Effect of 3-HBI on Liver Fibrosis via the TGF-β/SMAD2/3 Pathway on the Human Hepatic Stellate Cell Model
Abstract
1. Introduction
2. Results
2.1. The Effect of 3-HBI on LX-2 Cell Viability
2.2. The Effects of 3-HBI on Expression of Liver Fibrotic Markers
2.3. 3-HBI Suppresses Fibrotic Markers and Inhibits HSC Activation by Blocking SMAD Signaling Pathway at the Gene Expression Level
2.4. 3-HBI Inhibits the Fibrotic Marker Protein via the SMAD2/3 Pathway
2.5. In Silico Molecular Docking Analysis of Candidate Target Proteins
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Enzyme-Linked Immunosorbent Assay (ELISA)
4.3. Real-Time Quantitative Reverse Transcription (qRT-PCR)
4.4. Molecular Docking
4.5. Western Blot Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Berumen, J.; Baglieri, J.; Kisseleva, T.; Mekeel, K. Liver fibrosis: Pathophysiology and clinical implications. WIREs Mech. Dis. 2021, 13, 1499. [Google Scholar] [CrossRef] [PubMed]
- Lee, U.E.; Friedman, S.L. Mechanisms of hepatic fibrogenesis. Best Pract. Res. Clin. Gastroenterol. 2011, 25, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Campana, L.; Esser, H.; Huch, M.; Forbes, S. Liver regeneration and inflammation: From fundamental science to clinical applications. Nat. Rev. Mol. Cell Biol. 2021, 22, 608–624. [Google Scholar] [CrossRef] [PubMed]
- Tsuchida, T.; Friedman, S.L. Mechanisms of hepatic stellate cell activation. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 397–411. [Google Scholar] [CrossRef]
- Tie, Y.; Tang, F.; Peng, D.; Zhang, Y.; Shi, H. TGF-beta signal transduction: Biology, function and therapy for diseases. Mol. Biomed. 2022, 3, 45. [Google Scholar] [CrossRef]
- Luetragoon, T.; Pankla Sranujit, R.; Noysang, C.; Thongsri, Y.; Potup, P.; Suphrom, N.; Nuengchamnong, N.; Usuwanthim, K. Bioactive Compounds in Moringa oleifera Lam. Leaves Inhibit the Pro-Inflammatory Mediators in Lipopolysaccharide-Induced Human Monocyte-Derived Macrophages. Molecules 2020, 25, 191. [Google Scholar] [CrossRef]
- Chaudhary, A.; Venkatramanan, V.; Kumar Mishra, A.; Sharma, S. Agronomic and Environmental Determinants of Direct Seeded Rice in South Asia. Circ. Econ. Sustain. 2023, 3, 253–290. [Google Scholar] [CrossRef]
- Kato-Noguchi, H.; Seki, T.; Shigemori, H. Allelopathy and allelopathic substance in the moss Rhynchostegium pallidifolium. J. Plant Physiol. 2010, 167, 468–471. [Google Scholar] [CrossRef]
- Luetragoon, T.; Daowtak, K.; Thongsri, Y.; Potup, P.; Calder, P.C.; Usuwanthim, K. Anti-Inflammatory Potential of 3-Hydroxy-β-Ionone from Moringa oleifera: Decreased Transendothelial Migration of Monocytes Through an Inflamed Human Endothelial Cell Monolayer by Inhibiting the IκB-α/NF-κB Signaling Pathway. Molecules 2024, 29, 5873. [Google Scholar] [CrossRef]
- Luetragoon, T.; Pankla Sranujit, R.; Noysang, C.; Thongsri, Y.; Potup, P.; Suphrom, N.; Nuengchamnong, N.; Usuwanthim, K. Anti-Cancer Effect of 3-Hydroxy-β-Ionone Identified from Moringa oleifera Lam. Leaf on Human Squamous Cell Carcinoma 15 Cell Line. Molecules 2020, 25, 3563. [Google Scholar] [CrossRef]
- de Moura Espíndola, R.; Mazzantini, R.P.; Ong, T.P.; de Conti, A.; Heidor, R.; Moreno, F.S. Geranylgeraniol and β-ionone inhibit hepatic preneoplastic lesions, cell proliferation, total plasma cholesterol and DNA damage during the initial phases of hepatocarcinogenesis, but only the former inhibits NF-κB activation. Carcinogenesis 2005, 26, 1091–1099. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.M.; Kim, Y.S.; Jang, W.J.; Rakib, A.M.; Oh, T.W.; Kim, B.H.; Kim, S.Y.; Kim, J.O.; Ha, Y.L. Anti-proliferative Effects of β-ionone on Human Lung Cancer A-549 Cells. J. Life Sci. 2013, 23, 1351–1359. [Google Scholar] [CrossRef]
- U.S. Food and Drug Administration. FDA Approves First Treatment for Patients with Liver Scarring Due to Fatty Liver Disease. Available online: https://www.fda.gov/news-events/press-announcements/fda-approves-first-treatment-patients-liver-scarring-due-fatty-liver-disease (accessed on 28 April 2025).
