Goose Deoxycholic Acid Ameliorates Liver Injury in Laying Hens with Fatty Liver Hemorrhage Syndrome by Inhibiting the Inflammatory Response
Abstract
1. Introduction
2. Results
2.1. CDCA Ameliorates Effects of Liver Injury
2.2. CDCA Inhibits Macrophage M1-Type Polarization-Mediated Pro-Inflammatory Responses
2.3. CDCA Promotes Macrophage M2-Type Polarization–Mediated Anti-Inflammatory Responses
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Histopathological Analysis
4.3. Determination of Serum Biochemical Indices
4.4. Detection of Inflammatory Factors in Liver Tissue
4.5. Real-Time Polymerase Chain Reaction (PCR) Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wolford, J.H.; Polin, D. Study on fatty liver-hemorrhagic syndrome (FLHS). Poult. Sci. 1972, 51, 1707–1713. [Google Scholar] [CrossRef] [PubMed]
- Day, C.P.; James, O.F. Steatohepatitis: A tale of two “hits”. Gastroenterology 1998, 114, 842–845. [Google Scholar] [CrossRef] [PubMed]
- Mao, N.; Yu, Y.; Lu, X.; Yang, Y.; Liu, Z.; Wang, D. Preventive effects of matrine on LPS-induced inflammation in RAW 264.7 cells and intestinal damage in mice through the TLR4/NF-κB/MAPK pathway. Int. Immunopharmacol. 2024, 143, 113432. [Google Scholar] [CrossRef]
- Li, M.; Tan, J.; Zhang, R.; Gong, X.; Xie, J.; Liu, C.; Wu, C.; Li, X. Sunitinib alleviates hepatic ischemia reperfusion injury by inhibiting the JAK2/STAT pathway and promoting the M2 polarization of macrophages. Immunopharmacol. Immunotoxicol. 2024, 46, 672–684. [Google Scholar] [CrossRef]
- Comeglio, P.; Morelli, A.; Adorini, L.; Maggi, M.; Vignozzi, L. Beneficial effects of bile acid receptor agonists in pulmonary disease models. Expert Opin. Investig. Drugs 2017, 26, 1215–1228. [Google Scholar] [CrossRef]
- Oleszycka, E.; O’Brien, E.C.; Freeley, M.; Lavelle, E.C.; Long, A. Bile acids induce IL-1α and drive NLRP3 inflammasome-independent production of IL-1β in murine dendritic cells. Front. Immunol. 2023, 14, 1285357. [Google Scholar] [CrossRef]
- Keitel, V.; Häussinger, D. Role of TGR5 (GPBAR1) in Liver Disease. Semin. Liver Dis. 2018, 38, 333–339. [Google Scholar] [CrossRef]
- Ji, C.G.; Xie, X.L.; Yin, J.; Qi, W.; Chen, L.; Bai, Y.; Wang, N.; Zhao, D.Q.; Jiang, X.Y.; Jiang, H.Q. Bile acid receptor TGR5 overexpression is associated with decreased intestinal mucosal injury and epithelial cell proliferation in obstructive jaundice. Transl. Res. 2017, 182, 88–102. [Google Scholar] [CrossRef]
- Miao, Y.F.; Gao, X.N.; Xu, D.N.; Li, M.C.; Gao, Z.S.; Tang, Z.H.; Mhlambi, N.H.; Wang, W.J.; Fan, W.T.; Shi, X.Z.; et al. Protective effect of the new prepared Atractylodes macrocephala Koidz polysaccharide on fatty liver hemorrhagic syndrome in laying hens. Poult. Sci. 2021, 100, 938–948. [Google Scholar] [CrossRef]
