Google Scholar] [CrossRef] [PubMed]
  59. Varum, S.; Rodrigues, A.S.; Moura, M.B.; Momcilovic, O.; Easley, C.A.t.; Ramalho-Santos, J.; Van Houten, B.; Schatten, G. Energy metabolism in human pluripotent stem cells and their differentiated counterparts. PLoS ONE 2011, 6, e20914. [Google Scholar] [CrossRef] [PubMed]
  60. Nichols, J.; Smith, A. Naive and primed pluripotent states. Cell Stem Cell 2009, 4, 487–492. [Google Scholar] [CrossRef]
  61. Zhang, B.B.; Wang, D.G.; Guo, F.F.; Xuan, C. Mitochondrial membrane potential and reactive oxygen species in cancer stem cells. Fam. Cancer 2015, 14, 19–23. [Google Scholar] [CrossRef] [PubMed]
  62. Wu, Z.; Zuo, M.; Zeng, L.; Cui, K.; Liu, B.; Yan, C.; Chen, L.; Dong, J.; Shangguan, F.; Hu, W.; et al. OMA1 reprograms metabolism under hypoxia to promote colorectal cancer development. EMBO Rep. 2021, 22, e50827. [Google Scholar] [CrossRef] [PubMed]
  63. Marsboom, G.; Toth, P.T.; Ryan, J.J.; Hong, Z.; Wu, X.; Fang, Y.H.; Thenappan, T.; Piao, L.; Zhang, H.J.; Pogoriler, J.; et al. Dynamin-related protein 1-mediated mitochondrial mitotic fission permits hyperproliferation of vascular smooth muscle cells and offers a novel therapeutic target in pulmonary hypertension. Circ. Res. 2012, 110, 1484–1497. [Google Scholar] [CrossRef]
  64. Elstrom, R.L.; Bauer, D.E.; Buzzai, M.; Karnauskas, R.; Harris, M.H.; Plas, D.R.; Zhuang, H.; Cinalli, R.M.; Alavi, A.; Rudin, C.M.; et al. Akt stimulates aerobic glycolysis in cancer cells. Cancer Res. 2004, 64, 3892–3899. [Google Scholar] [CrossRef]
  65. Mauro, C.; Leow, S.C.; Anso, E.; Rocha, S.; Thotakura, A.K.; Tornatore, L.; Moretti, M.; De Smaele, E.; Beg, A.A.; Tergaonkar, V.; et al. NF-κB controls energy homeostasis and metabolic adaptation by upregulating mitochondrial respiration. Nat. Cell Biol. 2011, 13, 1272–1279. [Google Scholar] [CrossRef]
  66. Papandreou, I.; Cairns, R.A.; Fontana, L.; Lim, A.L.; Denko, N.C. HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell Metab. 2006, 3, 187–197. [Google Scholar] [CrossRef] [PubMed]
  67. Chiche, J.; Rouleau, M.; Gounon, P.; Brahimi-Horn, M.C.; Pouysségur, J.; Mazure, N.M. Hypoxic enlarged mitochondria protect cancer cells from apoptotic stimuli. J. Cell. Physiol. 2010, 222, 648–657. [Google Scholar] [CrossRef]
  68. Plecitá-Hlavatá, L.; Engstová, H.; Alán, L.; Špaček, T.; Dlasková, A.; Smolková, K.; Špačková, J.; Tauber, J.; Strádalová, V.; Malínský, J.; et al. Hypoxic HepG2 cell adaptation decreases ATP synthase dimers and ATP production in inflated cristae by mitofilin down-regulation concomitant to MICOS clustering. FASEB J. 2016, 30, 1941–1957. [Google Scholar] [CrossRef] [PubMed]
  69. Westermann, B. Bioenergetic role of mitochondrial fusion and fission. Biochim. Biophys. Acta 2012, 1817, 1833–1838. [Google Scholar] [CrossRef]