- Liu, Q.; Bengmark, S.; Qu, S. The role of hepatic fat accumulation in pathogenesis of non-alcoholic fatty liver disease (NAFLD). Lipids Health Dis. 2010, 9, 42. [Google Scholar] [CrossRef]
- Ahmad, R.; Ahmad, A. Understanding the mechanism of hepatic fibrosis and potential therapeutic approaches. Saudi J. Gastroenterol. 2012, 18, 155–167. [Google Scholar] [CrossRef]
- Buakaew, W.; Krobthong, S.; Yingchutrakul, Y.; Khamto, N.; Sutana, P.; Potup, P.; Thongsri, Y.; Daowtak, K.; Ferrante, A.; Léon, C.; et al. In Vitro Investigation of the Anti-Fibrotic Effects of 1-Phenyl-2-Pentanol, Identified from Moringa oleifera Lam., on Hepatic Stellate Cells. Int. J. Mol. Sci. 2024, 25, 8995. [Google Scholar] [CrossRef]
- Buakaew, W.; Krobthong, S.; Yingchutrakul, Y.; Potup, P.; Thongsri, Y.; Daowtak, K.; Ferrante, A.; Usuwanthim, K. Investigating the Antifibrotic Effects of β-Citronellol on a TGF-β1-Stimulated LX-2 Hepatic Stellate Cell Model. Biomolecules 2024, 14, 800. [Google Scholar] [CrossRef]
- Peng, Y.; Li, L.; Zhang, X.; Xie, M.; Yang, C.; Tu, S.; Shen, H.; Hu, G.; Tao, L.; Yang, H. Fluorofenidone affects hepatic stellate cell activation in hepatic fibrosis by targeting the TGF-β1/Smad and MAPK signaling pathways. Exp. Ther. Med. 2019, 18, 41–48. [Google Scholar] [CrossRef]
- Khongpiroon, C.; Buakaew, W.; Brindley, P.J.; Potikanond, S.; Daowtak, K.; Thongsri, Y.; Potup, P.; Usuwanthim, K. Anti-Fibrotic Effect of Oleamide Identified from the Moringa oleifera Lam. Leaves via Inhibition of TGF-β1-Induced SMAD2/3 Signaling Pathway. Int. J. Mol. Sci. 2025, 26, 3388. [Google Scholar] [CrossRef]
- Phaosri, M.; Jantrapirom, S.; Na Takuathung, M.; Soonthornchareonnon, N.; Sireeratawong, S.; Buacheen, P.; Pitchakarn, P.; Nimlamool, W.; Potikanond, S. Salacia chinensis L. Stem Extract Exerts Antifibrotic Effects on Human Hepatic Stellate Cells through the Inhibition of the TGF-β1-Induced SMAD2/3 Signaling Pathway. Int. J. Mol. Sci. 2019, 20, 6314. [Google Scholar] [CrossRef]
- Lu, Z.-N.; Niu, W.-X.; Zhang, N.; Ge, M.-X.; Bao, Y.-Y.; Ren, Y.; Guo, X.-L.; He, H.-W. Pantoprazole ameliorates liver fibrosis and suppresses hepatic stellate cell activation in bile duct ligation rats by promoting YAP degradation. Acta Pharmacol. Sin. 2021, 42, 1808–1820. [Google Scholar] [CrossRef]
- Song, Z.; Liu, X.; Zhang, W.; Luo, Y.; Xiao, H.; Liu, Y.; Dai, G.; Hong, J.; Li, A. Ruxolitinib suppresses liver fibrosis progression and accelerates fibrosis reversal via selectively targeting Janus kinase 1/2. J. Transl. Med. 2022, 20, 157. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.J.; Li, H.; Du, Y.J.; Pei, F.H.; Hu, Y.; Zhao, L.L.; Chen, J. Vatalanib, a tyrosine kinase inhibitor, decreases hepatic fibrosis and sinusoidal capillarization in CCl4-induced fibrotic mice. Mol. Med. Rep. 2017, 15, 2604–2610. [Google Scholar] [CrossRef] [PubMed]
- Berman, H.M.; Westbrook, J.; Feng, Z.; Gilliland, G.; Bhat, T.N.; Weissig, H.; Shindyalov, I.N.; Bourne, P.E. The Protein Data Bank. Nucleic Acids Res. 2000, 28, 235–242. [Google Scholar] [CrossRef] [PubMed]
- Berman, H.; Henrick, K.; Nakamura, H. Announcing the worldwide Protein Data Bank. Nat. Struct. Mol. Biol. 2003, 10, 980. [Google Scholar] [CrossRef]
- Varadi, M.; Anyango, S.; Deshpande, M.; Nair, S.; Natassia, C.; Yordanova, G.; Yuan, D.; Stroe, O.; Wood, G.; Laydon, A.; et al. AlphaFold Protein Structure Database: Massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 2022, 50, 439–444. [Google Scholar] [CrossRef]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef]
- Kim, S.; Chen, J.; Cheng, T.; Gindulyte, A.; He, J.; He, S.; Li, Q.; Shoemaker, B.A.; Thiessen, P.A.; Yu, B.; et al. PubChem 2023 update. Nucleic Acids Res. 2023, 51, 1373–1380. [Google Scholar] [CrossRef]
- Grosdidier, A.; Zoete, V.; Michielin, O. SwissDock, a protein-small molecule docking web service based on EADock DSS. Nucleic Acids Res. 2011, 39, 270–277. [Google Scholar] [CrossRef]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef]








| PDB ID | Protein Name | Binding Free Energy (kcal/mol) | Interacting Amino Acid |
|---|---|---|---|
| 1DD1 | Mothers against decapentaplegic homolog 4 | −5.47 | ARG502, GLN410, GLN516, TRP509, VAL426 |
| 6YIB | Mothers against decapentaplegic homolog 3 | −4.92 | ALA352, LEU220, LEU351, TRP405, VAL223, VAL355, VAL409 |
| 6YIA | Mothers against decapentaplegic homolog 2 | −4.69 | ASP304, CYS312, HSD291, PHE290, PHE311 |
| 5E8X | Transforming growth factor beta (TGF-β) receptor type 1 | −4.57 | HSD43, ILE85, LEU87, VAL34, VAL41 |
| 5E8V | Transforming growth factor beta (TGF-β) receptor type 2 | −3.01 | ASN40, GLN41, LYS42, PHE11, PHE126 |
| Genes | Description | Forward Primer (3′ → 5′) | Reverse Primer (3′ → 5′) |
|---|---|---|---|
| ACTA2 | Actin alpha 2, smooth muscle | CATCCTCATCCTCCCTTGAG | ATGAAGGATGGCTGGAACAG |
| COL1A1 | Collagen type I alpha 1 chain | CCGGCTCCTGCTCCTCTTAGCG | CGTTCTGTACGCAGGTGATTGGTGG |
| COL4A1 | Collagen type IV alpha 1 chain | CCTGGCTTGAAAAACAGCTC | CCCTGCTGAGGTCTGTGAAC |
| TIMP1 | TIMP metallopeptidase inhibitor 1 | CAAGATGTATAAAGGGTTCCAAGC | TCCATCCTGCAGTTTTCCAG′ |
| MMP2 | Matrix metallopeptidase 2 | AAGTATGGCTTCTGCCCTGA | ATTTGTTGCCCAGGAAAGTG |
| MMP9 | Matrix metallopeptidase 9 | CGAACTTTGACAGCGACAAG | CACTGAGGAATGATCTAAGCCC |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | ATGACATCAAGAAGGTGGTG | CATACCAGGAAATGAGCTTG′ |
| SMAD2 | SMAD family member 2 | TGCTCTGAAATTTGGGGACTGA | GACGACCATCAAGAGACCTGG |
| SMAD3 | SMAD family member 3 | ATCGTGAAGCGCCTGCTG | CATCCAGGGACCTGGGGA |
| SMAD4 | SMAD family member 4 | GCCCGAGCCCAGGTTATC | ACAATGCTCAGACAGGCATCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khongpiroon, C.; Buakaew, W.; Brindley, P.J.; Potikanond, S.; Daowtak, K.; Thongsri, Y.; Potup, P.; Usuwanthim, K. Effect of 3-HBI on Liver Fibrosis via the TGF-β/SMAD2/3 Pathway on the Human Hepatic Stellate Cell Model. Int. J. Mol. Sci. 2025, 26, 6022. https://doi.org/10.3390/ijms26136022
Khongpiroon C, Buakaew W, Brindley PJ, Potikanond S, Daowtak K, Thongsri Y, Potup P, Usuwanthim K. Effect of 3-HBI on Liver Fibrosis via the TGF-β/SMAD2/3 Pathway on the Human Hepatic Stellate Cell Model. International Journal of Molecular Sciences. 2025; 26(13):6022. https://doi.org/10.3390/ijms26136022
Chicago/Turabian StyleKhongpiroon, Chavisa, Watunyoo Buakaew, Paul J. Brindley, Saranyapin Potikanond, Krai Daowtak, Yordhathai Thongsri, Pachuenp Potup, and Kanchana Usuwanthim. 2025. "Effect of 3-HBI on Liver Fibrosis via the TGF-β/SMAD2/3 Pathway on the Human Hepatic Stellate Cell Model" International Journal of Molecular Sciences 26, no. 13: 6022. https://doi.org/10.3390/ijms26136022
APA StyleKhongpiroon, C., Buakaew, W., Brindley, P. J., Potikanond, S., Daowtak, K., Thongsri, Y., Potup, P., & Usuwanthim, K. (2025). Effect of 3-HBI on Liver Fibrosis via the TGF-β/SMAD2/3 Pathway on the Human Hepatic Stellate Cell Model. International Journal of Molecular Sciences, 26(13), 6022. https://doi.org/10.3390/ijms26136022