- Wei, F.; Yang, X.; Zhang, M.; Xu, C.; Hu, Y.; Liu, D. Akkermansia muciniphila Enhances Egg Quality and the Lipid Profile of Egg Yolk by Improving Lipid Metabolism. Front. Microbiol. 2022, 13, 927245. [Google Scholar] [CrossRef]
- Shini, A.; Shini, S.; Bryden, W.L. Fatty liver hemorrhagic syndrome occurrence in laying hens: Impact of production system. Avian Pathol. 2019, 48, 25–34. [Google Scholar] [CrossRef]
- Meng, J.; Ma, N.; Liu, H.; Liu, J.; Liu, J.; Wang, J.; He, X.; Zhao, X. Untargeted and targeted metabolomics profiling reveals the underlying pathogenesis and abnormal arachidonic acid metabolism in laying hens with fatty liver hemorrhagic syndrome. Poult. Sci. 2021, 100, 101320. [Google Scholar] [CrossRef] [PubMed]
- Wang, A.; Zhang, K.; Fu, C.; Zhou, C.; Yan, Z.; Liu, X. Alleviation effect of conjugated linoleic acid on estradiol benzoate induced fatty liver hemorrhage syndrome in Hy-line male chickens. J. Anim. Sci. 2023, 101, skad045. [Google Scholar] [CrossRef] [PubMed]
- Yadav, K.K.; Boley, P.A.; Khatiwada, S.; Lee, C.M.; Bhandari, M.; Kenney, S.P. Development of fatty liver disease model using high cholesterol and low choline diet in white leghorn chickens. Vet. Res. Commun. 2024, 48, 2489–2497. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Zhang, X.; You, M.; Shen, Y.; Zhang, S.; Li, J.; He, X.; Zhao, X.; Ma, N. Quantitative lipidomics reveals the changes of lipids and antioxidant capacity in egg yolk from laying hens with fatty liver hemorrhagic syndrome. Poult. Sci. 2024, 103, 103785. [Google Scholar] [CrossRef]
- Yang, X.; Li, D.; Zhang, M.; Feng, Y.; Jin, X.; Liu, D.; Guo, Y.; Hu, Y. Ginkgo biloba extract alleviates fatty liver hemorrhagic syndrome in laying hens via reshaping gut microbiota. J. Anim. Sci. Biotechnol. 2023, 14, 97. [Google Scholar] [CrossRef]
- Cui, Z.; Jin, N.; Amevor, F.K.; Shu, G.; Du, X.; Kang, X.; Ning, Z.; Deng, X.; Tian, Y.; Zhu, Q.; et al. Dietary supplementation of salidroside alleviates liver lipid metabolism disorder and inflammatory response to promote hepatocyte regeneration via PI3K/AKT/Gsk3-β pathway. Poult. Sci. 2022, 101, 102034. [Google Scholar] [CrossRef]
- Banerjee, T.; Sarkar, A.; Ali, S.Z.; Bhowmik, R.; Karmakar, S.; Halder, A.K.; Ghosh, N. Bioprotective Role of Phytocompounds Against the Pathogenesis of Non-alcoholic Fatty Liver Disease to Non-alcoholic Steatohepatitis: Unravelling Underlying Molecular Mechanisms. Planta Med. 2024, 90, 675–707. [Google Scholar] [CrossRef]
- Lu, H.; Ban, Z.; Xiao, K.; Sun, M.; Liu, Y.; Chen, F.; Shi, T.; Chen, L.; Shao, D.; Zhang, M.; et al. Hepatic-Accumulated Obeticholic Acid and Atorvastatin Self-Assembled Nanocrystals Potentiate Ameliorative Effects in Treatment of Metabolic-Associated Fatty Liver Disease. Adv. Sci. 2024, 11, e2308866. [Google Scholar] [CrossRef]
- Lu, Q.; Zhu, Y.; Wang, C.; Zhang, R.; Miao, Y.; Chai, Y.; Jiang, Z.; Yu, Q. Obeticholic acid protects against lithocholic acid-induced exogenous cell apoptosis during cholestatic liver injury. Life Sci. 2024, 337, 122355. [Google Scholar] [CrossRef]
- Fu, J.; Zhang, P.; Sun, Z.; Lu, G.; Cao, Q.; Chen, Y.; Wu, W.; Zhang, J.; Zhuang, C.; Sheng, C.; et al. A combined nanotherapeutic approach targeting farnesoid X receptor, ferroptosis, and fibrosis for nonalcoholic steatohepatitis treatment. Acta Pharm. Sin. B 2024, 14, 2228–2246. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Li, Y.; Tang, R.; Yang, P.; Zhuo, Y.; Jiang, X.; Che, L.; Lin, Y.; Xu, S.; Li, J.; et al. Bile acids metabolism in the gut-liver axis mediates liver injury during lactation. Life Sci. 2024, 338, 122380. [Google Scholar] [CrossRef] [PubMed]
- Aljarboa, A.S.; Alhusaini, A.M.; Sarawi, W.S.; Mohammed, R.; Ali, R.A.; Hasan, I.H. The implication of LPS/TLR4 and FXR receptors in hepatoprotective efficacy of indole-3-acetic acid and chenodeoxycholic acid. Life Sci. 2023, 334, 122182. [Google Scholar] [CrossRef]
- Hsu, C.C.; Cheng, K.C.; Li, Y.; Hsu, P.H.; Cheng, J.T.; Niu, H.S. TGR5 Expression Is Associated with Changes in the Heart and Urinary Bladder of Rats with Metabolic Syndrome. Life 2021, 11, 695. [Google Scholar] [CrossRef]
- Zhang, B.; Yang, Y.; Yi, J.; Zhao, Z.; Ye, R. Hyperglycemia modulates M1/M2 macrophage polarization via reactive oxygen species overproduction in ligature-induced periodontitis. J. Periodontal. Res. 2021, 56, 991–1005. [Google Scholar] [CrossRef]
- Sun, S.; Yao, Y.; Huang, C.; Xu, H.; Zhao, Y.; Wang, Y.; Zhu, Y.; Miao, Y.; Feng, X.; Gao, X.; et al. CD36 regulates LPS-induced acute lung injury by promoting macrophages M1 polarization. Cell. Immunol. 2022, 372, 104475. [Google Scholar] [CrossRef]
- Shihabudeen, M.S.; Roy, D.; James, J.; Thirumurugan, K. Chenodeoxycholic acid, an endogenous FXR ligand alters adipokines and reverses insulin resistance. Mol. Cell. Endocrinol. 2015, 414, 19–28. [Google Scholar] [CrossRef]
- Brenøe, J.E.; van Hoorn, E.G.M.; Beck, L.; Bulthuis, M.; Bezemer, R.E.; Gordijn, S.J.; Schoots, M.H.; Prins, J.R. Altered placental macrophage numbers and subsets in pregnancies complicated with intrahepatic cholestasis of pregnancy (ICP) compared to healthy pregnancies. Placenta 2024, 153, 22–30. [Google Scholar] [CrossRef]
- Zhuang, L.; Jia, N.; Zhang, L.; Zhang, Q.; Antwi, S.O.; Sartorius, K.; Wu, K.; Sun, D.; Xi, D.; Lu, Y. Gpbar-1/cAMP/PKA signaling mitigates macrophage-mediated acute cholestatic liver injury via antagonizing NLRP3-ASC inflammasome. Biochim. Biophys. Acta Mol. Basis Dis. 2024, 1870, 167266. [Google Scholar] [CrossRef]
- Kayagaki, N.; Stowe, I.B.; Lee, B.L.; O’Rourke, K.; Anderson, K.; Warming, S.; Cuellar, T.; Haley, B.; Roose-Girma, M.; Phung, Q.T.; et al. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling. Nature 2015, 526, 666–671. [Google Scholar] [CrossRef]
- Zangerolamo, L.; Solon, C.; Soares, G.M.; Engel, D.F.; Velloso, L.A.; Boschero, A.C.; Carneiro, E.M.; Barbosa, H.C.L. Energy homeostasis deregulation is attenuated by TUDCA treatment in streptozotocin-induced Alzheimer’s disease mice model. Sci. Rep. 2021, 11, 18114. [Google Scholar] [CrossRef] [PubMed]
- Attia, Y.M.; Tawfiq, R.A.; Gibriel, A.A.; Ali, A.A.; Kassem, D.H.; Hammam, O.A.; Elmazar, M.M. Activation of FXR modulates SOCS3/Jak2/STAT3 signaling axis in a NASH-dependent hepatocellular carcinoma animal model. Biochem. Pharmacol. 2021, 186, 114497. [Google Scholar] [CrossRef] [PubMed]
- Renga, B.; Migliorati, M.; Mencarelli, A.; Fiorucci, S. Reciprocal regulation of the bile acid-activated receptor FXR and the interferon-gamma-STAT-1 pathway in macrophages. Biochim. Biophys. Acta 2009, 1792, 564–573. [Google Scholar] [CrossRef] [PubMed]
- Meng, C.; Liu, Y.; Ming, Y.; Lu, C.; Li, Y.; Zhang, Y.; Su, D.; Gao, X.; Yuan, Q. Enhancing Liver Delivery of Gold Nanoclusters via Human Serum Albumin Encapsulation for Autoimmune Hepatitis Alleviation. Pharmaceutics 2024, 16, 110. [Google Scholar] [CrossRef]
- Ciesielska, A.; Matyjek, M.; Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell. Mol. Life Sci. 2021, 78, 1233–1261. [Google Scholar] [CrossRef]
- Funes, S.C.; Rios, M.; Escobar-Vera, J.; Kalergis, A.M. Implications of macrophage polarization in autoimmunity. Immunology 2018, 154, 186–195. [Google Scholar] [CrossRef]
- Wang, L.; Yang, J.W.; Lin, L.T.; Huang, J.; Wang, X.R.; Su, X.T.; Cao, Y.; Fisher, M.; Liu, C.Z. Acupuncture Attenuates Inflammation in Microglia of Vascular Dementia Rats by Inhibiting miR-93-Mediated TLR4/MyD88/NF-κB Signaling Pathway. Oxid. Med. Cell. Longev. 2020, 2020, 8253904. [Google Scholar] [CrossRef]
- Li, W.; Feng, G.; Gauthier, J.M.; Lokshina, I.; Higashikubo, R.; Evans, S.; Liu, X.; Hassan, A.; Tanaka, S.; Cicka, M.; et al. Ferroptotic cell death and TLR4/Trif signaling initiate neutrophil recruitment after heart transplantation. J. Clin. Investig. 2019, 129, 2293–2304. [Google Scholar] [CrossRef]
- Saikh, K.U. MyD88 and beyond: A perspective on MyD88-targeted therapeutic approach for modulation of host immunity. Immunol. Res. 2021, 69, 117–128. [Google Scholar] [CrossRef]
- Milivojac, T.; Grabež, M.; Krivokuća, A.; Maličević, U.; Gajić Bojić, M.; Đukanović, Đ.; Uletilović, S.; Mandić-Kovačević, N.; Cvjetković, T.; Barudžija, M.; et al. Ursodeoxycholic and chenodeoxycholic bile acids attenuate systemic and liver inflammation induced by lipopolysaccharide in rats. Mol. Cell. Biochem. 2024; Online ahead of print. [Google Scholar] [CrossRef]
- Dai, J.; Wang, H.; Dong, Y.; Zhang, Y.; Wang, J. Bile acids affect the growth of human cholangiocarcinoma via NF-kB pathway. Cancer Investig. 2013, 31, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.; Li, L.; Pang, J.; Heng, C.; Wei, C.; Wang, X.; Xia, Z.; Huang, X.; Zhang, L.; Jiang, Z. Modulating intestinal barrier function by sphingosine-1-phosphate receptor 1 specific agonist SEW2871 attenuated ANIT-induced cholestatic hepatitis via the gut-liver axis. Int. Immunopharmacol. 2023, 125, 111150. [Google Scholar] [CrossRef] [PubMed]
- Mobraten, K.; Haugbro, T.; Karlstrom, E.; Kleiveland, C.R.; Lea, T. Activation of the bile acid receptor TGR5 enhances LPS-induced inflammatory responses in a human monocytic cell line. J. Recept. Signal Transduct. Res. 2015, 35, 402–409. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, H.; Liu, X.; Xue, S.; Chen, D.; Zou, J.; Jiang, H. TGR5 deficiency activates antitumor immunity in non-small cell lung cancer via restraining M2 macrophage polarization. Acta Pharm. Sin. B 2022, 12, 787–800. [Google Scholar] [CrossRef]
- Gong, Z.; Zhou, J.; Zhao, S.; Tian, C.; Wang, P.; Xu, C.; Chen, Y.; Cai, W.; Wu, J. Chenodeoxycholic acid activates NLRP3 inflammasome and contributes to cholestatic liver fibrosis. Oncotarget 2016, 7, 83951–83963. [Google Scholar] [CrossRef]
- Li, H.; Zhu, X.; Xu, J.; Li, L.; Kan, W.; Bao, H.; Xu, J.; Wang, W.; Yang, Y.; Chen, P.; et al. The FXR mediated anti-depression effect of CDCA underpinned its therapeutic potentiation for MDD. Int. Immunopharmacol. 2023, 115, 109626. [Google Scholar] [CrossRef]
- Lai, Y.S., Jr.; Nguyen, H.T.; Salmanida, F.P.; Chang, K.T. MERTK+/hi M2c Macrophages Induced by Baicalin Alleviate Non-Alcoholic Fatty Liver Disease. Int. J. Mol. Sci. 2021, 22, 10604. [Google Scholar] [CrossRef]
- Chen, X.; Tang, J.; Shuai, W.; Meng, J.; Feng, J.; Han, Z. Macrophage polarization and its role in the pathogenesis of acute lung injury/acute respiratory distress syndrome. Inflamm. Res. 2020, 69, 883–895. [Google Scholar] [CrossRef]
- Grander, C.; Meyer, M.; Steinacher, D.; Claudel, T.; Hausmann, B.; Pjevac, P.; Grabherr, F.; Oberhuber, G.; Grander, M.; Brigo, N.; et al. 24-Norursodeoxycholic acid ameliorates experimental alcohol-related liver disease and activates hepatic PPARγ. JHEP Rep. 2023, 5, 100872. [Google Scholar] [CrossRef]
- Du, J.; Xiang, X.; Li, Y.; Ji, R.; Xu, H.; Mai, K.; Ai, Q. Molecular cloning and characterization of farnesoid X receptor from large yellow croaker (Larimichthys crocea) and the effect of dietary CDCA on the expression of inflammatory genes in intestine and spleen. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2018, 216, 10–17. [Google Scholar] [CrossRef]
- Shao, J.; Ge, T.; Tang, C.; Wang, G.; Pang, L.; Chen, Z. Synergistic anti-inflammatory effect of gut microbiota and lithocholic acid on liver fibrosis. Inflamm. Res. 2022, 71, 1389–1401. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wei, Y.; Jia, W.; Can, C.; Wang, R.; Yang, X.; Gu, C.; Liu, F.; Ji, C.; Ma, D. Chenodeoxycholic acid suppresses AML progression through promoting lipid peroxidation via ROS/p38 MAPK/DGAT1 pathway and inhibiting M2 macrophage polarization. Redox Biol. 2022, 56, 102452. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.J.; Wang, S.H.; Wu, C.C.; Su, Y.A.; Chiang, C.Y.; Lai, C.H.; Wang, T.H.; Cheng, T.L.; Kuo, J.Y.; Hsu, T.C.; et al. IL-4 and IL-13 Promote Proliferation of Mammary Epithelial Cells through STAT6 and IRS-1. Int. J. Mol. Sci. 2021, 22, 12008. [Google Scholar] [CrossRef] [PubMed]
- Gong, T.; Yan, R.; Kang, J.; Chen, R. Chemical Components of Ganoderma. Adv. Exp. Med. Biol. 2019, 1181, 59–106. [Google Scholar] [CrossRef]
- Nelms, K.; Keegan, A.D.; Zamorano, J.; Ryan, J.J.; Paul, W.E. The IL-4 receptor: Signaling mechanisms and biologic functions. Annu. Rev. Immunol. 1999, 17, 701–738. [Google Scholar] [CrossRef]
- Arnold, C.E.; Whyte, C.S.; Gordon, P.; Barker, R.N.; Rees, A.J.; Wilson, H.M. A critical role for suppressor of cytokine signalling 3 in promoting M1 macrophage activation and function in vitro and in vivo. Immunology 2014, 141, 96–110. [Google Scholar] [CrossRef]
- Chen, X.; Yan, L.; Guo, Z.; Chen, Y.; Li, M.; Huang, C.; Chen, Z.; Meng, X. Chenodeoxycholic acid attenuates high-fat diet-induced obesity and hyperglycemia via the G protein-coupled bile acid receptor 1 and proliferator-activated receptor γ pathway. Exp. Ther. Med. 2017, 4, 5305–5312. [Google Scholar] [CrossRef][Green Version]
- Lv, L.; Chen, Z.; Bai, W.; Hao, J.; Heng, Z.; Meng, C.; Wang, L.; Luo, X.; Wang, X.; Cao, Y.; et al. Taurohyodeoxycholic acid alleviates trinitrobenzene sulfonic acid induced ulcerative colitis via regulating Th1/Th2 and Th17/Treg cells balance. Life Sci. 2023, 318, 121501. [Google Scholar] [CrossRef]
- Chen, Y.S.; Liu, H.M.; Lee, T.Y. Ursodeoxycholic Acid Regulates Hepatic Energy Homeostasis and White Adipose Tissue Macrophages Polarization in Leptin-Deficiency Obese Mice. Cells 2019, 8, 253. [Google Scholar] [CrossRef]











| Groups | n Values | Treatments |
|---|---|---|
| Normal group (C) | n = 36 | Corn-soya-meal–based feed |
| FLHS model group (M) | n = 36 | High-energy, low-protein feed |
| CDCA low-dose group (CDCA L) | n = 36 | High-energy, low-protein feed + 0.01% CDCA |
| CDCA medium-dose group (CDCA M) | n = 36 | High-energy, low-protein feed + 0.02% CDCA |
| CDCA high-dose group (CDCA H) | n = 36 | High-energy, low-protein feed + 0.03% CDCA |
| C+ CDCA (CC) | n = 36 | Corn-soya-meal–based feed + 0.02% CDCA |
| Gene | Primer Sequences | ID | |
|---|---|---|---|
| iNOS | F: ATCTACAGGTATTGATGCTCGT | R: TTCTGGATCTTGGCCGTTTG | 35671 |
| JAK2 | F: CTGGCTTCTACGTTCTTCGT | R: GGAGGTTTGATTTATCTTTTGG | 374199 |
| STAT1 | F: TACTTATGACCCTGACCCTATC | R: TTTCCTGAATCCTTTGACTG | 424044 |
| IRF5 | F: ATCCAAGTGTTCAGCCTCCA | R: CTCCACCAGAGCATCCTTCA | 430409 |
| TLR4 | F: GGAGGTTGTAGATTTGATGAG | R: AGATGGGACATAACATGATTT | 417241 |
| MyD88 | F: GAGTTGGAGCAAACGGAGTT | R: TTGGTGCAAGGATTGGTGTA | 420420 |
| NF-κB | F: AGGTGGTCCCTAAGTTCCGTG | R: TTTGCCTCTTGGTGCGTTTC | 396093 |
| AP-1 | F: AACTTCGTGCCCACCGTGAC | R: CCGCTGCCATCTTGTTCCTC | 102587711 |
| IRF1 | F: AGCATTGAGGATATCGTGAAG | R: TGGTTGTGGTCTGTGCTGTGT | 396384 |
| NLRP3 | F:AAAGGACGTGAATATGTTGTTA | R: CAAGGCTATTCCTGTGAAACT | 423021 |
| Caspase-1 | F: GCTGCCGTGGAGACAACATA | R: CGTTGGACCTTTCGGAACAT | 395764 |
| Caspase-11 | F: AGTCAGAGCACAGGACGAAG | R: GATGGGAAGAGGAAGAGAG | 395476 |
| CD163 | F: TGGTTCCGCTCATTTTGGTC | R: GGGCAGTTTCAGTTCCTTTAC | 426826 |
| CD206 | F: GCATCAAGCGTATTTAGCAA | R:GAAAGTCCAATCCAAAAGTAT | 9332 |
| ARG | F: TGATCTTGGAGTCATCTGGG | R:GTCCGTCAACATCAAAACTTAG | 46717 |
| IL-4R | F: CAGCATCACCAAGATTAGAA | R: TCCAGAAAACAGGGCAAGAG | 3566 |
| STAT6 | F: CTGGGAGAAGATGTGCGATAC | R: TTGCTGATGAAGCCAATGAT | 100859196 |
| SOCS1 | F: CGATGTCTACTTGACCCTCC | R: CCCCGTCTGAAAGTTTATCC | 416630 |
| PPARy | F: GCAGGAACAGAACAAAGAAG | R: TGCCAGGTCACTGTCATCTA | 100356422 |
| KLF4 | F: CCTTCAACCTGGCGGACATC | R: CTGGCCTCCTGCTTGATTTT | 770254 |
| β-Actin | F: GGAGGGAAATCGTGCGTGACA | R: CGATAGTGACCTGACCGTCA | 396526 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, N.; Li, W.; Ouyang, G.; Li, H.; Yang, J.; Wu, G. Goose Deoxycholic Acid Ameliorates Liver Injury in Laying Hens with Fatty Liver Hemorrhage Syndrome by Inhibiting the Inflammatory Response. Int. J. Mol. Sci. 2025, 26, 429. https://doi.org/10.3390/ijms26010429
Wang N, Li W, Ouyang G, Li H, Yang J, Wu G. Goose Deoxycholic Acid Ameliorates Liver Injury in Laying Hens with Fatty Liver Hemorrhage Syndrome by Inhibiting the Inflammatory Response. International Journal of Molecular Sciences. 2025; 26(1):429. https://doi.org/10.3390/ijms26010429
Chicago/Turabian StyleWang, Nannan, Weiwei Li, Guangyi Ouyang, Hengqi Li, Jiancheng Yang, and Gaofeng Wu. 2025. "Goose Deoxycholic Acid Ameliorates Liver Injury in Laying Hens with Fatty Liver Hemorrhage Syndrome by Inhibiting the Inflammatory Response" International Journal of Molecular Sciences 26, no. 1: 429. https://doi.org/10.3390/ijms26010429
APA StyleWang, N., Li, W., Ouyang, G., Li, H., Yang, J., & Wu, G. (2025). Goose Deoxycholic Acid Ameliorates Liver Injury in Laying Hens with Fatty Liver Hemorrhage Syndrome by Inhibiting the Inflammatory Response. International Journal of Molecular Sciences, 26(1), 429. https://doi.org/10.3390/ijms26010429