  70. Kung-Chun Chiu, D.; Pui-Wah Tse, A.; Law, C.T.; Ming-Jing Xu, I.; Lee, D.; Chen, M.; Kit-Ho Lai, R.; Wai-Hin Yuen, V.; Wing-Sum Cheu, J.; Wai-Hung Ho, D.; et al. Hypoxia regulates the mitochondrial activity of hepatocellular carcinoma cells through HIF/HEY1/PINK1 pathway. Cell Death Dis. 2019, 10, 934. [Google Scholar] [CrossRef]
  71. Gdynia, G.; Sauer, S.W.; Kopitz, J.; Fuchs, D.; Duglova, K.; Ruppert, T.; Miller, M.; Pahl, J.; Cerwenka, A.; Enders, M.; et al. The HMGB1 protein induces a metabolic type of tumour cell death by blocking aerobic respiration. Nat. Commun. 2016, 7, 10764. [Google Scholar] [CrossRef]
  72. Wong, C.C.; Xu, J.; Bian, X.; Wu, J.L.; Kang, W.; Qian, Y.; Li, W.; Chen, H.; Gou, H.; Liu, D.; et al. In Colorectal Cancer Cells with Mutant KRAS, SLC25A22-Mediated Glutaminolysis Reduces DNA Demethylation to Increase WNT Signaling, Stemness, and Drug Resistance. Gastroenterology 2020, 159, 2163–2180.e2166. [Google Scholar] [CrossRef]
  73. Deshmukh, A.; Deshpande, K.; Arfuso, F.; Newsholme, P.; Dharmarajan, A. Cancer stem cell metabolism: A potential target for cancer therapy. Mol. Cancer 2016, 15, 69. [Google Scholar] [CrossRef] [PubMed]
  74. Kao, T.W.; Chuang, Y.C.; Lee, H.L.; Kuo, C.C.; Shen, Y.A. Therapeutic Targeting of Glutaminolysis as a Novel Strategy to Combat Cancer Stem Cells. Int. J. Mol. Sci. 2022, 23, 15296. [Google Scholar] [CrossRef] [PubMed]
  75. Koo, J.H.; Guan, K.L. Interplay between YAP/TAZ and Metabolism. Cell Metab. 2018, 28, 196–206. [Google Scholar] [CrossRef] [PubMed]
  76. Mori, T.; Ohmori, H.; Luo, Y.; Mori, S.; Miyagawa, Y.; Nukaga, S.; Goto, K.; Fujiwara-Tani, R.; Kishi, S.; Sasaki, T.; et al. Giving combined medium-chain fatty acids and glucose protects against cancer-associated skeletal muscle atrophy. Cancer Sci. 2019, 110, 3391–3399. [Google Scholar] [CrossRef] [PubMed]
  77. Nukaga, S.; Mori, T.; Miyagawa, Y.; Fujiwara-Tani, R.; Sasaki, T.; Fujii, K.; Mori, S.; Goto, K.; Kishi, S.; Nakashima, C.; et al. Combined administration of lauric acid and glucose improved cancer-derived cardiac atrophy in a mouse cachexia model. Cancer Sci. 2020, 111, 4605–4615. [Google Scholar] [CrossRef] [PubMed]
  78. Tham, Y.Y.; Choo, Q.C.; Muhammad, T.S.T.; Chew, C.H. Lauric acid alleviates insulin resistance by improving mitochondrial biogenesis in THP-1 macrophages. Mol. Biol. Rep. 2020, 47, 9595–9607. [Google Scholar] [CrossRef]
  79. Smith, A.L.M.; Whitehall, J.C.; Greaves, L.C. Mitochondrial DNA mutations in ageing and cancer. Mol. Oncol. 2022, 16, 3276–3294. [Google Scholar] [CrossRef] [PubMed]
  80. Taylor, R.W.; Turnbull, D.M. Mitochondrial DNA mutations in human disease. Nat. Rev. Genet. 2005, 6, 389–402. [Google Scholar] [CrossRef]
  81. Czarnecka, A.M.; Kukwa, W.; Krawczyk, T.; Scinska, A.; Kukwa, A.; Cappello, F. Mitochondrial DNA mutations in cancer--from bench to bedside. Front. Biosci. 2010, 15, 437–460. [Google Scholar] [CrossRef]
  82. Kopinski, P.K.; Singh, L.N.; Zhang, S.; Lott, M.T.; Wallace, D.C. Mitochondrial DNA variation and cancer. Nat. Rev. Cancer 2021, 21, 431–445. [Google Scholar] [CrossRef] [PubMed]
  83. Luo, Y.; Ma, J.; Lu, W. The Significance of Mitochondrial Dysfunction in Cancer. Int. J. Mol. Sci. 2020, 21, 5598. [Google Scholar] [CrossRef]
  84. Wallace, D.C. Mitochondria and cancer. Nat. Rev. Cancer 2012, 12, 685–698. [Google Scholar] [CrossRef] [PubMed]
  85. Kim, M.; Mahmood, M.; Reznik, E.; Gammage, P.A. Mitochondrial DNA is a major source of driver mutations in cancer. Trends Cancer 2022, 8, 1046–1059. [Google Scholar] [CrossRef]
  86. Artusi, M.; Nicoli, S.; Colombo, P.; Bettini, R.; Sacchi, A.; Santi, P. Effect of chemical enhancers and iontophoresis on thiocolchicoside permeation across rabbit and human skin in vitro. J. Pharm. Sci. 2004, 93, 2431–2438. [Google Scholar] [CrossRef]
  87. Jiang, J.; Li, H.; Qaed, E.; Zhang, J.; Song, Y.; Wu, R.; Bu, X.; Wang, Q.; Tang, Z. Salinomycin, as an autophagy modulator—A new avenue to anticancer: A review. J. Exp. Clin. Cancer Res. 2018, 37, 26. [Google Scholar] [CrossRef] [PubMed]
  88. Tan, T.; Li, J.; Luo, R.; Wang, R.; Yin, L.; Liu, M.; Zeng, Y.; Zeng, Z.; Xie, T. Recent Advances in Understanding the Mechanisms of Elemene in Reversing Drug Resistance in Tumor Cells: A Review. Molecules 2021, 26, 5792. [Google Scholar] [CrossRef] [PubMed]
  89. Wu, X.Y.; Xu, W.W.; Huan, X.K.; Wu, G.N.; Li, G.; Zhou, Y.H.; Najafi, M. Mechanisms of cancer cell killing by metformin: A review on different cell death pathways. Mol. Cell. Biochem. 2023, 478, 197–214. [Google Scholar] [CrossRef] [PubMed]
  90. Sirtori, C.R.; Castiglione, S.; Pavanello, C. Metformin: From diabetes to cancer to prolongation of life. Pharmacol. Res. 2024, 208, 107367. [Google Scholar] [CrossRef] [PubMed]
  91. Mori, S.; Fujiwara-Tani, R.; Gyoten, M.; Nukaga, S.; Sasaki, R.; Ikemoto, A.; Ogata, R.; Kishi, S.; Fujii, K.; Kuniyasu, H. Berberine Induces Combined Cell Death in Gastrointestinal Cell Lines. Int. J. Mol. Sci. 2023, 24, 6588. [Google Scholar] [CrossRef]
  92. Hojo, Y.; Kishi, S.; Mori, S.; Fujiwara-Tani, R.; Sasaki, T.; Fujii, K.; Nishiguchi, Y.; Nakashima, C.; Luo, Y.; Shinohara, H.; et al. Sunitinib and Pterostilbene Combination Treatment Exerts Antitumor Effects in Gastric Cancer via Suppression of PDZD8. Int. J. Mol. Sci. 2022, 23, 4002. [Google Scholar] [CrossRef] [PubMed]
  93. Mori, S.; Kishi, S.; Honoki, K.; Fujiwara-Tani, R.; Moriguchi, T.; Sasaki, T.; Fujii, K.; Tsukamoto, S.; Fujii, H.; Kido, A.; et al. Anti-Stem Cell Property of Pterostilbene in Gastrointestinal Cancer Cells. Int. J. Mol. Sci. 2020, 21, 9347. [Google Scholar] [CrossRef] [PubMed]
  94. Nishiguch, Y.; Fujiwara-Tani, R.; Nukaga, S.; Nishida, R.; Ikemoto, A.; Sasaki, R.; Mori, S.; Ogata, R.; Kishi, S.; Hojo, Y.; et al. Pterostilbene Induces Apoptosis from Endoplasmic Reticulum Stress Synergistically with Anticancer Drugs That Deposit Iron in Mitochondria. Int. J. Mol. Sci. 2024, 25, 2611. [Google Scholar] [CrossRef]
  95. Kuniyasu, H.; Oue, N.; Wakikawa, A.; Shigeishi, H.; Matsutani, N.; Kuraoka, K.; Ito, R.; Yokozaki, H.; Yasui, W. Expression of receptors for advanced glycation end-products (RAGE) is closely associated with the invasive and metastatic activity of gastric cancer. J. Pathol. 2002, 196, 163–170. [Google Scholar] [CrossRef] [PubMed]
Ijms 26 00664 g001
Figure 1. Differences in proliferation, differentiation, and energy metabolism between two CRC cell lines. HT29 and CT26 cells were cultured in a regular medium. (A) Cell growth. (B) Protein levels during colonocyte-associated differentiation. (C) Mitochondrial stress test results. (D) OXPHOS parameters. (E) Glycolytic stress test results, including the maximum ECAR. (F) Energy metabolism phenotypes. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; ALP, alkaline phosphatase; MUC2, mucin 2; OCR, oxygen consumption rate; ECAR, extracellular acidification rate; Max, maximum; OXPHOS, oxidative phosphorylation; ANOVA, analysis of variance.
Figure 1. Differences in proliferation, differentiation, and energy metabolism between two CRC cell lines. HT29 and CT26 cells were cultured in a regular medium. (A) Cell growth. (B) Protein levels during colonocyte-associated differentiation. (C) Mitochondrial stress test results. (D) OXPHOS parameters. (E) Glycolytic stress test results, including the maximum ECAR. (F) Energy metabolism phenotypes. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; ALP, alkaline phosphatase; MUC2, mucin 2; OCR, oxygen consumption rate; ECAR, extracellular acidification rate; Max, maximum; OXPHOS, oxidative phosphorylation; ANOVA, analysis of variance.
Ijms 26 00664 g001
Ijms 26 00664 g002
Figure 2. Differences in oxidative stress between two CRC cell lines. HT29 and CT26 cells were cultured in a regular medium. (A) Assessment of MtVol with mitogen. (B) MMP assessed using TMRE. (C) H2O2 levels assessed using DHR123. (D) MtSOX. (E) 4HNE. Scale bar: 50 μm. Right panel: semi-quantification of fluorescence images. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; MtVol, mitochondrial volume; MMP, mitochondrial membrane potential; TMRE, tetramethylrhodamine ethyl ester; DHR123, dihydrorhodamine 123; mtSOX, mitochondrial superoxide; 4HNE, 4-hydroxynonenal; ANOVA, analysis of variance.
Figure 2. Differences in oxidative stress between two CRC cell lines. HT29 and CT26 cells were cultured in a regular medium. (A) Assessment of MtVol with mitogen. (B) MMP assessed using TMRE. (C) H2O2 levels assessed using DHR123. (D) MtSOX. (E) 4HNE. Scale bar: 50 μm. Right panel: semi-quantification of fluorescence images. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; MtVol, mitochondrial volume; MMP, mitochondrial membrane potential; TMRE, tetramethylrhodamine ethyl ester; DHR123, dihydrorhodamine 123; mtSOX, mitochondrial superoxide; 4HNE, 4-hydroxynonenal; ANOVA, analysis of variance.
Ijms 26 00664 g002
Ijms 26 00664 g003
Figure 3. Differences in stemness between two CRC cell lines. HT29 and CT26 cells were cultured in a regular medium. (A) Expression of stemness marker genes LGR5 and NS. Right panel: semi-quantification of RT-PCR signals. (B) Sensitivity to 5FU. (C) Expression of naïve/prime transition-associated genes KLF4, PRODH, LIN28a, and DNMT3B. Right panel: semi-quantification of RT-PCR signals. (D) Sphere areas. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; LGR5, leucine-rich repeat-containing G-protein coupled receptor 5; NS, nucleostemin; ACTB, β-actin; RT-PCR, reverse transcription polymerase chain reaction; 5FU, 5-fluorouracil; KLF4, Krüppel-like factor 4; PRODH, proline dehydrogenase; DNMT3B, DNA methyltransferase 3B.
Figure 3. Differences in stemness between two CRC cell lines. HT29 and CT26 cells were cultured in a regular medium. (A) Expression of stemness marker genes LGR5 and NS. Right panel: semi-quantification of RT-PCR signals. (B) Sensitivity to 5FU. (C) Expression of naïve/prime transition-associated genes KLF4, PRODH, LIN28a, and DNMT3B. Right panel: semi-quantification of RT-PCR signals. (D) Sphere areas. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; LGR5, leucine-rich repeat-containing G-protein coupled receptor 5; NS, nucleostemin; ACTB, β-actin; RT-PCR, reverse transcription polymerase chain reaction; 5FU, 5-fluorouracil; KLF4, Krüppel-like factor 4; PRODH, proline dehydrogenase; DNMT3B, DNA methyltransferase 3B.
Ijms 26 00664 g003
Ijms 26 00664 g004
Figure 4. Characterization of 5FU-resistant cell lines derived from two CRC cell lines. The HT29R and CT26R cell lines resistant to 5FU were established from HT29 and CT26 cells, respectively, by continuous treatment with low-dose 5FU (IC5) for 50 passages. (A) 5FU sensitivity, indicated by IC50. (B) Cell growth in regular medium. (C) Expression of 5FU-resistance-related genes TS, DPD, MTHFR, and TYMP. (D–F) OXPOHS parameters: basal OCR (D), maximum OCR (E), and ATP (F). (G) Max ECAR. (H) Energy metabolism phenotype. (I) MtVol assessed using MitoGreen. (J) MMP assessed using TMRE. (K) Mitochondrial H2O2 levels were assessed using DHR123. (L) MtSOX. (M) 4HNE. (N–P) HT29R and CT26R treated with 5FU (5 μg/mL for 48 h). H2O2 (N), mtSOX (O), 4HNE (P). Error bars: standard deviation of three independent trials Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; 5FU, 5-fluorouracil; IC, inhibitory concentration; TS, thymidylate synthase; DPD, dihydropyrimidine dehydrogenase; MTHFR, methylenetetrahydrofolate reductase; TYMP, thymidine phosphorylase; OXPHOS, oxidative phosphorylation; OCR, oxygen consumption rate; ECAR, extracellular acidification rate; MtVol, mitochondrial volume; MMP, mitochondrial membrane potential; TMRE, tetramethylrhodamine ethyl ester; DHR123, dihydrorhodamine 123; mtSOX, mitochondrial superoxide; 4HNE, 4-hydroxynonenal; ANOVA, analysis of variance.
Figure 4. Characterization of 5FU-resistant cell lines derived from two CRC cell lines. The HT29R and CT26R cell lines resistant to 5FU were established from HT29 and CT26 cells, respectively, by continuous treatment with low-dose 5FU (IC5) for 50 passages. (A) 5FU sensitivity, indicated by IC50. (B) Cell growth in regular medium. (C) Expression of 5FU-resistance-related genes TS, DPD, MTHFR, and TYMP. (D–F) OXPOHS parameters: basal OCR (D), maximum OCR (E), and ATP (F). (G) Max ECAR. (H) Energy metabolism phenotype. (I) MtVol assessed using MitoGreen. (J) MMP assessed using TMRE. (K) Mitochondrial H2O2 levels were assessed using DHR123. (L) MtSOX. (M) 4HNE. (N–P) HT29R and CT26R treated with 5FU (5 μg/mL for 48 h). H2O2 (N), mtSOX (O), 4HNE (P). Error bars: standard deviation of three independent trials Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; 5FU, 5-fluorouracil; IC, inhibitory concentration; TS, thymidylate synthase; DPD, dihydropyrimidine dehydrogenase; MTHFR, methylenetetrahydrofolate reductase; TYMP, thymidine phosphorylase; OXPHOS, oxidative phosphorylation; OCR, oxygen consumption rate; ECAR, extracellular acidification rate; MtVol, mitochondrial volume; MMP, mitochondrial membrane potential; TMRE, tetramethylrhodamine ethyl ester; DHR123, dihydrorhodamine 123; mtSOX, mitochondrial superoxide; 4HNE, 4-hydroxynonenal; ANOVA, analysis of variance.
Ijms 26 00664 g004
Ijms 26 00664 g005
Figure 5. Stemness of 5FU-resistant cell lines derived from two CRC cell lines. 5FU-resistant HT29R and CT26R cell lines were established from HT29 and CT26 cells, respectively, by continuous treatment with low-dose 5FU (IC5) for 50 passages. (A) Apoptosis. (B) 5FU (5 μg/mL for 48 h). (C) Mitophagy. Scale bar: 50 μm. Right panel: semi-quantification of fluorescence images. (D) Expression of stemness-associated genes HIF1α and ME1. Right panel: semi-quantification of RT-PCR signals. (E) Sphere areas. (F) Expression of the naïve/prime transition-associated genes PRODH and LIN28a. Right panel: semi-quantification of RT-PCR signals. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; 5FU, 5-fluorouracil; ACTB, β-actin; RT-PCR, reverse transcription polymerase chain reaction; PRODH, proline dehydrogenase; HIF1A, hypoxia-inducible 1α; ME1, cytosolic NADPH dehydrogenase 1 (malic enzyme 1); ANOVA, analysis of variance.
Figure 5. Stemness of 5FU-resistant cell lines derived from two CRC cell lines. 5FU-resistant HT29R and CT26R cell lines were established from HT29 and CT26 cells, respectively, by continuous treatment with low-dose 5FU (IC5) for 50 passages. (A) Apoptosis. (B) 5FU (5 μg/mL for 48 h). (C) Mitophagy. Scale bar: 50 μm. Right panel: semi-quantification of fluorescence images. (D) Expression of stemness-associated genes HIF1α and ME1. Right panel: semi-quantification of RT-PCR signals. (E) Sphere areas. (F) Expression of the naïve/prime transition-associated genes PRODH and LIN28a. Right panel: semi-quantification of RT-PCR signals. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; 5FU, 5-fluorouracil; ACTB, β-actin; RT-PCR, reverse transcription polymerase chain reaction; PRODH, proline dehydrogenase; HIF1A, hypoxia-inducible 1α; ME1, cytosolic NADPH dehydrogenase 1 (malic enzyme 1); ANOVA, analysis of variance.
Ijms 26 00664 g005
Ijms 26 00664 g006
Figure 6. Effect of lauric acid (LAA) on stemness in 5FU-resistant CRC cell lines. The 5FU-resistant cell lines HT29R and CT26R were treated with 5FU (10 μg/mL) with or without LAA (40 μg/mL) for 40 h. (A) Cell growth. (B) 4HNE. (C) Apoptosis. (D) ATP. (E) Lactate levels in the culture medium. (F,G) Protein levels of HIF1α (F) and ME1 (G). (H) Sphere areas. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; 5FU, 5-fluorouracil; LAA, lauric acid; 4HNE, 4-hydroxynonenal; HIF1α, hypoxia inducible 1α; ME1, cytosolic NADPH dehydrogenase 1 (malic enzyme 1); ANOVA, analysis of variance.
Figure 6. Effect of lauric acid (LAA) on stemness in 5FU-resistant CRC cell lines. The 5FU-resistant cell lines HT29R and CT26R were treated with 5FU (10 μg/mL) with or without LAA (40 μg/mL) for 40 h. (A) Cell growth. (B) 4HNE. (C) Apoptosis. (D) ATP. (E) Lactate levels in the culture medium. (F,G) Protein levels of HIF1α (F) and ME1 (G). (H) Sphere areas. Error bars: standard deviation of three independent trials. Asterisk, p < 0.05. Statistical differences were calculated using ordinary ANOVA with Bonferroni correction. CRC, colorectal cancer; 5FU, 5-fluorouracil; LAA, lauric acid; 4HNE, 4-hydroxynonenal; HIF1α, hypoxia inducible 1α; ME1, cytosolic NADPH dehydrogenase 1 (malic enzyme 1); ANOVA, analysis of variance.
Ijms 26 00664 g006
Table 1. RT-PCR primers and ELISA kits.
Table 1. RT-PCR primers and ELISA kits.
RT-PCR Primers
GeneSpeciesIDLeftRight
ActbMouseNM_007393.5AGCCATGTACGTAGCCATCCCTCTCAGCTGTGGTGGTGAA
ACTBHumanNM_001101.3GGACTTCGAGCAAGAGATGGAGCACTGTGTTGGCGTACAG
Lgr5MouseNM_010195.2CATTCACTTTTGGCCGTTTTAGGGCCAACAGGACACATAG
LGR5HumanAF061444.1CTCTTCCTCAAACCGTCTGCGATCGGAGGCTAAGCAACTG
Klf4MouseNM_010637.3CTGAACAGCAGGGACTGTCAGTGTGGGTGGCTGTTCTTTT
KLF4HumanKJ901962.1CCCACACAGGTGAGAAACCTCCCACACAGGTGAGAAACCT
NsMouseBC037996.1ATGTGGGGAAAAGCAGTGTCTGGGGGAGTTACAAGGTGAG
NSHumanBC001024.2ATTGCCAACAGTGGTGTTCAAATGGCTTTGCTGCAAGTTT
Lin28aMouseNM_145833.1GTGTCCAACCAGCAGTTTGCCTCTTCCTCTTCCTCCCGGA
LIN28AHumanNM_024674.6CGTGTCCAACCAGCAGTTTGTGGCTTTCCCTGTGCACTAG
ProdhMouseAF120279.1AAGCAGTATCAGGTGCACCCCCTCCTCAGTGAACCGTGAC
PRODHHumanAF120278.1GGTAGAGTCAGCGATGACGGTGTGTTGAAGATGAGCGGCT
Dnmt3bMouseBC105677.1TGTGGGGAAAGATCAAGGGCCGTTCTCGGCTCTCCTCATC
DNMT3BHumanAF331857.1TTCTCCGAGGTCTCTGCAGACTGCCACAAGACAAACAGCC
Hif1aMouseAF003695.1TGCTTGCCAAAAGAGGTGGACAGAAGGACTTGCTGGCTGA
HIF1AHumanAF208487.1GAAAGCGCAAGTCCTCAAAGTGGGTAGGAGATGGAGATGC
Me1MouseNM_008615.2GGAGTTGCTGCAATTGGTGGTGCAGGCCACGGATAACAAT
ME1HumanNM_002395.5GGATTGCACACCTGATTGTGTCTTCATGTTCATGGGCAAA
TsMouseNM_021288.4TTCAAGAAGGAGGACCGCACCACGCCCAGACCCATATCTC
TSHumanNM_001071.4CTGGGGCAGATCCAACACATCTGGCGATGTTGAAAGGCAC
DpdMouseNM_170778.3GTATGGCCCTGGACAAAGCTGCAGTTCCTGACACTCCTCC
DPDHumanNM_000110.4GTATGGCCCTGGACAAAGCTGCAATGGAGGTCACAGCTCT
MthfrMouseNM_001161798.1CAGCTGGGCACTGTTATCCAGCTTCCCAGTGGTCACCTAC
MTHFRHumanNM_001330358.2TCTACCGTACCCAGGAGTGGGTGGGCTGGATGATCTCTCG
TympMouseNM_138302.3CTGGAGGTGGAAGAAGCGTTGGGAGGACAAGTTCAGCGAA
TYMPHumanBC018160.1CAAGGTGCCAATGATCAGCGCAGGTCCCTTAAGTCTGGCG
ELISA
TargetSpeciesCat#Company
AlpMouseab285274Abcam, Waltham, MA, USA
ALPHumanab285149Abcam, Waltham, MA, USA
Muc2MouseM0EB0548AssayGenie, Dublin, Ireland
MUC2Humanab282871Abcam, Waltham, MA, USA
4HNE-ab287803Abcam, Waltham, MA, USA
Lactate-ab65331Abcam, Waltham, MA, USA
ATP-ab83355Abcam, Waltham, MA, USA
Hif1αMouse#88-8022-88Thermo Fisher, Tokyo, Japan
HIF1αHuman#A43658Thermo Fisher, Tokyo, Japan
Me1MouseE1556MoBioassay Technology Laboratory, Shanghai, China
ME1HumanABIN6231269Antibodies-online.com, Limerick, PA, USA
RT-PCR, reverse transcription polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; ACTB, β-actin; LGR5, leucine-rich repeat-containing G-protein coupled receptor 5; KLF4, Krüppel-like factor 4; NS, nucleostemin; PRODH, proline dehydrogenase; 4HNE, 4-hyrdoxynonenal; Dnmt3b, DNA methyl transferase 3B; HIF1A, hypoxia-inducible factor 1-alpha; ME1, cytosolic NADPH dehydrogenase 1 (malic enzyme 1); ALP, alkaline phosphatase; MUC2, mucin 2; ATP, adenine triphosphate; TS, thymidylate synthase; DPD, dihydropyrimidine dehydrogenase; MTHFR, methylenetetrahydrofolate reductase; TYMP, thymidine phosphorylase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fujiwara-Tani, R.; Luo, Y.; Ogata, R.; Fujii, K.; Sasaki, T.; Sasaki, R.; Nishiguchi, Y.; Mori, S.; Ohmori, H.; Kuniyasu, H. Energy Metabolism and Stemness and the Role of Lauric Acid in Reversing 5-Fluorouracil Resistance in Colorectal Cancer Cells. Int. J. Mol. Sci. 2025, 26, 664. https://doi.org/10.3390/ijms26020664

AMA Style

Fujiwara-Tani R, Luo Y, Ogata R, Fujii K, Sasaki T, Sasaki R, Nishiguchi Y, Mori S, Ohmori H, Kuniyasu H. Energy Metabolism and Stemness and the Role of Lauric Acid in Reversing 5-Fluorouracil Resistance in Colorectal Cancer Cells. International Journal of Molecular Sciences. 2025; 26(2):664. https://doi.org/10.3390/ijms26020664

Chicago/Turabian Style

Fujiwara-Tani, Rina, Yi Luo, Ruiko Ogata, Kiyomu Fujii, Takamitsu Sasaki, Rika Sasaki, Yukiko Nishiguchi, Shiori Mori, Hitoshi Ohmori, and Hiroki Kuniyasu. 2025. "Energy Metabolism and Stemness and the Role of Lauric Acid in Reversing 5-Fluorouracil Resistance in Colorectal Cancer Cells" International Journal of Molecular Sciences 26, no. 2: 664. https://doi.org/10.3390/ijms26020664

APA Style

Fujiwara-Tani, R., Luo, Y., Ogata, R., Fujii, K., Sasaki, T., Sasaki, R., Nishiguchi, Y., Mori, S., Ohmori, H., & Kuniyasu, H. (2025). Energy Metabolism and Stemness and the Role of Lauric Acid in Reversing 5-Fluorouracil Resistance in Colorectal Cancer Cells. International Journal of Molecular Sciences, 26(2), 664. https://doi.org/10.3390/ijms26020664

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop