Next Article in Journal
Anti-Tumor Effects of Sheep Umbilical Cord Mesenchymal Stem Cells on Melanoma Cells
Previous Article in Journal
CD8+ and CD8− NK Cells and Immune Checkpoint Networks in Peripheral Blood During Healthy Pregnancy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 1
10.3390/ijms26010425
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Whole-Exome Sequencing: Discovering Genetic Causes of Granulomatous Mastitis

by
Beyza Ozcinar
1,
Zeynep Ocak
2,
Deryanaz Billur
3,4,
Baris Ertugrul
3 and
Ozlem Timirci-Kahraman
3,*
1
Department of General Surgery, Istanbul Medical Faculty, Istanbul University, 34093 Istanbul, Türkiye
2
Department of Medical Genetics, Medical Faculty, Istinye University, 34396 Istanbul, Türkiye
3
Department of Molecular Medicine, Aziz Sancar Institute of Experimental Medicine, Istanbul University, 34093 Istanbul, Türkiye
4
Department of Molecular Medicine, Institute of Graduate Studies in Health Sciences, Istanbul University, 34093 Istanbul, Türkiye
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 425; https://doi.org/10.3390/ijms26010425
Submission received: 23 November 2024 / Revised: 3 January 2025 / Accepted: 4 January 2025 / Published: 6 January 2025
(This article belongs to the Section Molecular Genetics and Genomics)
Versions Notes

Abstract

Granulomatous mastitis (GM) is a rare, benign, but chronic and recurrent inflammatory breast disease that significantly impacts physical and psychological well-being. It often presents symptoms such as pain, swelling, and discharge, leading to diagnostic confusion with malignancy. The etiology of GM remains unclear, though autoimmune and multifactorial components are suspected. This study aimed to explore the genetic underpinnings of GM using whole-exome sequencing (WES) on 22 GM patients and 52 healthy controls to identify single nucleotide variants (SNVs) and copy number variations (CNVs) potentially linked to the disease. WES analysis revealed novel SNVs in six genes: BRCA2 (rs169547), CFTR (rs4727853), NCF1 (rs10614), PTPN22 (rs2476601), HLA-DRB1 (seven variants), and C3 (rs406514). Notably, most of these variants are associated with immune regulation and inflammatory pathways, supporting the hypothesis that GM is an autoimmune disease. However, all identified variants were classified as benign according to the American College of Medical Genetics and Genomics (ACMG) guidelines, necessitating further investigation into their potential functional effects. Despite conducting CNV analysis, no significant variations were identified. This study represents a foundational step in linking genetic predisposition to GM and highlights the need for integrating genetic, clinical, and functional data to better understand GM’s pathophysiology. Future research should focus on larger cohorts, functional studies, and exploring multifactorial contributors to GM, including hormonal and environmental factors.

1. Introduction

Granulomatous mastitis (GM) is a rare, chronic inflammatory breast disease characterized by granuloma and abscess formation. Clinically and radiologically, it can be misdiagnosed as breast cancer, leading to unnecessary anxiety and invasive procedures [1,2]. GM predominantly affects women in their 30s and 40s, particularly those with a history of childbirth and breastfeeding. The disease significantly impacts patients’ quality of life by causing persistent pain, swelling, and psychological distress [3,4].
The etiology of GM remains unclear, with multiple factors proposed [5,6,7,8,9,10]. Autoimmune mechanisms are strongly implicated, as GM often coexists with other autoimmune diseases, such as systemic lupus erythematosus (SLE) and Sjögren’s syndrome. This phenomenon, known as polyautoimmunity, suggests shared immunological pathways among these conditions. In addition, hormonal, environmental, and infectious factors have been hypothesized, indicating a multifactorial nature. For example, retained ductal secretions causing epithelial damage and subsequent immune activation are considered possible triggers. However, the lack of comprehensive studies has hindered definitive conclusions about GM’s pathophysiology [11,12,13,14,15].
Genetic predisposition may play a critical role in GM, particularly through variants in immune-related genes. Previous studies have highlighted the involvement of specific HLA alleles in autoimmune conditions, but their relevance to GM remains underexplored. This study aims to address this gap by identifying single nucleotide variants (SNVs) and copy number variations (CNVs) in GM patients using whole exome sequencing (WES). By analyzing genetic data and their potential clinical significance, we seek to enhance understanding of GM’s molecular mechanisms and contribute to the development of targeted therapies.

2. Results

2.1. Population Characteristics

This study explored the genetic basis of GM by analyzing a cohort of 22 patients diagnosed with GM and 52 healthy controls. Patients were evaluated at Istanbul University Medical Faculty, with detailed clinical, imaging, and biopsy data. Controls were selected based on matching criteria, including age, sex, and ethnicity, to minimize confounding genetic variability. Table 1 summarizes the clinical characteristics of the GM cohort. Imaging findings have been standardized using Breast Imaging Reporting and Data System nomenclature to improve clarity and consistency.

2.2. Next Generation Sequencing Analysis

WES identified 12 SNVs across six genes: BRCA2, CFTR, NCF1, PTPN22, HLA-DRB1, and C3. Seven variants were found in the HLA-DRB1 gene, while the remaining five were distributed among other genes. Table 2 summarizes the detected SNVs, their minor allele frequencies (MAFs), and associated statistical measures.
SNVs were identified in 18/22 GM patients (81.8%) and 10/52 controls (19.2%). Detailed data are provided in Table 2. For example, rs10614 (NCF1) showed an odds ratio (OR) of 4.2 (p = 0.002), suggesting a potential association with GM. However, several variants, such as rs169547 (BRCA2) and rs9270303 (HLA-DRB1), have high MAFs (MAF > 0.5) in the general population.
Deeply looking into our results, we identified the following variants: rs10614 c.295 A > C/A > G/A > T (p.Ser99=) in homozygous patients in the NCF1 gene, rs4727853 c.1251C > A (p.Asn417Lys) in heterozygous patients in the CFTR gene, rs169547 c.7397T > C (p.Val2466Ala) in homozygous patients in the BRCA2 gene, rs2476601 c.1858= (p.Trp620=) in homozygous patients in the PTPN22 gene, and rs406514 c.155-8C > T in homozygous patients in the C3 gene.
Out of the twelve variants, seven were in HLA-DRB1. These were rs9270303, rs2308760, rs3830130, rs707953, rs701829, rs9269958, and rs9270299. Population frequencies varied, with some SNVs being quite common (e.g., rs10614 in NCF1 at 70.9%) and others being less frequent (e.g., rs4727853 in CFTR at 30.7%). Eight SNVs were identified with a MAF greater than 0.5, signifying that the minor allele is present in more than half of the population for these SNVs. These SNVs are rs169547 (BRCA2), rs10614 (NCF1), rs2476601 (PTPN22), rs9270303 (HLA-DRB1), rs3830130 (HLA-DRB1), rs9270299 (HLA-DRB1), rs701829 (HLA-DRB1), and rs406514 (C3). On the other hand, four SNVs, rs4727853 (CFTR), rs2308760 (HLA-DRB1), rs707953 (HLA-DRB1), and rs9269958 (HLA-DRB1), stand out with population frequencies below 0.5 (0.307, 0.384, 0.481, and 0.467, respectively). All twelve SNVs were classified as benign according to the American College of Medical Genetics and Genomics (ACMG) classification [16]. ClinVar information, which provides additional details on variant pathogenicity, was not available for all SNVs. In ClinVar, the CFTR gene is related to cystic fibrosis (CF), the BRCA2 gene is associated with breast cancer and breast-ovarian cancer syndrome, and the C3 gene is associated with complement component 3 deficiency. In Online Mendelian Inheritance in Man (OMIM), the NCF1 gene is associated with chronic granulomatous disease, the CFTR gene is associated with cystic fibrosis and hereditary pancreatitis, the BRCA2 gene is associated with male breast cancer, medulloblastoma, prostate cancer, and pancreatic cancer, the PTPN22 gene is associated with SLE, diabetes mellitus type 1, and rheumatoid arthritis susceptibility, the C3 gene is associated with age-related macular degeneration and C3 deficiency, and the HLA-DRB1 gene is associated with multiple sclerosis and sarcoidosis susceptibility (Table 2).
CNV analysis was performed using ExomeDepth v1.1.16 software. No significant variations were detected. The results suggest that larger datasets may be required to detect subtle CNV effects.

2.3. Sanger Sequencing Verification

To validate the WES findings, Sanger sequencing (SS) was performed on a subset of variants identified in the BRCA2, CFTR, NCF1, PTPN22, and C3 genes. The variants c.7397T > C (p.V2466A) in BRCA2, c.1251C > A (p.N417K) in CFTR, and c.295G > A (p.G99S) in NCF1 were successfully validated by SS. SS traces confirmed that the nucleotide changes were consistent with the WES results, supporting the reliability of these findings. Variants in HLA-DRB1 were not subjected to SS due to resource limitations, highlighting the need for further validation in future studies.

3. Discussion

GM is an uncommon, long-lasting inflammatory breast disease with an unclear cause. While the exact trigger remains a mystery, some evidence suggests it might be related to the body’s immune system attacking healthy breast tissue [8,17]. This study aimed to explore the genetic basis of GM through WES and identified novel SNVs in six key genes: BRCA2, CFTR, NCF1, PTPN22, HLA-DRB1, and C3. These findings provide preliminary evidence supporting the hypothesis that GM may be influenced by genetic predisposition, particularly through immune-related pathways. Both our study and that of Zhu et al. [17] provide valuable insights into the pathophysiology of GM, albeit through different approaches. Our study focused on identifying genetic variations through whole-exome sequencing, revealing novel SNVs in genes primarily involved in immune regulation. This aligns with Zhu et al.’s findings, which demonstrated significant enrichment of differentially expressed mRNAs in immune-related pathways. While our study primarily explored genetic predispositions, Zhu et al. delved into the transcriptional landscape of GM, identifying potential drug targets such as HSD11B1, a gene linked to the efficacy of prednisone, a common GM treatment. Both studies underscore the crucial role of the immune system in GM pathogenesis and highlight the need for further research to elucidate the complex interplay of genetic, transcriptional, and environmental factors contributing to this challenging condition.
Considering all of these research data, it appears that our hypothesis that GM is an autoimmune disease is consistent with the findings. This is supported by the effective steroid treatment of GM, as stated by Zhu et al. [17], and the fact that GM is a disease caused by dysfunctions of the immune system.
Additionally, there are some studies showing the simultaneous appearance of GM with other autoimmune diseases such as SLE and Sjögren’s syndrome [12,13,14]. This simultaneous occurrence of two or more autoimmune diseases in a patient is called polyautoimmunity and is considered a common phenomenon in rheumatic and autoimmune diseases [18,19,20]. The presence of polyautoimmunity in GM patients highlights the importance of shared etiopathogenesis with other autoimmune diseases.
Environmental and hormonal factors are suspected to play a role; the potential contribution of genetics remains unclear [21]. This study aimed to shed light on this by analyzing single nucleotide variants and CNVs in GM patients compared to healthy controls. We identified specific variants in genes linked to autoimmune and inflammatory processes— BRCA2 (rs169547), CFTR (rs4727853), NCF1 (rs10614), PTPN22 (rs2476601), HLA-DRB1 (rs9270303, rs2308760, rs3830130, rs707953, rs701829, rs9269958, rs9270299), and C3 (rs406514). The finding of SNVs in NCF1 [22], CFTR [23], and PTPN22 [24] is particularly interesting due to the established roles in immune function and inflammatory processes. The detection of these SNVs in GM patients suggests a potential link between genetic predisposition to altered immune function and the inflammatory processes characteristic of GM. This study provides preliminary evidence linking these SNVs to GM susceptibility in humans.
We report a novel association of the NCF1 gene variant rs10614 with GM. NCF1 plays a critical role in immune function through the production of reactive oxygen species (ROS) by white blood cells [25,26]. Reduced ROS production due to NCF1 variants is linked to autoimmunity in diseases like SLE [22,27]. While the precise mechanism by which rs10614 contributes to GM requires further investigation, the observed association suggests a potential link between this variant, altered ROS production, and the development of GM. NCF1 is a complex gene region with pseudogenes and variable copy numbers influencing autoimmune risk across ethnicities [28,29]. Further research is needed to understand the functional consequences of rs10614 and how NCF1 variants interact with other genes in GM development [30].
Limited research exists on CFTR variants and GM. We found a novel SNV (rs4727853) in the CFTR gene of GM patients. While the precise role of rs4727853 remains unclear, the established link between CFTR dysfunction and inflammation in cystic fibrosis [31] and autoimmune pancreatitis [32] suggests a potential connection to GM, a disease with possible autoimmune features supported by the presence of T-cells [33,34]. CFTR deficiency in macrophages is known to contribute to an imbalanced Th2-skewed immune response [35], potentially relevant to GM’s inflammatory pathology. Studies of T-cell involvement in GM further support this exploration [33,34]. Further research is crucial to understand how CFTR variants, including rs4727853, might influence immune response and contribute to GM development, especially in patients with steroid-resistant disease [36]. While the hypothesis that rs4727853 and GM are linked is grounded in the known involvement of CFTR in other diseases, this article fails to provide concrete evidence directly connecting CFTR deficiency to GM. To definitively establish whether this variant influences immunological signaling or CFTR protein function in GM patients and to confirm its relevance to the disease, conducting functional studies is essential.
The PTPN22 gene plays a crucial role in regulating immune responses, and variations within this gene have been implicated in the development of various autoimmune diseases [37]. This study investigates a potential association between the rs2476601 (Arg620Trp) variant in PTPN22 and GM. While previous research has linked this variant to other autoimmune disorders, it is important to note that these findings do not necessarily imply the same underlying mechanism in GM. While the rs2476601 variant may disrupt signaling pathways, potentially leading to an inflammatory response as observed in other autoimmune contexts [38], its specific impact on GM pathogenesis requires further investigation. Notably, this variant is predicted to reduce the activity of LYP, a protein crucial for the development and function of regulatory T cells (Tregs), which play a critical role in maintaining immune tolerance [39]. Given the evidence of T cell dysregulation in GM patients [33,34,40,41], we hypothesize that the rs2476601 variant may contribute to the pathogenesis of GM by impairing Treg function through reduced LYP activity. However, it is crucial to acknowledge that the precise mechanisms by which this variant might contribute to GM pathogenesis remain to be elucidated. Our findings provide preliminary evidence for an association between rs2476601 and GM, and further investigations, including functional studies, are necessary to confirm the impact of rs2476601 on Treg cell development and function in the context of GM. Investigating this mechanism could improve our understanding of GM and potentially lead to new treatments.
Our analysis revealed a previously unreported link between a BRCA2 variant, rs169547, and GM susceptibility. BRCA2, a known tumor suppressor gene for breast and ovarian cancers, also plays a role in immune response [42]. The variant (rs169547) may influence immune function and GM risk, although its high frequency suggest it may not be a major disease-causing factor alone [43]. Interestingly, clinical data suggests a link between GM and breast cancer risk [44]. While further research is needed to confirm this association, rs169547 could potentially serve as a marker for increased breast cancer risk in GM patients.
This study uncovered seven novel HLA-DRB1 gene variants associated with GM. The HLA system plays a critical role in immune response, and variations can influence autoimmune diseases [45]. Our findings add to limited research on HLA variants in GM. Previous studies reported associations between specific HLA markers and GM [46] and upregulated HLA-DRB1 proteins in GM tissue [8]. Our study emphasizes the genetic underpinnings of GM by identifying novel HLA-DRB1 variants potentially associated with the disease’s etiology. While we found a vast number of HLA-DRB1 variations (over 8000 SNVs and indels), limited information exists in ClinVar, a key database for variant interpretation. This highlights the need for functional studies to understand how these variants might influence GM susceptibility or progression.
A novel HLA-DRB1 variant (rs9270303) was identified in this study as a potential contributor to GM. Interestingly, this variant has been linked to Alzheimer’s disease [47] and Hepatitis B Virus (HBV)-associated hepatocellular carcinoma (HCC) [48], suggesting a potential broader role beyond GM. Additionally, research suggests population-specific prevalence of rs9270303, with Lithuanians having a higher frequency [49].
This study links rs2308760, a nonsynonymous variant in HLA-DRB1, to GM. While HLA-DRB1 variants have been extensively studied in various autoimmune disorders, this represents one of the first reports associating rs2308760 specifically with GM. This finding contributes to a growing body of evidence supporting the role of HLA-DRB1 in the pathogenesis of GM. While classified as benign, the lack of prior links to GM necessitates further investigation. Functional studies are crucial to understand how this variant might influence protein function and contribute to GM susceptibility.
While our study links the intronic HLA-DRB1 variant rs3830130 to GM, its benign classification and lack of prior associations necessitate functional studies. These studies should investigate potential effects on splicing, regulatory elements, or gene expression in GM-relevant cell types.
Results from this study suggest that the HLA-DRB1 variant (rs707953) may be a potential risk factor for GM. The variant shows population-specific frequencies, with Lithuanians having a higher prevalence [49]. This amino acid change necessitates functional studies to understand its impact on protein function and potential contribution to GM susceptibility. Additionally, investigating variant prevalence in GM across diverse populations could reveal links between genetic background, variant frequency, and disease risk, similar to regional variations observed in GM itself [21,34,50,51,52].
Our analysis identified a novel association between a common nonsynonymous variant (rs701829) in HLA-DRB1 and GM. While the variant is prevalent, its impact on GM is unclear.
A stop-gain variant (rs9269958) within HLA-DRB1 was identified by our study as a novel risk factor for GM. This moderately common variant has also been linked to asthma [53], suggesting a potential shared immune dysfunction pathway. The stop-gain variant likely disrupts antigen presentation, potentially contributing to GM and asthma. However, prior studies in rheumatoid arthritis [54] suggest the variant might be linked to a broader autoimmune susceptibility.
The presence of the rs9270299 genetic variant in GM raises questions about its potential role in the disease. Notably, research by Yu et al. and Brant et al. links HLA genes, particularly HLA-DRB1, to inflammatory bowel disease and HBV-associated HCC, respectively [48,55]. These findings suggest a broader role for HLA-related genes in various inflammatory conditions, potentially including GM.
C3 variant rs406514 association with GM suggests a potential role for C3 in disease pathogenesis. Deangelis et al. linked this variant to neovascular age-related macular degeneration, suggesting potential roles for shared inflammatory pathways influenced by C3 variations [56]. Notably, rs406514 resides near exon 18, a functionally relevant region identified by Lokki et al. warranting further investigation into its functional impact on C3 and its contribution to GM [57].
A substantial proportion of GM patients exhibited SNVs compared to controls. Notably, the rs10614 variant within the NCF1 gene demonstrated a strong association with GM, as indicated by a significant odds ratio. However, several other identified variants, including those within the BRCA2 and HLA-DRB1 genes, displayed high frequencies within the general population. These high frequencies raise concerns regarding their specific involvement in GM pathogenesis. Therefore, further statistical analysis and functional studies are essential to definitively establish the role of these variants in the development of GM.
While all identified variants were classified as benign according to ACMG guidelines, their potential functional roles in GM pathogenesis cannot be entirely disregarded. For instance, the NCF1 variant (rs10614) has been associated with reduced ROS production [22,27], which could impair neutrophil function and contribute to chronic inflammation observed in GM. However, experimental evidence is necessary to confirm the specific impact of this variant on GM pathology. Similarly, dysregulation of CFTR, as observed with the rs4727853 variant, has been linked to altered macrophage activity and immune responses in conditions like cystic fibrosis [31], suggesting a potential role in GM, particularly in steroid-resistant cases. Furthermore, the PTPN22 variant (rs2476601) is known to affect Treg function [39], potentially disrupting immune homeostasis, a mechanism that could contribute to the inflammatory environment observed in GM. These observations highlight the need for further functional studies to elucidate the potential impact of these benign variants on GM pathogenesis and to better understand their contribution to the disease.

4. Materials and Methods

4.1. Patients and Study Approval

This study included 22 female patients diagnosed with idiopathic GM and 52 age- (37.18 ± 7.15 years), sex-, ethnicity-, and breastfeeding history-matched healthy female controls. Patients were recruited from the outpatient clinic of the Department of General Surgery at Istanbul University Medical Faculty. Detailed clinical histories, including any history of rheumatological disease and medication use, were obtained from all participants. Diagnosis of GM was confirmed through imaging (ultrasound, mammography, or MRI), histopathological examination, and exclusion of tuberculosis via chest imaging, PPD testing, and tuberculous quantiferon assays. This study adhered to the Declaration of Helsinki guidelines and was approved by the Institutional Ethics Committee of Istanbul University Faculty of Medicine (approval number: 2018/1515). Informed consent was obtained from all participants prior to sample collection. The project was supported by the Scientific Research Project Coordination Unit of Istanbul University (grant number: 38474).

4.2. Sample Collection

Blood samples were collected from 22 GM patients and 52 controls using Ethylenediaminetetraacetic acid, also called EDTA, tubes and stored at −20 °C. Tissue samples were exclusively used for histopathological examination. Genomic DNA was extracted from blood samples using QIAamp genomic DNA extraction kits (QIAGEN, Hilden, Germany) following the manufacturer’s protocol. DNA quality and quantity were assessed using a NanoDrop™ Lite Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and visualized on a 1% agarose gel with CYBR Safe dye (Thermo Fisher Scientific, Waltham, MA, USA). Extracted DNA was stored at −80 °C until further analysis.

4.3. Whole-Exome Sequencing (WES)

WES was performed on 22 GM patients and 52 controls using Agilent’s SureSelect Human All Exon V6 Kit (Agilent Technologies, Inc., Santa Clara, CA, USA) for library preparation [58]. Sequencing was conducted on an Illumina NovaSeq6000 platform (Illumina, Inc., San Diego, CA, USA) with 150 bp paired-end reads, achieving an average coverage depth of 100×. Quality control measures included read depth analysis (>97% bases covered at 10×) using FastQC v0.12.1 software. Low-quality reads and adapter sequences were removed prior to variant calling.
Variants were annotated and analyzed using databases and in silico tools, including gnomAD [59], ClinVar [60], dbSNP [61], OMIM [62], PolyPhen2 [63], and SIFT [64]. The Human Genome Variation Society nomenclature was applied via the VarSeq transcript annotation algorithm. CNVs were analyzed using ExomeDepth v1.1.16 software.

4.4. Sanger Sequencing (SS)

SS was used to validate selected variants identified through WES in the BRCA2, CFTR, NCF1, PTPN22, and C3 genes. Primers were designed using Primer3Plus v3.3.0 software (Table 3). Polymerase chain reaction products were purified and sequenced on an ABI genetic analyzer using the BigDye Terminator v3.1 Cycle Sequencing kit (Thermo Fisher Scientific, Waltham, MA, USA). Sequence data were analyzed to confirm the nucleotide changes detected by WES, with electropherograms visually inspected for consistency.

4.5. Statistical Analysis of Genetic Variants

The statistical significance of identified SNVs was evaluated using chi-square tests and logistic regression analysis. p-values less than 0.05 were considered statistically significant. ORs and 95% confidence intervals were calculated for each variant to assess their association with GM. CNV analysis was performed using ExomeDepth v1.1.16 software, with a false discovery rate threshold of 5%.

5. Conclusions

This study identified novel SNVs in genes associated with immune regulation and inflammation, including BRCA2, CFTR, NCF1, PTPN22, HLA-DRB1, and C3, in patients with GM. While all identified variants were classified as benign according to ACMG guidelines, these findings suggest a potential genetic predisposition to GM, supporting the hypothesis that GM is an autoimmune disease. However, the association of GM with benign genetic variants highlights the multifactorial nature of the disease. Hormonal, environmental, and infectious factors likely interact with these genetic predispositions, emphasizing the need for further research, integrating genetic, clinical, and environmental data to gain a more comprehensive understanding of GM.
Functional studies are essential to determine how these genetic variations impact protein function and immune pathways. Furthermore, larger and more diverse patient groups are needed to validate these findings and potentially identify additional genetic contributors. The current approach to treating GM, often involving short-term high-dose steroids, may not address the underlying autoimmune nature of the disease and can lead to significant side effects. A longer-term treatment strategy with lower-dose immunosuppressive medications, similar to that used for other autoimmune diseases, may be more appropriate. However, it is important to note that this is a hypothetical approach, and further clinical research and functional evidence are necessary to support its use in GM.
Ultimately, these research efforts could pave the way for personalized treatment strategies that target specific genetic and immunological pathways involved in GM.

Limitations and Future Directions

Despite laying the groundwork for understanding the genetic basis of GM, this study has several limitations that should be acknowledged. The small sample size (22 patients, 52 controls) limits the statistical power of the findings and restricts their generalizability to broader populations. Larger cohorts with more diverse demographics are necessary to confirm the observed associations and explore potential population-specific genetic contributions.
Another limitation is the absence of functional studies to evaluate the impact of the identified SNVs on protein function and immune pathways. While in silico tools provide valuable insights, experimental validation (e.g., gene expression studies, protein function assays) is essential to establish causative links between these variants and GM.
Additionally, while CNV analysis was performed, no significant findings were reported. Further studies with larger datasets may help uncover subtle CNV effects that contribute to GM pathogenesis.
Future research should prioritize the following:
  • Expanding the study population to include diverse ethnicities and larger sample sizes.
  • Conducting functional studies to explore the biological effects of the identified variants.
  • Investigating the interaction between genetic, hormonal, environmental, and infectious factors in GM development.
  • Integrating genetic data with clinical phenotypes to develop personalized treatment strategies.
  • Exploring the therapeutic potential of low-dose immunosuppressive drugs in well-designed clinical trials.
By addressing these limitations, future studies can provide a more comprehensive understanding of GM’s genetic and molecular basis, paving the way for improved diagnostic tools and targeted therapies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26010425/s1.

Author Contributions

Conceptualization, B.O. and O.T.-K.; methodology, B.O. and O.T.-K.; software, O.T.-K.; validation, B.O., Z.O. and O.T.-K.; formal analysis, Z.O. and O.T.-K.; investigation, Z.O., D.B., B.E. and O.T.-K.; resources, B.O.; data curation, Z.O. and O.T.-K.; writing—original draft preparation, B.O., Z.O., D.B., B.E. and O.T.-K.; writing—review and editing, B.O., Z.O., D.B., B.E. and O.T.-K.; visualization, Z.O. and O.T.-K.; supervision, O.T.-K.; project administration, B.O.; funding acquisition, B.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Istanbul University Scientific Research Project Coordination Unit with grant number 38474.

Institutional Review Board Statement

This study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Ethics Committee of Istanbul University Faculty of Medicine (2018/1515, 09/11/2018).

Informed Consent Statement

Informed consent was obtained from all subjects involved in this study.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its Supplementary Information files.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lai, E.C.; Chan, W.C.; Ma, T.K.; Tang, A.P.; Poon, C.S.; Leong, H.T. The role of conservative treatment in idiopathic granulomatous mastitis. Breast J. 2005, 11, 454–456. [Google Scholar] [CrossRef] [PubMed]
  2. Azizi, A.; Prasath, V.; Canner, J.; Gharib, M.; Fattahi, A.S.; Forghani, M.N.; Sajjadi, S.; Farhadi, E.; Vasigh, M.; Kaviani, A.; et al. Idiopathic granulomatous mastitis: Management and predictors of recurrence in 474 patients. Breast J. 2020, 26, 1358–1362. [Google Scholar] [CrossRef] [PubMed]
  3. Steuer, A.B.; Stern, M.J.; Cobos, G.; Castilla, C.; Joseph, K.-A.; Pomeranz, M.K.; Femia, A.N. Clinical Characteristics and Medical Management of Idiopathic Granulomatous Mastitis. JAMA Dermatol. 2020, 156, 460–464. [Google Scholar] [CrossRef] [PubMed]
  4. Bayrak, B.Y.; Cam, I.; Eruyar, A.T.; Utkan, N.Z. Clinicopathological evaluation of idiopathic granulomatous mastitis patients: A retrospective analysis from a tertiary care hospital in Türkiye. Ann. Diagn. Pathol. 2021, 55, 151812. [Google Scholar] [CrossRef]
  5. Benson, J.R.; Dumitru, D. Idiopathic granulomatous mastitis: Presentation, investigation and management. Future Oncol. 2016, 12, 1381–1394. [Google Scholar] [CrossRef]
  6. Destek, S.; Gul, V.O.; Ahioglu, S. A variety of gene polymorphisms associated with idiopathic granulomatous mastitis. J. Surg. Case Rep. 2016, 12, rjw156. [Google Scholar] [CrossRef]
  7. Ling, J.; Xie, X.; Wang, Y.; Huang, W.; Luo, J.; Su, J.; Fan, H.; Wu, S.; Liu, L. Differential expression profiles of miRNA in granulomatous lobular mastitis and identification of possible biomarkers. Exp. Ther. Med. 2022, 24, 500. [Google Scholar] [CrossRef]
  8. Albayrak, M.G.B.; Simsek, T.; Kasap, M.; Akpinar, G.; Canturk, N.Z.; Guler, S.A. Tissue proteome analysis revealed an association between cancer, immune system response, and the idiopathic granulomatous mastitis. Med. Oncol. 2022, 39, 238. [Google Scholar] [CrossRef]
  9. Sarmadian, R.; Safi, F.; Sarmadian, H.; Shokrpour, M.; Almasi-Hashiani, A. Treatment modalities for granulomatous mastitis, seeking the most appropriate treatment with the least recurrence rate: A systematic review and meta-analysis. Eur. J. Med. Res. 2024, 29, 164. [Google Scholar] [CrossRef]
  10. Shojaeian, F.; Haghighat, S.; Abbasvandi, F.; Tehrani, A.H.; Najafi, N.B.N.; Zandi, A.; Olfatbakhsh, A.; Sharifi, M.; Hashemi, E.; Nafissi, N.; et al. Refractory and Recurrent Idiopathic Granulomatous Mastitis Treatment: Adaptive, Randomized Clinical Trial. J. Am. Coll. Surg. 2024, 238, 1153–1165. [Google Scholar] [CrossRef]
  11. Bes, C.; Soy, M.; Vardi, S.; Sengul, N.; Yilmaz, F. Erythema nodosum associated with granulomatous mastitis: Report of two cases. Rheumatol. Int. 2010, 30, 1523–1525. [Google Scholar] [CrossRef] [PubMed]
  12. Letourneux, C.; Diemunsch, P.; Korganow, A.S.; Akladios, C.Y.; Bellocq, J.P.; Mathelin, C. First report of granulomatous mastitis associated with Sjögren’s syndrome. World J. Surg. Oncol. 2013, 11, 268. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, L.N.; Shi, T.Y.; Yang, Y.J.; Zhang, F.C. An SLE patient with prolactinoma and recurrent granulomatous mastitis successfully treated with hydroxychloroquine and bromocriptine. Lupus 2014, 23, 417–420. [Google Scholar] [CrossRef] [PubMed]
  14. Yazigi, G.; Trieu, B.H.; Landis, M.; Parikh, J.G.; Mangal, M. Granulomatous Mastitis: A Rare Case with Sjogren’s Syndrome and Complications. Cureus 2019, 11, e5359. [Google Scholar] [CrossRef]
  15. Velidedeoglu, M.; Papila Kundaktepe, B.; Mete, B.; Ugurlu, S. Idiopathic granulomatous mastitis associated with erythema nodosum may indicate a worse prognosis. Int. J. Rheum. Dis. 2021, 24, 1370–1377. [Google Scholar] [CrossRef]
  16. Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef]
  17. Zhu, Q.; Wang, L.; Wang, P. The Identification of Gene Expression Profiles Associated with Granulomatous Mastitis. Breast Care 2021, 16, 319–327. [Google Scholar] [CrossRef]
  18. Lazarus, M.N.; Isenberg, D.A. Development of additional autoimmune diseases in a population of patients with primary Sjögren’s syndrome. Ann. Rheum. Dis. 2005, 64, 1062–1064. [Google Scholar] [CrossRef]
  19. Chambers, S.A.; Charman, S.C.; Rahman, A.; Isenberg, D.A. Development of additional autoimmune diseases in a multiethnic cohort of patients with systemic lupus erythematosus with reference to damage and mortality. Ann. Rheum. Dis. 2007, 66, 1173–1177. [Google Scholar] [CrossRef]
  20. Matusiewicz, A.; Stróżyńska-Byrska, J.; Olesińska, M. Polyautoimmunity in rheumatological conditions. Int. J. Rheum. Dis. 2019, 22, 386–391. [Google Scholar] [CrossRef]
  21. Wang, X.; He, X.; Liu, J.; Zhang, H.; Wan, H.; Luo, J.; Yang, J. Immune pathogenesis of idiopathic granulomatous mastitis: From etiology toward therapeutic approaches. Front. Immunol. 2024, 15, 1295759. [Google Scholar] [CrossRef] [PubMed]
  22. Meng, Y.; Ma, J.; Yao, C.; Ye, Z.; Ding, H.; Liu, C.; Li, J.; Li, G.; He, Y.; Li, J.; et al. The NCF1 variant p.R90H aggravates autoimmunity by facilitating the activation of plasmacytoid dendritic cells. J. Clin. Investig. 2022, 132, e153619. [Google Scholar] [CrossRef] [PubMed]
  23. Patel, H.; Levine, J.; Weinstein, T. Combination of CFTR gene mutation and autoimmune pancreatitis presenting as necrotizing pancreatitis. Pancreas 2012, 41, 970–971. [Google Scholar] [CrossRef] [PubMed]
  24. Tizaoui, K.; Shin, J.I.; Jeong, G.H.; Yang, J.W.; Park, S.; Kim, J.H.; Hwang, S.Y.; Park, S.J.; Koyanagi, A.; Smith, L. Genetic Polymorphism of PTPN22 in Autoimmune Diseases: A Comprehensive Review. Medicina 2022, 58, 1034. [Google Scholar] [CrossRef]
  25. Sareila, O.; Jaakkola, N.; Olofsson, P.; Kelkka, T.; Holmdahl, R. Identification of a region in p47phox/NCF1 crucial for phagocytic NADPH oxidase (NOX2) activation. J. Leukoc. Biol. 2013, 93, 427–435. [Google Scholar] [CrossRef]
  26. Zhong, J.; Li, Q.; Luo, H.; Holmdahl, R. Neutrophil-derived reactive oxygen species promote tumor colonization. Commun. Biol. 2021, 4, 865. [Google Scholar] [CrossRef]
  27. Luo, H.; Urbonaviciute, V.; Saei, A.A.; Lyu, H.; Gaetani, M.; Végvári, Á.; Li, Y.; Zubarev, R.A.; Holmdahl, R. NCF1-dependent production of ROS protects against lupus by regulating plasmacytoid dendritic cell development and functions. JCI Insight 2023, 8, e164875. [Google Scholar] [CrossRef]
  28. Greve, B.; Hoffmann, P.; Vonthein, R.; Kun, J.; Lell, B.; Mycko, M.P.; Selmaj, K.W.; Berger, K.; Weissert, R.; Kremsner, P.G. NCF1 gene and pseudogene pattern: Association with parasitic infection and autoimmunity. Malar. J. 2008, 7, 251. [Google Scholar] [CrossRef]
  29. Brunson, T.; Wang, Q.; Chambers, I.; Song, Q. A copy number variation in human NCF1 and its pseudogenes. BMC Genet. 2010, 11, 13. [Google Scholar] [CrossRef]
  30. Proust, M. Inside the USCAP Journals. Mod. Pathol. 2017, 30, 472–473. [Google Scholar] [CrossRef]
  31. Parisi, G.F.; Papale, M.; Pecora, G.; Rotolo, N.; Manti, S.; Russo, G.; Leonardi, S. Cystic Fibrosis and Cancer: Unraveling the Complex Role of CFTR Gene in Cancer Susceptibility. Cancers 2023, 15, 4244. [Google Scholar] [CrossRef] [PubMed]
  32. Hegyi, P.; Wilschanski, M.; Muallem, S.; Lukacs, G.L.; Sahin-Tóth, M.; Uc, A.; Gray, M.A.; Rakonczay, Z.; Maléth, J. CFTR: A New Horizon in the Pathomechanism and Treatment of Pancreatitis. Rev. Physiol. Biochem. Pharmacol. 2016, 170, 37–66. [Google Scholar] [CrossRef] [PubMed]
  33. Erhan, Y.; Veral, A.; Kara, E.; Özdemir, N.; Kapkac, M.; Özdedeli, E.; Yilmaz, R.; Koyuncu, A.; Özbal, O. A clinicopthologic study of a rare clinical entity mimicking breast carcinoma: Idiopathic granulomatous mastitis. Breast 2000, 9, 52–56. [Google Scholar] [CrossRef] [PubMed]
  34. Emsen, A.; Köksal, H.; Uçaryılmaz, H.; Kadoglou, N.; Artaç, H. The alteration of lymphocyte subsets in idiopathic granulomatous mastitis. Turk. J. Med. Sci. 2021, 51, 1905–1911. [Google Scholar] [CrossRef]
  35. Polverino, F.; Lu, B.; Quintero, J.R.; Vargas, S.O.; Patel, A.S.; Owen, C.A.; Gerard, N.P.; Gerard, C.; Cernadas, M. CFTR regulates B cell activation and lymphoid follicle development. Respir. Res. 2019, 20, 133. [Google Scholar] [CrossRef]
  36. Chang, M.-C.; Jan, I.-S.; Liang, P.-C.; Jeng, Y.-M.; Yang, C.-Y.; Tien, Y.-W.; Wong, J.-M.; Chang, Y.-T. Cystic fibrosis transmembrane conductance regulator gene variants are associated with autoimmune pancreatitis and slow response to steroid treatment. J. Cyst. Fibros. 2015, 14, 661–667. [Google Scholar] [CrossRef]
  37. Schulz, S.; Zimmer, P.; Pütz, N.; Jurianz, E.; Schaller, H.G.; Reichert, S. rs2476601 in PTPN22 gene in rheumatoid arthritis and periodontitis-a possible interface? J. Transl. Med. 2020, 18, 389. [Google Scholar] [CrossRef]
  38. Ghorban, K.; Ezzeddini, R.; Eslami, M.; Yousefi, B.; Moghaddam, B.S.; Tahoori, M.-T.; Dadmanesh, M.; Farrokhi, A.S. PTPN22 1858 C/T polymorphism is associated with alteration of cytokine profiles as a potential pathogenic mechanism in rheumatoid arthritis. Immunol. Lett. 2019, 216, 106–113. [Google Scholar] [CrossRef]
  39. Fiorillo, E.; Orrú, V.; Stanford, S.M.; Liu, Y.; Salek, M.; Rapini, N.; Schenone, A.D.; Saccucci, P.; Delogu, L.G.; Angelini, F.; et al. Autoimmune-associated PTPN22 R620W variation reduces phosphorylation of lymphoid phosphatase on an inhibitory tyrosine residue. J. Biol. Chem. 2010, 285, 26506–26518. [Google Scholar] [CrossRef]
  40. Ucaryilmaz, H.; Koksal, H.; Emsen, A.; Kadoglou, N.; Dixon, J.M.; Artac, H. The Role of Regulatory T and B Cells in the Etiopathogenesis of Idiopathic Granulomatous Mastitis. Immunol. Investig. 2022, 51, 357–367. [Google Scholar] [CrossRef]
  41. Zheng, B.; Song, J.; Lu, M.; Chen, C.; Sun, S. Current Research Describing the Role of CD4+ T Lymphocyte Subsets in the Pathogenesis of Granulomatous Lobular Mastitis. J. Investig. Surg. 2022, 35, 1790–1795. [Google Scholar] [CrossRef] [PubMed]
  42. O’Donovan, P.J.; Livingston, D.M. BRCA1 and BRCA2: Breast/ovarian cancer susceptibility gene products and participants in DNA double-strand break repair. Carcinogenesis 2010, 31, 961–967. [Google Scholar] [CrossRef] [PubMed]
  43. Sagna, T.; Bonora, E.; Ouedraogo, M.N.L.; Fusco, D.; Zoure, A.A.; Bisseye, C.; Djigma, F.; Kafando, J.G.; Zongo, N.; Douamba, Z.; et al. Identification of BRCA1/2 p.Ser1613Gly, p.Pro871Leu, p.Lys1183Arg, p.Glu1038Gly, p.Ser1140Gly, p.Ala2466Val, p.His2440Arg variants in women under 45 years old with breast nodules suspected of having breast cancer in Burkina Faso. Biomol. Concepts 2019, 10, 120–127. [Google Scholar] [CrossRef] [PubMed]
  44. Chen, Y.-C.; Chan, C.-H.; Lim, Y.-B.; Yang, S.-F.; Yeh, L.-T.; Wang, Y.-H.; Chou, M.-C.; Yeh, C.-B. Risk of Breast Cancer in Women with Mastitis: A Retrospective Population-Based Cohort Study. Medicina 2020, 56, 372. [Google Scholar] [CrossRef]
  45. Berryman, M.A.; Ilonen, J.; Triplett, E.W.; Ludvigsson, J. Important denominator between autoimmune comorbidities: A review of class II HLA, autoimmune disease, and the gut. Front. Immunol. 2023, 14, 1270488. [Google Scholar] [CrossRef]
  46. Koksal, H. Human leukocyte antigens class I and II in patients with idiopathic granulomatous mastitis. Am. J. Surg. 2019, 218, 605–608. [Google Scholar] [CrossRef]
  47. Katsumata, Y.; Nelson, P.T.; Estus, S.; Alzheimer’s Disease Neuroimaging Initiative (ADNI); Fardo, D.W. Translating Alzheimer’s disease-associated polymorphisms into functional candidates: A survey of IGAP genes and SNPs. Neurobiol. Aging 2019, 74, 135–146. [Google Scholar] [CrossRef]
  48. Yu, F.; Zhang, X.; Tian, S.; Geng, L.; Xu, W.; Ma, N.; Wang, M.; Jia, Y.; Liu, X.; Ma, J.; et al. Comprehensive investigation of cytokine- and immune-related gene variants in HBV-associated hepatocellular carcinoma patients. Biosci. Rep. 2017, 37, BSR20171263. [Google Scholar] [CrossRef]
  49. Pranckėnienė, L.; Urnikytė, A.; Kučinskas, V. Microevolutionary processes analysis in the Lithuanian genome. Sci. Rep. 2023, 13, 11941. [Google Scholar] [CrossRef]
  50. Centers for Disease Control and Prevention (CDC). Idiopathic granulomatous mastitis in Hispanic women—Indiana, 2006–2008. MMWR Morb. Mortal. Wkly. Rep. 2019, 58, 1317–1321. [Google Scholar]
  51. Huyser, M.; Kieran, J.; Myers, S. Review of idiopathic granulomatous mastitis in the Southwest Native American population. In Proceedings of the American Society of Breast Surgeons, 19th Annual Meeting, Orlando, FL, USA, 2–6 May 2018. [Google Scholar]
  52. Wolfrum, A.; Kümmel, S.; Theuerkauf, I.; Pelz, E.; Reinisch, M. Granulomatous Mastitis: A Therapeutic and Diagnostic Challenge. Breast Care 2018, 13, 413–418. [Google Scholar] [CrossRef] [PubMed]
  53. Valette, K.; Li, Z.; Bon-Baret, V.; Chignon, A.; Bérubé, J.-C.; Eslami, A.; Lamothe, J.; Gaudreault, N.; Joubert, P.; Obeidat, M.; et al. Prioritization of candidate causal genes for asthma in susceptibility loci derived from UK Biobank. Commun. Biol. 2021, 4, 700. [Google Scholar] [CrossRef] [PubMed]
  54. Leong, K.P.; Yun Yong, M.; Ling Goh, L.; Mun Woo, C.; Wei Lim, C.; Koh, E.T. Missense variant in interleukin-6 signal transducer identified as susceptibility locus for rheumatoid arthritis in Chinese patients. Arch. Rheumatol. 2021, 36, 603–610. [Google Scholar] [CrossRef] [PubMed]
  55. Brant, S.R.; Okou, D.T.; Simpson, C.L.; Cutler, D.J.; Haritunians, T.; Bradfield, J.P.; Chopra, P.; Prince, J.; Begum, F.; Kumar, A.; et al. Genome-Wide Association Study Identifies African-Specific Susceptibility Loci in African Americans With Inflammatory Bowel Disease. Gastroenterology 2017, 152, 206–217.e2. [Google Scholar] [CrossRef]
  56. DeAngelis, M.M.; Margaux, A.M. Allelic Variants Associated with Advanced Age-Related Macular Degeneration. U.S. Patent Application No. 13/141,898, 2012. Available online: https://patents.google.com/patent/WO2010075519A2/en (accessed on 1 June 2024).
  57. Lokki, A.I.; Kaartokallio, T.; Holmberg, V.; Onkamo, P.; Koskinen, L.L.E.; Saavalainen, P.; Heinonen, S.; Kajantie, E.; Kere, J.; Kivinen, K.; et al. Analysis of Complement C3 Gene Reveals Susceptibility to Severe Preeclampsia. Front. Immunol. 2017, 8, 589. [Google Scholar] [CrossRef]
  58. Naseer, M.I.; Abdulkareem, A.A.; Muthaffar, O.Y.; Sogaty, S.; Alkhatabi, H.; Almaghrabi, S.; Chaudhary, A.G. Whole Exome Sequencing Identifies Three Novel Mutations in the ASPM Gene From Saudi Families Leading to Primary Microcephaly. Front. Pediatr. 2021, 8, 627122. [Google Scholar] [CrossRef]
  59. The Genome Aggregation Database (gnomAD). Available online: https://gnomad.broadinstitute.org/ (accessed on 10 May 2024).
  60. ClinVar. Available online: https://www.ncbi.nlm.nih.gov/clinvar/ (accessed on 10 May 2024).
  61. Single Nucleotide Polymorphism Database (dbSNP). Available online: https://www.ncbi.nlm.nih.gov/snp/ (accessed on 10 May 2024).
  62. Online Mendelian Inheritance in Man (OMIM). Available online: https://www.omim.org/ (accessed on 10 May 2024).
  63. Polymorphism Phenotyping v2 (PolyPhen-2). Available online: http://genetics.bwh.harvard.edu/pph2/ (accessed on 10 May 2024).
  64. Sorting Intolerant From Tolerant (SIFT). Available online: https://sift.bii.a-star.edu.sg/ (accessed on 10 May 2024).
Table 1. Clinical characteristics of the patients.
Table 1. Clinical characteristics of the patients.
Clinical FeaturesErythema NodosumUltrasound FeaturesDrug-Taking HistoryRecurrence
1Bilateral multiple abscesses with sinus tractsYesMultiple breast abscessesMethylprednisolone
per oral + intralesional		Yes—repeated drug therapy than surgical excision
2Unilateral, large, inflamed, hard, painful breast massNoDiffuse hypoechoic heterogenous lesion with multiple abscessesMethylprednisolone
per oral		Yes—intralesional ozone therapy
3Unilateral big mass with abscessNoHuge abscess with inflammation aroundAbscess drainage + Methylprednisolone
per oral		No
4Unilateral, large, inflamed, hard, painful breast mass NoLeafy-type irregular hypoechoic lesion Methylprednisolone
per oral + intralesional		No
5Bilateral, multiple, inflamed, hard, painful breast lesions with sinus tractsNoLeafy-type multiple irregular hypoechoic lesions with small abscessesMethylprednisolone
per oral + intralesional		No
6Unilateral, hard, painless breast massNoLocalized hypoechoic massObservationNo
7Unilateral, large, inflamed, hard, painful breast mass with sinus tractNoLeafy-type irregular hypoechoic lesion with small abscessesMethylprednisolone
per oral		Yes—repeated drug therapy with per oral methylprednisolone
8Unilateral, large, inflamed, hard, painful breast massNoLeafy-type irregular hypoechoic lesion Methylprednisolone
per oral		No
9Bilateral, multiple, inflamed, hard, painful breast lesionsNoLeafy-type multiple irregular hypoechoic lesionsMethylprednisolone
per oral		Yes—Colchicine treatment
10Bilateral, multiple, inflamed, hard, painful breast lesions with sinus tractsNoLeafy-type multiple irregular hypoechoic lesions with small abscessesMethylprednisolone
per oral		Yes—repeated drug therapy with per oral methylprednisolone
11Unilateral, large, inflamed, hard, painful breast massNoLeafy-type irregular hypoechoic lesion Methylprednisolone
per oral		No
12Unilateral, inflamed, painful breast massNoHeterogenous irregular hypoechoic lesionObservationNo
13Unilateral, large, inflamed, hard, painful breast massNoLeafy-type irregular hypoechoic lesion Methylprednisolone
per oral		No
14Unilateral, large, hard breast massNoLarge hypoechoic heterogenous irregular lesionMethylprednisolone
per oral		Yes—repeated drug therapy with per oral methylprednisolone
15Unilateral, large, inflamed, hard, painful breast massNoLeafy-type irregular hypoechoic lesion Methylprednisolone
per oral		Yes—repeated drug therapy with per oral methylprednisolone
16Unilateral, hard breast mass with no inflammationNoHypoechoic irregular mass lesionSurgical excisionNo
17Unilateral, inflamed, painful breast massNoHeterogenous irregular hypoechoic lesionMethylprednisolone
per oral		No
18Unilateral, large, inflamed, hard, painful breast mass with abscessNoLeafy-type irregular hypoechoic lesion with abscess Abscess drainage + Methylprednisolone
intralesional		Yes—methotrexate ebewe per oral
19Bilateral, multiple, inflamed, hard, painful breast lesions with sinus tractsNoLeafy-type multiple irregular hypoechoic lesions with small abscessesTriamcinolone acetonide
intralesionally + externally		Yes—repeated drug therapy with per oral methylprednisolone + triamsinolon asetonid intralesional
than methotrexate ebewe per oral
20Unilateral, multiple, inflamed, hard, painful breast lesions with sinus tractsNoLeafy-type multiple irregular hypoechoic lesions with small abscessesTriamcinolone acetonide
intralesionally + externally		Yes—repeated drug therapy with per oral methylprednisolone + triamsinolon asetonid intralesional
than methotrexate ebewe per oral
21Unilateral, large, inflamed, hard, painful breast massNoLeafy-type irregular hypoechoic lesion Triamcinolone acetonide
intralesionally + externally		Lost in follow-up
22Unilateral, inflamed, painful breast massNoHeterogenous irregular hypoechoic lesionMethylprednisolone intralesionalNo
Table 2. Candidate genetic variants associated with granulomatous mastitis.
Table 2. Candidate genetic variants associated with granulomatous mastitis.
Gene SymbolChromosomeGenotypedbSNPPopulation FrequencyTranslation ImpactACMGClinVarOMIM
BRCA213Hom (141/141)rs1695470.982nonsynonymous SNVBenignbreast cancerMale breast cancer, medulloblastoma, prostate cancer, pancreatic cancer
CFTR7Het (40/93)rs47278530.307nonsynonymous SNVBenigncystic fibrosisCystic fibrosis, hereditary pancreatitis
NCF17Hom (121/130)rs106140.709nonsynonymous SNVBenignnot specifiedChronic granulomatous disease
PTPN221Hom (59/59)rs24766010.918nonsynonymous SNVBenignno informationSystemic lupus erythematosus, diabetes mellitus type 1, and rheumatoid arthritis susceptibility
HLA-DRB16Hom (322/322)rs92703030.76nonsynonymous SNVBenignno informationMultiple sclerosis and sarcoidosis susceptibility
HLA-DRB16Het (139/316)rs23087600.384nonsynonymous SNVBenignno informationMultiple sclerosis and sarcoidosis susceptibility
HLA-DRB16Het (159/173)rs38301300.709intronBenignno informationMultiple sclerosis and sarcoidosis susceptibility
HLA-DRB16Het (134/299)rs7079530.481nonsynonymous SNVBenignno informationMultiple sclerosis and sarcoidosis susceptibility
HLA-DRB16Hom (317/317)rs7018290.839nonsynonymous SNVBenignno informationMultiple sclerosis and sarcoidosis susceptibility
HLA-DRB16Het (35/85)rs92699580.467stopgainBenignno informationMultiple sclerosis and sarcoidosis susceptibility
HLA-DRB16Hom (214/214)rs92702990.839nonsynonymous SNVBenignno informationMultiple sclerosis and sarcoidosis susceptibility
C319Hom (106/106)rs4065140.761intronBenigncomplement component 3 deficiency Age-related macular degeneration, C3 deficiency
ACMG: Association for Molecular Pathology, dbSNP: Single Nucleotide Polymorphism Database, Het: heterozygous, Hom: homozygous, OMIM: Online Mendelian Inheritance in Man, SNV: single nucleotide variant.
Table 3. Primer design according to the provided accession number and locations.
Table 3. Primer design according to the provided accession number and locations.
Genes with Accession NumberVariantAmino Acid ChangePrimers
BRCA2 (NM_000059)c.7397T > Cp.V2466AF: TTTCACAGAGTTGAACAGTGTGT
R: AGGGCTTTAAAATTACCACCACC
CFTR (NM_000492)c.1251C > Ap. N417KF: CATGGGCCATGTGCTTTTCA
R: CTTGCCTGCTCCAGTGGATC
NCF1 (NM_000265) c.295G > Ap.G99SF:CTGCCCTCCCAGCCCCTCTCGGGCTT
R: CGCACCTTGAAGAAGTCGAGGAG
INT: CGCACCTTGAAGAAGTCGAGGAG
PTPN22 (NM_015967)c.1858T > Cp.W620RF: ACTGATAATGTTGCTTCAACGGA
R: AGGCTCACACATCAGCTTCC
C3 (NM_000064)c.2246-8C > T F: CTCCAACTCCTGGCCTCAAG
R: CGGTGGCTCTTTCAAGTCCT
F: forward, R: reverse.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ozcinar, B.; Ocak, Z.; Billur, D.; Ertugrul, B.; Timirci-Kahraman, O. Whole-Exome Sequencing: Discovering Genetic Causes of Granulomatous Mastitis. Int. J. Mol. Sci. 2025, 26, 425. https://doi.org/10.3390/ijms26010425

AMA Style

Ozcinar B, Ocak Z, Billur D, Ertugrul B, Timirci-Kahraman O. Whole-Exome Sequencing: Discovering Genetic Causes of Granulomatous Mastitis. International Journal of Molecular Sciences. 2025; 26(1):425. https://doi.org/10.3390/ijms26010425

Chicago/Turabian Style

Ozcinar, Beyza, Zeynep Ocak, Deryanaz Billur, Baris Ertugrul, and Ozlem Timirci-Kahraman. 2025. "Whole-Exome Sequencing: Discovering Genetic Causes of Granulomatous Mastitis" International Journal of Molecular Sciences 26, no. 1: 425. https://doi.org/10.3390/ijms26010425

APA Style

Ozcinar, B., Ocak, Z., Billur, D., Ertugrul, B., & Timirci-Kahraman, O. (2025). Whole-Exome Sequencing: Discovering Genetic Causes of Granulomatous Mastitis. International Journal of Molecular Sciences, 26(1), 425. https://doi.org/10.3390/ijms26010425

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop