Next Article in Journal
Phosphoenolpyruvate and Related Metabolic Pathways Contribute to the Regulation of Plant Growth and Development
Previous Article in Journal
A Low-Modulus Phosphatidylserine-Exposing Microvesicle Alleviates Skin Inflammation via Persistent Blockade of M1 Macrophage Polarization
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling

1
Engineering Research Center of Key Technology and Industrialization of Cell-Based Vaccine, Ministry of Education, Lanzhou 730030, China
2
Gansu Tech Innovation Center of Animal Cell, Biomedical Research Center, Northwest Minzu University, Lanzhou 730030, China
3
Key Laboratory of Biotechnology & Bioengineering of State Ethnic Affairs Commission, Biomedical Research Center, Northwest Minzu University, Lanzhou 730030, China
4
China-Malaysia National Joint Laboratory, Biomedical Research Center, Northwest Minzu University, Lanzhou 730030, China
5
School of Life Sciences and Engineering, Northwest Minzu University, Lanzhou 730030, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 395; https://doi.org/10.3390/ijms26010395
Submission received: 20 September 2024 / Revised: 29 December 2024 / Accepted: 30 December 2024 / Published: 4 January 2025
(This article belongs to the Section Molecular Biology)

Abstract

Madin–Darby Canine Kidney (MDCK) cells are a key cell line for influenza vaccine production, due to their high viral yield and low mutation resistance. In our laboratory, we established a tertiary cell bank (called M60) using a standard MDCK cell line imported from American Type Culture Collection (ATCC) in the USA. Due to their controversial tumourigenicity, we domesticated non-tumourigenic MDCK cells (named CL23) for influenza vaccine production via monoclonal screening in the early stage of this study, and the screened CL23 cells were characterised based on their low proliferative capacity, which had certain limitations in terms of expanding their production during cell resuscitation. It was thus our objective to enhance the proliferation efficiency of MDCK cells for influenza vaccine production following cell resuscitation, with a view to improving the production of non-tumourigenic MDCK cells for vaccines and enhancing the production of influenza virus lysate vaccines from MDCK cells through genetic intervention. We concentrated on the protein thrombosponin-1 (THBS1), which was markedly differentiated in the proteomics data of the two MDCK cells. By integrating this finding with related studies, we were able to ascertain that THBS1 exerts a significant influence on the level of cell proliferation and apoptosis. Consequently, our objective was to investigate the impact of THBS1 expression on MDCK cell apoptosis by verifying the differences in THBS1 expression between the two MDCK cells and by interfering with THBS1 expression in the MDCK cells. We found that the knockdown of THBS1 significantly increased the proliferation and apoptosis of CL23 cells without causing significant changes in cell migration and invasion, and its overexpression significantly decreased the proliferation of M60 cells and increased cell migration, invasion, and apoptosis. In addition, the TGF-β/Smad pathway target genes transforming growth factor-β1 (TGF-β1), mothers against decapentaplegic homolog 2 (Smad2), and mothers against decapentaplegic homolog 3 (Smad3), were significantly down-regulated in CL23 cells after THBS1 knockdown and up-regulated in M60 cells after overexpression, with consistent expression identified at both the mRNA and protein levels. The treatment of cells with TGF-β activators and inhibitors further demonstrated that THBS1 regulated MDCK cell proliferation and apoptosis through the TGF-β/Smad signalling pathway. Finally, we found that THBS1 also regulated H1N1 influenza virus replication. These findings enable a comprehensive understanding of the regulatory mechanisms of THBS1 regarding MDCK cell proliferation and apoptosis functions and the effects of influenza virus replication.

1. Introduction

Influenza is a global acute respiratory disease caused by the influenza A and B viruses, which seriously affects human health and causes a disease burden due to its high morbidity and mortality. Vaccination is currently the most effective means of preventing influenza virus infection, and relevant vaccines and antiviral drugs have been developed to prevent influenza [1,2]. Traditional influenza vaccines are mainly produced using chicken embryos, but the production of such influenza vaccines based on chicken embryos cannot meet the surge in demand during a pandemic [3]. Secondly, producing influenza vaccines using chicken embryos has many limitations compared to using Madin–Darby Canine Kidney (MDCK) cells for production, such as a long supply time, a cumbersome operation process, susceptibility to contamination, and the possibility of mutation during embryonic adaptation [4]. MDCK cells effectively support the proliferation of most influenza A viruses (IVAs), and they are therefore widely used in influenza vaccine production [5].
However, because of the MDCK cells’ notable changes in cell shape, proliferation rate, and virus sensitivity, cell safety restricted its application in large-scale vaccine production [6]. A considerable number of laboratories have already adopted the use of subcellular lines as a means of meeting their influenza vaccine production requirements. Notable examples include Novartis and MedImmune, which have acquired MDCK cell lines with their own intellectual property rights and have successfully demonstrated their ability to produce influenza vaccines through the processes of cell subcloning and screening [7]. To produce a high-titer virus vaccine, increasing the cell proliferation rate for the achievement of a high cell density vaccine production process is also an important research focus. Direct application of wild-type epidemic strains for vaccine production in a tertiary biosafety environment is an important reason why the proliferation rate of MDCK cells used to produce influenza vaccines needs to be increased [8]. Accordingly, an investigation into the means of accelerating the proliferation rate of MDCK cells for the production of influenza vaccines constituted the core objective of our research programme. At present, research into cell growth and proliferation is primarily focussed on the cell cycle and metabolic regulation. However, the success rate in achieving high cell densities to develop vaccine production processes remains relatively low. It is therefore imperative to develop alternative cultivation methods for MDCK cell lines, such as genetic engineering techniques, in order to achieve a higher cell proliferation rate.
Accordingly, the protein thrombosponin-1 (THBS1), which is associated with proliferation and apoptosis, was identified on the basis of previous MDCK cell proteomics data profiling. THBS1 can stimulate or inhibit cell adhesion, proliferation, and migration in an environment-dependent and cell-specific manner, but THBS1’s hydrolysed and recombinant N-terminal protein portion has significant pro-angiogenic activity, mediated primarily by β-1 integrins, whereas the interaction of 3TSR with α5β1 integrins inhibits endothelial cell migration in a PI3K-dependent manner [9]. The TSP-1 TSR also interacts with CD148, a transmembrane protein tyrosine phosphatase expressed in endothelial cells, thereby inhibiting endothelial cell proliferation and angiogenesis [10]. THBS1 is a 450 kDa single-subunit homodimeric matrix glycoprotein and the first recognised member of the THBS family, consisting of N- and C-terminal globular domains linked by a pre-collagen homology region, type I alkyrin repeat, type II epidermal growth factor repeat, and type III calcium-binding region repeat. It plays a multifunctional role in cell–matrix and cell–cell interactions, as well as angiogenesis and tumours [5,11,12]. THBS1 is secreted by many types of cells in response to injury or specific cytokines. It is transiently present in the extracellular matrix, but is rapidly internalised and degraded by fibroblasts and endothelial cells; however, THBS1 is abundant in megakaryocytes and platelets and constitutively expressed in the dermal–epidermal border of the skin and the subendothelial matrices of some blood vessels [13]. THBS1 can participate in important physiological processes, such as embryonic development, neovascularisation, and tissue repair, but it is also closely associated with the development of many diseases, especially tumours [14]. Most, but not all malignant tumour cells exhibit down-regulated THBS1 expression during malignant progression [15], which is due to attenuated positive THBS1 gene regulation by the oncogenes TP53 and NMEI, as well as the enhanced negative regulation of oncogenes such as RAS and MYC. Secondly, THBS1 expression is induced by TGF-β, vitamin A, progesterone, and analogues, but inhibited by IDI and HGF (hepatocyte growth factor) [16].
Reduced THBS1 levels are also associated with poor prognosis in a variety of cancers, including non-small cell lung cancer [17], pancreatic adenocarcinoma, gastric cancer [18], invasive cervical cancer, and oral squamous cell carcinoma [19], whereas THBS1 is positively correlated with infiltration in hepatocellular carcinoma [20]. THBS1 also inhibits cell adhesion, cell growth, and cell motility [21], and induces apoptosis in endothelial cells and several other cell types [22]. Through screening the signalling pathways regulated by FGF7/FGFR2-driven THBS1 expression, the key pathways for fibroblast growth factor signalling were identified as the Ras–MAP kinase pathway, involving ERK1/2, p38 and JNK kinases, and the PI3K–Akt pathway, and using a range of inhibitors, it was demonstrated that FGF7/FGFR2-mediated THBS1 up-regulation may occur through the PI3K/Akt/mTOR pathway [23]. THBS1 expression is regulated by the Akt and PI3K pathways, as well as several growth factors, such as P53, ras, c-src, transforming growth factor-β, and fibroblast growth factor-2 [24]. IGFBP3, a functional secreted extracellular regulator protein, regulates THBS1 via THBS1 promoter expression, mainly through the intracellular pathway of IGFBP3 [25]. In addition, Wang, Y et al. [26] reported that THBS1 is a potential target gene of METTL14 that functions as a tumour suppressor in prostate cancer (PCa), demonstrating that METTL14 inhibits THBS1 expression in the nucleus in an m6A-dependent manner and promotes PCa proliferation. However, the precise function of THBS1 in controlling the phenotypes of MDCK cells, including proliferation and apoptosis, remains unclear. In addition, the production of a vaccine by knocking down THBS1 has not been reported in the literature to date. However, Cui DL et al. [27] reported that the THBS1 gene may be associated with the prevention and treatment of COVID-19. Consequently, our objective is to develop high-proliferative MDCK cell lines for vaccine production through the genetic engineering of MDCK cells. In this study, MDCK cell lines with THBS1 knockdown or overexpression were constructed to explore the effects of THBS1 on the proliferation and apoptosis of MDCK cells, and the mechanisms underlying these effects.

2. Results

2.1. Proliferation- and Apoptosis-Related Gene Detection

We verified the differences in the expression of proliferation- and apoptosis-related genes in MDCK cells by showing that THBS1 and EPHB2 were highly expressed at the mRNA level in CL23 cells, while UPK3A was poorly expressed in CL23 cells, and the difference in ATXN1 expression between CL23 and M60 cells was not significant (Figure 1a). Moreover, the THBS1 and EPHB2 proteins were highly expressed in CL23 cells (Figure 1b,c). Given that THBS1 is associated with neoangiogenesis, tissue repair, and functions such as endothelial cell proliferation and migration, we postulated that THBS1 might be related to the regulation of proliferation and apoptosis in MDCK cells. Furthermore, we screened THBS1 and EPHB2 through the preliminary MDCK cell proteomics data and detected their expression differences in the two kinds of MDCK cells using RT-qPCR technology. The expression differences were more significant at the Western blot protein level for THBS1, and thus it was determined that the THBS1 protein was selected for further investigation into its potential role in regulating proliferation and apoptosis in MDCK cells.

2.2. Determination of the Proliferation, Apoptosis, and Migration Capacity of M60 and CL23 Cells

To determine the differences in the proliferation, apoptosis, and migration abilities of M60 and CL23 cells, the cells’ growth curves and apoptosis and migration abilities were determined in this study. The results show that M60 and CL23 cells were in the latent phase on days 0–2, entered the logarithmic growth phase on days 2–4, and entered the plateau phase on day 6. The difference in the proliferation rates of cells in the latent phase on days 0–2 was not significant, and the proliferation rate of M60 cells was significantly higher than that of CL23 cells on days 4–8 (p < 0.001) (Figure 2a). Apoptosis detection via flow cytometry showed that the apoptotic capacity of the M60 cells was higher than that of the CL23 cells at stage two, and the apoptotic capacity of the M60 cells was lower than that of the CL23 cells at stage three. Moreover, the total apoptotic capacity of the M60 cells was significantly higher than that of the CL23 cells (p < 0.05) (Figure 2b,c). The migration ability, as detected through cell scratching, was significantly higher for M60 cells than CL23 cells within a 0–24 h period (p < 0.001) (Figure 2d,e).

2.3. Construction and Characterisation of THBS1-Knockdown and -Overexpressing MDCK Cell Lines

The results show that the fluorescent expression of THBS1 in stably under- and overexpressing cells after puromycin screening was above 95% (Figure 3a), proving that the knockdown and overexpression transfections were successful. The THBS1 expression levels were detected using RT-qPCR and Western blotting, and the results show that, compared with the knockdown control cells THBS1-sh-con, the knockdown level of the THBS1-sh-122484 locus differed significantly, and the expression was consistent at the mRNA and protein levels (Figure 3b,d,e). Moreover, compared with the overexpressing THBS1-OE-con control cells, THBS1-OE cells demonstrated overexpression at significantly different levels, with consistent expression identified at the mRNA and protein levels (Figure 3c,d,f), demonstrating that THBS1 cell lines with stable knockdown and overexpression were successfully constructed.

2.4. Effect of Knockdown of THBS1 on Proliferation, Apoptosis, and Migration Ability of CL23 Cells

The proliferation rate (p < 0.05) (Figure 4a) and apoptosis level (p < 0.001) (Figure 4c) were significantly up-regulated on days 4–8 after the knockdown of THBS1 compared with the knockdown control cells, whereas the difference in the cell migration abilities of the cell types was not significant (p > 0.05) (Figure 4b). The S-phase, which is the cellular DNA replication phase, was significantly up-regulated when THBS1 was knocked down compared with the knockdown control group (p < 0.001) (Figure 4d), demonstrating that THBS1 knockdown promoted the proliferative activity of CL23 cells.

2.5. Effects of Overexpression of THBS1 on Cell Proliferation, Apoptosis, and Migration Ability

Compared with the overexpression control cells, the proliferation rate was significantly reduced (p < 0.001) (Figure 5a), the apoptosis level was significantly up-regulated (p < 0.01) (Figure 5c), and the cell migration ability was significantly enhanced (p < 0.001) (Figure 5b) after the overexpression of THBS1 on days 4–8. Moreover, the S-phase was significantly down-regulated (p < 0.001) (Figure 5d), further proving that THBS1 overexpression inhibited the proliferative activity of M60 cells.

2.6. Effects of the Knockdown and Overexpression of THBS1 on H1N1 Influenza Virus Replication

THBS1 knockdown significantly inhibited NP and NS1 expression at the mRNA level (p < 0.05) (p < 0.001) (Figure 6a,b), and it also significantly inhibited NP expression at the protein level (p < 0.001) (Figure 6c,d) at 36 h, 48 h, and 72 h. THBS1 overexpression significantly promoted NP and NS1 expression at the mRNA level at 48 h (p < 0.001) (Figure 6e,f), while significantly promoting NP expression at the protein level at 48 h and 72 h (p < 0.001) (p < 0.05) (Figure 6g,h). This indicates that THBS1 knockdown inhibited H1N1 influenza virus replication in CL23 cells and THBS1 overexpression promoted H1N1 influenza virus replication in M60 cells.

2.7. Expression of TGF-β/Smad Pathway Target Genes in M60 and CL23 Cells

Compared with in CL23 cells, the TGF-β/Smad signalling pathway downstream target genes TGF-β1, Smad2, and Smad3 were significantly down-regulated at the mRNA and protein levels in M60 cells (p < 0.01), while SCARB2 was significantly up-regulated (p < 0.001), and the PI3K/Akt and P53 signalling pathway downstream target genes Akt, Bcl2, and TP53 were not significantly different at the mRNA level (p > 0.05) (Figure 7). We speculated that THBS1 might be involved in MDCK cell biology regulation through TGF-β/Smad signalling, and that there might be a mutual inhibitory relationship between SCARB2 and THBS1.

2.8. Effects of Knockdown and Overexpression of THBS1 on the Expression of Target Genes Downstream of TGF-β/Smad Signalling

To further determine the THBS1 signalling pathways involved in proliferation and apoptosis regulation in MDCK cells and whether there was any interaction between THBS1 and SCARB2, we performed differential expression assays of the downstream target genes of the PI3K/Akt, P53, and TGF-/Smad signalling pathways, as well as the predicted interacting gene SCARB2, with the THBS1-knockdown and -overexpression groups of cells. The results showed that, compared with knockdown control cells (THBS1-sh-con), the TGF-β/Smad signalling pathway downstream target genes of TGF-β1, Smad2, and Smad3 were significantly down-regulated at both the mRNA and protein levels after THBS1 knockdown (THBS1-sh-122484) (Figure 8b,e,f). The PI3K/Akt pathway downstream target gene Akt and the P53 pathway downstream target genes TP53, Bcl2, and Bax were significantly up-regulated at the mRNA level, while SCARB2 and Cyclin-D1 were significantly down-regulated at the mRNA level (Figure 8a), promoting phosphorylation at the P53 protein level and inhibiting phosphorylation at the Akt protein level. Moreover, SCARB2 was significantly non-significant at the protein level (Figure 8e,f). This indicates that the knockdown of THBS1 in CL23 cells could inhibit TGF-β/Smad signalling, activate P53 phosphorylation, and inhibit Akt phosphorylation in CL23 cells. Furthermore, THBS1 overexpression in M60 cells could activate TGF-β/Smad signalling, inhibit P53 phosphorylation, and promote Akt phosphorylation in M60 cells. Therefore, we speculated that THBS1 regulated the proliferation and apoptosis of MDCK cells through TGF-β/Smad signalling, whereas after THBS1 knockdown and overexpression, SCARB2 only underwent changes at the mRNA level, not the protein level, which might be related to the post-transcriptional translation in the cells. Therefore, we speculated that there was no interaction between the THBS1 and SCARB2 proteins.

2.9. Effects of TGF-β Activators and Inhibitors on TGF-β/Smad Signalling Target Genes and THBS1 Expression in MDCK Cells

The results showed that in the positive control group (THBS1-sh-122484+DMSO) with DMSO, the growth state of adherent cells gradually decreased from the 10 μg/mL concentration, and more than 90% of the cells were in the floating state at the 50 μg/mL concentration (Figure 9a). The detection of differences in the expression of downstream target genes of the TGF-β/Smad signalling pathway and THBS1 in cells in the 2 μg/mL, 5 μg/mL, and 10 μg/mL concentration groups, as well as in the positive control group, revealed that TGF-β1, Smad2, Smad3, and THBS1 activation at the mRNA and protein levels was significant at 5 μg/mL compared with that of the positive control group (Figure 9c,e,f). In the DMSO positive control group (THBS1-OE+DMSO), the growth status of adherent cells gradually decreased from 20 μg/mL, and more than 90% of cells were floating at a 50 μg/mL concentration (Figure 9b). Detecting differences in the expression of downstream target genes of the TGF-β/Smad signalling pathway and THBS1 in cells in the 2 μg/mL, 5 μg/mL, and 10 μg/mL concentration groups, as well as in the positive control group, revealed that the inhibitory effects of TGF-β1, Smad3, and THBS1 at the mRNA and protein levels were significant at 10 μg/mL compared with those in the positive control group (Figure 9d,e,g). This indicated that the optimal activation concentration of SRI-011381 for THBS1-knockdown cells (THBS1-sh122484) was 5 μg/mL, while the optimal inhibitory concentration of LY2109761 for THBS1-overexpressing cells (THBS1-OE) was 10 μg/mL. Meanwhile, we also confirmed that THBS1 regulated MDCK cells by inhibiting the TGF-β/Smad signalling pathway to regulate MDCK cell proliferation and apoptosis.

2.10. Effects of TGF-β Activators and Inhibitors on Target Genes Downstream of PI3K/Akt and P53 Signalling in MDCK Cells

We investigated the effects of TGF-β activators and inhibitors on the knockdown and overexpression of PI3K/Akt and P53 downstream target genes and SCARB2 in THBS1 cells. Akt and SCARB2 were significantly up-regulated at the mRNA level, while TP53, Bcl2, and Bax were not significantly changed at the mRNA level in THBS1-sh-122484 cells after SRI-011381 (5 μg/mL) intervention, compared to the DMSO positive control group (Figure 10a). The phosphorylation of the Akt and SCARB2 proteins was not significant (Figure 10c,d), Akt and TP53 were significantly up-regulated at the mRNA level, while SCARB2, Bcl2, and Bax were not significantly modulated at the mRNA level in THBS1-OE cells after LY2109761 intervention (10 μg/mL) (Figure 10b). The phosphorylation of the Akt protein was inhibited, and the difference in the SCARB2 protein level was not significant (Figure 10c,e). This indicates that SRI-011381 could activate Akt phosphorylation in THBS1-knockdown cells (THBS1-sh122484), and LY2109761 could inhibit such phosphorylation in THBS1-overexpressing cells (THBS1-OE), in turn regulating MDCK proliferation and apoptosis.

2.11. Effects of TGF-β Activators and Inhibitors on the Proliferative, Migratory Capacities and Apoptosis Ability of THBS1-Knockdown and -Overexpressing Cells

In this study, we evaluated the effects of SRI-011381, a signalling pathway activator, on the proliferative, migratory capacity and apoptosis ability of THBS1-knockdown cells (THBS1-sh122484) and the effects of the inhibitor LY2109761 on the proliferative, migratory capacity and apoptosis ability of THBS1-overexpressing cells (THBS1-OE) to further determine THBS1’s influence on the proliferative and apoptosis capacity of MDCK cells, by regulating TGF-β signalling capacity. Compared with that in the DMSO positive control group, the proliferation rate of THBS1-knockdown cells (THBS1-sh122484) in the SRI-011381-treated group was significantly down-regulated after day 2 (p < 0.001) (Figure 11a), the cell migration rate was significantly reduced at 48 h (p < 0.001) (Figure 11b,c), and the cell apoptosis ability was significantly reduced (p < 0.001) (Figure 11d). The proliferation rate of THBS1-overexpressing cells (THBS1-OE) in the LY2109761 treatment group was significantly up-regulated after day 2 (p < 0.001) (Figure 11e), the cell migration rate was significantly reduced at 24 h (p < 0.001) (Figure 11f,g), and the cell apoptosis ability was significantly reduced (p < 0.01) (Figure 11h). This indicates that SRI-011381 reduced the proliferation, migration, and apoptosis ability of THBS1-knockdown cells (THBS1-sh122484. Moreover, LY2109761 promoted the proliferation of THBS1-overexpressing cells (THBS1-OE) and inhibited their migration and apoptosis ability.

3. Discussion

MDCK cells are considered the most favourable cellular substrate for influenza vaccine production, due to their specific efficacy in becoming infected with influenza viruses, rapid proliferation, and reduced susceptibility to mutations [28]. However, the tumourigenic phenotype possessed by MDCK cells is highly controversial during vaccine production [29], and in recent years, much evidence has highlighted key factors of MDCK cell tumourigenicity, such as CDC20, TGM2, and miR-2779-x. Moreover, a previous study demonstrated that they regulate influenza virus replication [30,31], as well as affecting the proliferative capacity of MDCK cells, by influencing the oncogenic phenotype of MDCK cells. IncRNAMSTRG.1056.2 has also been shown to regulate ERBB3, which activates the PI3K-Akt pathway and promotes tumourigenic phenotype development in MDCK cells [32].
MDCK cells greatly support the proliferation of most IVAs; therefore, they are widely used in influenza vaccine production. Increasing the susceptibility of MDCK cells to influenza viruses can increase the vaccine yield or lead to the isolation of more strains of influenza viruses, which is important for controlling influenza virus transmission [5]. Many studies on influenza virus replication in MDCK cells and virus-associated regulatory mechanisms have been reported in recent years. CRISPR-Cas9 gene-editing technology was used to construct TRAF3-knockout MDCK cells (MDCK-TRAF3-/-), and after IVA infection, the HA titre and viral titre of MDCK-TRAF3-/- cells were elevated, the type I interferon-related pathway was significantly blocked, and the transcription of several antiviral-related genes was significantly reduced; therefore, the knockout of the TRAF3 gene decreased the resistance of MDCK cells to IVA, thus providing a prospective research field for improving IVA isolation and influenza vaccine production [33]. After successive passages in cell culture, influenza viruses may undergo HA and NA protein mutations, reducing the effectiveness of the vaccine [34]. Therefore, researchers compared the HA and NA sequences obtained from the microRNA inhibitor-treated group with the parental population used and found that neither HA nor NA were mutated, despite virus propagation in cells treated with microRNA inhibitors and gene-editing tools that knock out or knock down microRNAs both in vitro and in vivo [35,36,37].
In this study, we found, for the first time, that interfering with THBS1 affected IVA replication in MDCK cells, and studies on the effect of THBS1 on influenza virus replication have not yet been reported, so THBS1 may be a potential target gene affecting influenza virus replication, showing potential promise for the study of potential influenza vaccines for the matrix of MDCK cells. Regarding the regulation of IVA replication by THBS1, the replication mechanism in MDCK cells needs to be further explored.
THBS1, a major component of human platelets, is an extracellular matrix glycoprotein synthesised and secreted by various cells, including platelets, fibroblasts, and vascular endothelial cells [38,39]. THBS1 binds to extracellular matrix ligands, including fibrinogen, fibronectin, some collagens, latent and active TGF-β1, TNFAIP6 (TSG6), heparin, fibronectin, CTSG (histone G), ELANE (neutrophil elastase), some MMPs, tissue-factor pathway inhibitors, and heparan sulphate proteoglycans, and it participates in signalling pathways that regulate cell proliferation and apoptosis via CALR and integrin binding to the cell surface receptors CD36, CD47, and LRP1 [40,41]. In this study, we found that THBS1 was highly expressed in CL23 cells, and their proliferation, apoptosis, and migration abilities were lower than those of M60 cells, so we hypothesised that THBS1’s ability to participate in proliferation and apoptosis regulation in MDCK cells was related to cellular tumourigenicity. To confirm this theory, we interfered with the expression of THBS1 in MDCK cells with different tumourigenicities in vitro and demonstrated that THBS1 regulated MDCK cell proliferation, apoptosis, migration and cell cycles, suggesting that THBS1 influences MDCK cell tumourigenicity by affecting MDCK cell proliferation and apoptosis capacity, as well as the cell cycle. It has been shown that THBS1 stimulates the migration and proliferation of vascular endothelial cells and capillary bud formation in vitro [42]. Jiang, D. et al. [11] found that THBS1 overexpression significantly induced the proliferation and migration of proliferative scar fibroblasts while inhibiting apoptosis, and THBS1 silencing mildly suppressed fibroblast proliferation and migration and up-regulated apoptosis. THBS1 also promoted proliferation and inhibited apoptosis in RAW264.7 cells and promoted tumour cell proliferation, migration, growth, and survival in vivo [43,44].
TGF-β is a key cytokine that regulates T-cell development, activation, proliferation, differentiation, and death [45]. The TGF-β superfamily is known to have at least 33 members, including TGF-β, bone morphogenetic proteins (BMPs), activins, inhibins, and glial cell lineage-derived neurotrophic factors (GDNFs) [46]. TGF-β1 is the predominant isoform found in blood and immune cells, and it plays a key role in regulating the immune response [47]. TGF-β regulates various biological processes such as tissue homeostasis, angiogenesis, migration, and differentiation [48]. TGF-β stimulation stops proliferation in almost all non-carcinogenic epithelial cells, endothelial cells, haematopoietic cells, and neuronal cells, and some mesenchymal cells [49]. During haematopoiesis, the TGF-β signalling pathway is a key negative regulator of proliferation and promotes differentiation and apoptosis under appropriate circumstances. In certain haematological malignancies, TGF-β also has tumour suppressor activity [50].
In this study, we found that THBS1 knockdown promoted proliferation and apoptosis in CL23 cells and inhibited the expression of TGF-β1 and Smad2/3, as well as inhibiting Akt phosphorylation and promoting P53 phosphorylation, whereas the opposite result was observed in M60 cells, which suggests that THBS1 can regulate the proliferation and apoptosis ability of DMCK cells through TGF-β/Smad signalling, and may also be involved in the PI3K/Akt/P53 axis that regulates the oncogenic capacity of MDCK cells. TGF-β plays a balancing role by inducing cell cycle arrest and apoptosis, and in some haematological malignancies, it also has tumour suppressor activity. The TGF-β/Smad signalling pathway can cause growth inhibition, differentiation, and apoptosis [51,52,53]. To further validate this possible regulatory process, we pharmacologically intervened in MDCK cell lines with THBS1 knockdown and overexpression using TGF-β activators and inhibitors, finding that TGF-β activators and inhibitors reversed the effects on the expression and Akt phosphorylation of THBS1, TGF-β1, and Smad2/3, as well as reversing the effect on cellular proliferative capacity, demonstrating that THBS1 is regulated through TGF-β/Smad signalling, which regulates the proliferative and apoptotic capacity of DMCK cells and cellular tumourigenicity development. TGF-β activates various intracellular signalling pathways, including the classic Smad pathway. Upon activating TGF-β signalling, TGF-β transmits signals by binding to specific heterodimeric type I and II receptor complexes. TGF-β first binds to Tβ RII, and it then recruits and activates Tβ RI. The activated Tβ RI then recruits and phosphorylates the receptor Smad, Smad2/3 induces TGF-β phosphorylation at the C-terminus or linker region, and phosphorylated Smad2/3 forms a complex with Smad4 for translocation to the nucleus to regulate its target genes [54,55]. In general, Smad2/3/4 complexes cannot regulate the transcription of target genes without interacting with other co-transcription factors, and Smad3 and Smad2 compensate for each other by mediating TGF-β signalling in immune cells, as the absence of Smad2 and Smad3 in T cells completely blocks TGF-β signalling [56]. In addition, Soo Min Lee et al. [57] found that THBS1 is involved in both the TGF-β and p53 pathways, and they demonstrated through in vitro experiments that the main mechanism is the regulation of a positive feedback loop between the THBS1 and TGF-β pathways.
Past studies show that MDCK cells are an ideal cellular matrix for influenza vaccine production compared to other available cellular matrices. Increasing influenza virus titres and reducing tumour formation in MDCK cells are issues that must be addressed [4]; however, our findings indicate that THBS1 plays a role in regulating MDCK cell proliferation and apoptosis through TGF-β/Smad signalling. Additionally, preliminary evidence suggests that THBS1 may influence the expression of the H1N1 influenza virus nuclear gene NP. Nevertheless, the precise impact of THBS1 on influenza virus titer and its underlying mechanism remains unclear. It is our intention, therefore, to enhance influenza virus replication and titer by identifying MDCK cell proliferation-related targets to increase cell proliferation efficiency. Furthermore, we will investigate the regulatory mechanism of THBS1 on influenza virus replication and its effect on the enhancement of influenza virus titer in future studies.
In conclusion, in this study, we found for the first time that THBS1 regulated MDCK cell proliferation and apoptosis through the TGF-β/Smad signalling pathway and, at the same time, participated in PI3K/Akt/P53 axis signalling regulation, which may be related to the THBS1 feedback regulation mechanism of the TGF-β pathway. We also found that THBS1 regulated influenza virus replication. We hope to further understand the role of THBS1 in MDCK tumourigenicity and influenza virus replication, and to better understand the function of THBS1 in MDCK cells affecting influenza virus replication, providing a basis for the construction of high-yield genetically engineered MDCK cell lines for vaccine use.

4. Material and Methods

4.1. Cell Culture and Virus

MDCK-M60 cells were purchased from American Type Culture Collection (ATCC) and provided by the Gansu Animal Cell Technology Innovation Centre; non-tumourigenic MDCK-CL23 cells were domesticated and cultured by the Gansu Animal Cell Technology Innovation Centre. Frozen MDCK-M60 and MDCK-CL23 cells were resuscitated in T25 square flasks. They were mixed with 5 mL of 10% NBS/DMEM medium or 5 mL of 10% FBS/DMEM medium (Minhai Bioengineering, Lanzhou, China), respectively, and cultured in a 37 °C, 5% CO2 incubator, and the medium was changed after 12 h to 24 h. The H1N1 influenza virus strain number was X-275 and was provided by the Wuhan Institute of Biological Products Co., Ltd. (Wuhan, China).

4.2. Lentivirus Transfection

The THBS1 knockdown and overexpression lentiviruses used in this experiment were synthesised by Gikai. MDCK cells (M60, CL23 cells) with good growth statuses were detached with the help of trypsin and counted, before being inoculated into 24-well plates at 5 × 104 cells/well, and cells were grown in an incubator with 5% CO2 at a temperature of 37 °C. When the cells had grown to 60–70% confluence, they were detached with the help of trypsin and counted. Then, the volume of the viral fluid required per well was calculated according to the number of cells and the viral titre, and the volume of lentivirus in each well was calculated according to MOI = 100. THBS1 RNAi (122484-1, 122485-2, and 122486-2) and a negative control CON313 lentiviral solution were inoculated into MDCK (CL23) cells, and LV-THBS1 (93180-22) and a negative control CON335 lentiviral solution were inoculated into MDCK (M60) cells in the overexpression group at MOI = 100. The cells were cultured for 12 h and the medium was then replaced with 10% NBS DMEM normal medium. The fluorescence expression intensity was observed under a fluorescence microscope after 24 h, and the cells were passaged, frozen, and tested for the cell transient effect. Lentivirus-transfected cells were passaged and cultured, and 4 μg/mL puromycin (Solarbio, Beijing, China) added to the medium was used for cell resistance screening when the cells had grown to 20–30% confluence. The fluorescence expression intensity was then observed under a fluorescence microscope over 2–4 generations under puromycin treatment; when the fluorescence expression effect reached 98% or more, the THBS1 expression level was verified. The successful construction of THBS1-knockdown and -overexpression cell lines was verified using the fluorescence expression intensity and THBS1 expression levels of the cells, which were then prepared for detecting the effects of THBS1 on their proliferation and apoptosis phenotypes.

4.3. Treatment of THBS1-Knockdown/Overexpression Cell Lines with TGF-β Activator and Inhibitor

To further evaluate the mechanism by which THBS1 regulates MDCK cell proliferation and apoptosis through TGF-β/Smad signalling, we observed the cell growth status with different concentration gradients of the TGF-β/Smad signalling pathway activator SRI-011381 (MCE, Shanghai, China, HY-12075) of THBS1-knockdown cells (THBS1-sh122484) and the inhibitor LY2109761 (MCE, Shanghai, China, HY-100347) of THBS1-overexpressing cells (THBS1-OE). We also identified the optimal concentrations of SRI-011381 for THBS1-knockdown cells (THBS1-sh122484) and LY2109761 for THBS1-overexpressing cells (THBS1-OE) to further determine THBS1’s involvement in the regulation of the TGF-β/Smad signalling pathway.
In total, 5 mg each of the TGF-β pathway activator SRI-011381 and inhibitor LY2109761 powder was added to 5 mL of dimethyl Sulfoxide (DMSO) solution (Solarbio, Beijing, China) to make a master mix of 1 mg/mL, which was stored in an ultra-low-temperature freezer at −80 °C. THBS1-sh-122484 and THBS1-OE cells with good growth statuses were added to 6-well plates, and after they reached 80% confluence, they were washed three times with PBS, and treated with 8 μL, 20 μL, 40 μL, 80 μL, or 200 μL of activator or inhibitor; the control cells received the same volume of DMSO. The stock solutions were added to 4 mL of serum-free DMEM medium to form 2 μg/mL, 5 μg/mL, 10 μg/mL, 20 μg/mL, or 50 μg/mL concentrations, before being added to a 6-well plate with the cells and placed in a 37 °C, 5% CO2 incubator for 3 days. Then, the state of the cells in each treatment group was observed under a microscope and photographed, and at the same time, the effects of the concentration of each treatment (THBS1-sh-122484 + DMSO, THBS1-sh-122484 + SRI011381 (2 μg/mL), THBS1-sh-122484 + SRI011381 (5 μg/mL), THBS1-sh-122484 + SRI011381 (10 μg/mL), THBS1-OE + DMSO, THBS1-OE + LY2109761 (2 μg/mL), THBS1-OE + LY2109761 (5 μg/mL), and THBS1-OE + LY2109761 (10 μg/mL)) were determined. RNA and protein samples were analysed to detect downstream pathway target genes and the effects of THBS1 activation and inhibition.

4.4. RNA Extraction and cDNA Library Construction

The following cells were cultured and prepared: MDCK-M60 and MDCK-CL23 THBS1-sh-con, THBS1-sh-122484, THBS1-sh-122485, THBS1-sh-122486, THBS1-OE-con, and THBS1-OE cells; THBS1-sh-122484 + DMSO, THBS1-sh-122484 + SRI011381 (2 μg/mL), THBS1-sh-122484 + SRI011381 (5 μg/mL), and THBS1-sh-122484 + SRI011381 (10 μg/mL) cells; and THBS1-OE + DMSO, THBS1-OE + LY2109761 (2 μg/mL), THBS1-OE + LY2109761 (5 μg/mL), and THBS1-OE + LY2109761 (10 μg/mL) cells. We extracted RNA using the TRIzol method following the manufacturer’s instructions, and used 1–2 μL of each RNA sample to detect the absorbance at 450 nm. For the detection of RNA extraction concentration and purity, a concentration range of 300–1500 μg/μL was used and an absorbance ratio of 1.8–2.0 was taken to indicate purity.

4.5. Reverse Transcription and RT-qPCR of RNA Samples

The Evo M-MLV Reverse Transcription Premix Kit was purchased from Acer Biologics. Total RNA was isolated and extracted using TRIzol reagent, and then cDNA was synthesised using the Evo M-MLV Reverse Transcription Premix Kit. cDNA from MDCK-M60 and MDCK-CL23 cells was used as the template for RT-qPCR. The expression level of the target gene was detected via PCR. The primer sequences are shown in Table 1. The reaction conditions were as follows: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 10 s, and annealing at 60 °C for 30 s, with a total of 40 cycles. The denaturation curve was analysed at 65 °C for 5 s and 95 °C for 5 min. After the reaction was complete, the data were analysed using F = 2−ΔΔΔCt, and graphs were generated using GraphPad Prism 8 for differential expression analysis of the target genes.

4.6. Western Blotting

We separated the proteins by SDS-PAGE and then transferred them to a membrane. At the end of the experiment, the membrane was blocked with 5% skimmed milk powder in Tris-buffered saline with Tween 20 (TBST) solution for 2 h, and after blocking incubation with the antibody takes place straight away. The THBS1 primary antibody (Abcam, Shanghai, China, ab267388; 1:1000 dilution), EPHB2 primary antibody (Abcam, Shanghai, China, ab307811; 1:1000 dilution), TGF-β1 primary antibody (Bioss, Beijing, China, bs-0086R; 1:1000 dilution), Smad2 primary antibody (Bioss, Beijing, China, bs-0718R; 1:1000 dilution), Smad3 primary antibody (Affinity Biologicals, Ancaster, ON, Canada, AF6362; 1:1000 dilution), TP53 primary antibody (Abcam, Shanghai, China, ab26; 1:1000 dilution), p-TP53 primary antibody (MCE, Shanghai, China, HY-P80472; 1:1000 dilution), Akt primary antibody (Affinity Biologicals, USA, AF0836; 1:1000 dilution), p-Akt primary antibody (Affinity Biologicals, USA, AF0832; 1:1000 dilution), SCARB2 primary antibody (Abcam, Shanghai, China, ab26; 1:1000 dilution), and endogenous β-actin primary antibody (Abcam, Shanghai, China, ab8226; 1:2000 dilution) were incubated with the membrane at room temperature for 2 h or overnight at 4 °C. Then, the membrane was washed three times with TBST (5 min/times) and the goat anti-rabbit IgG secondary antibody (Bioss, Beijing, China, bs-80295G-HRP;1:5000 dilution) was incubated with it at room temperature for 1 h. It was then washed three times with TBST (5 min/time) and photographed after colour development via the ECL method. Then, the grey value of the protein bands was determined using Image J 1.8.0 software, and the protein grey expression was statistically analysed using GraphPad Prism 8.0 software.

4.7. Cell Proliferative Capacity Assay

Well-grown MDCK-M60, MDCK-CL23, THBS1-sh-con, THBS1-sh-122484, THBS1-OE-con, THBS1-OE, THBS1-sh-122484 + DMSO, THBS1-sh-122484 + SRI011381 (5 μg/mL), THBS1-OE + DMSO, and THBS1-OE + LY2109761 (10 μg/mL) cells were detached with the help of trypsin and counted, 24-well plates were seeded at 0.5 × 104 cells/mL, and 1 mL of 10% NBS DMEM medium was added to each well. Then, counting was carried out for 8 consecutive days, and the average value was calculated from the three replicate wells of each group to plot the cell growth curve.

4.8. Detection of Apoptotic Capacity

MDCK-M60, MDCK-CL23, THBS1-sh-con, THBS1-sh-122484, THBS1-OE-con, and THBS1-OE cells with good growth statuses were taken from T25 cell vials. A single-cell suspension was prepared and stained with Annexin/PI and analysed by flow cytometry. FITC has green fluorescence, PI has red fluorescence, and the apoptosis level of the cells was analysed.

4.9. Cell Migration Assays

Well-grown MDCK-M60, MDCK-CL23, THBS1-sh-con, THBS1-sh-122484, THBS1-OE-con, THBS1-OE, THBS1-sh-122484 + DMSO, THBS1-sh-122484 + SRI011381 (5 μg/mL), THBS1-OE + DMSO, and THBS1-OE + LY2109761 (10 μg/mL) cells were detached with the help of trypsin and spread on 6-well plates. Then, 3 mL of 10% NBS DMEM medium was added to each well, and when the cells reached 100% confluence, they were scratched with a pipette tip. The data of the cell healing degree were analysed using Image J software, and difference analysis was performed using GraphPad Prism 8.0 statistical software.

4.10. Analysing the Cell Cycle Viaflow Cytometry

We used THBS1-sh-con, THBS1-sh-122484, THBS1-OE-con, and THBS1-OE cells with good growth statuses after they had reached confluence in T25 cell bottles, discarded the medium, washed them with PBS three times, added 1 mL of pancreatic enzyme to detach the cells completely, and then added DMEM medium to terminate the digestion. We transferred the cell suspension to a centrifuge tube for centrifugation at 1000 rpm for 5 min. Then, the medium was discarded and the cells were resuspended in PBS to make a cell suspension for washing, and the cells were transferred to a 1.5 mL centrifuge tube and centrifuged at 1000 rpm for 5 min to collect the cells, after which pre-cooled 70% ethanol was added and the cells were fixed at 4 °C for 1–4 h. After centrifugation and removing the fixing solution, the cells were resuspended in 1 mL of pre-cooled PBS. We then added 100 μL of PI staining solution to make a final concentration of 100 μg/mL, performed staining in the absence of light for 30 min, and analysed the cell cycle changes using flow cytometry.

4.11. H1N1 Influenza Virus Infects MDCK Cells

In this experiment, to study the effects of THBS1 knockdown on influenza virus replication in CL23 cells and THBS1 overexpression on influenza virus replication in M60 cells, we used well-grown, stably transfected THBS1-sh-con, THBS1-sh-122484, THBS1-OE-con, and THBS1-OE cells. They were grown in 6-well plates until they reached 90% confluence. Then, they were detached with 0.25% trypsin (Lanzhou Bailing, Lanzhou, China, CPT101.02) and counted, washed three times with PBS, and resuspended in serum-free DMEM medium. The number of cells was used to determine the volume of H1N1 virus fluid required to infect the cells in each group (MOI = 0.001). Then, we collected the virus infection supernatant, RNA samples, and protein samples at 36 h, 48 h, and 72 h, to determine the protein expression levels for the H1N1 influenza virus.

4.12. Statistical Analysis

All of the data used in this experiment are expressed as mean ± standard error of measurement (SEM) and were analysed using GraphPad Prism 8.0 software for paired samples t-test data variance analysis.

Author Contributions

K.Y. and Z.Q. contributed to conception and design of the study. R.L. and F.Z. performed the experiments and organised the database. L.W. and S.W. performed the statistical analysis. M.Z., J.W. and Y.Z. wrote the first draft of the manuscript. X.T. and W.C. wrote sections of the manuscript. All authors contributed to manuscript revision, read, and approved the submitted version. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (31860687); Provincial Talent Programme in Gansu Province (2025QNGR63); The Natural Science Foundation of Gansu Province (24JRRA155); The Universities teacher innovation Funds Program of Gansu Province (2023B-055); The Fundamental Research Funds for the Central Universities in Northwest Minzu University (3192024125-01); and Lanzhou Youth Science and Technology Talent Innovation Project (2023-QN-70).

Institutional Review Board Statement

The study did not require ethical approval.

Informed Consent Statement

Not applicable.

Data Availability Statement

Mandates data sharing and peer reviews data.

Conflicts of Interest

The authors have no conflicts of interest to declare.

References

  1. Uyeki, T.M.; Hui, D.S.; Zambon, M.; Wentworth, D.E.; Monto, A.S. Influenza. Lancet 2022, 400, 693–706. [Google Scholar] [CrossRef] [PubMed]
  2. Guan, L.; Ping, J.; Lopes, T.J.S.; Fan, S.; Presler, R.; Neumann, G.; Kawaoka, Y. Development of an Enhanced High-Yield Influenza Vaccine Backbone in Embryonated Chicken Eggs. Vaccines 2023, 11, 1364. [Google Scholar] [CrossRef] [PubMed]
  3. Chia, M.Y.; Lin, C.Y.; Chen, P.L.; Lai, C.C.; Weng, T.C.; Sung, W.C.; Hu, A.Y.; Lee, M.S. Characterization and Immunogenicity of Influenza H7N9 Vaccine Antigens Produced Using a Serum-Free Suspension MDCK Cell-Based Platform. Viruses 2022, 14, 1937. [Google Scholar] [CrossRef] [PubMed]
  4. Qiu, Z.; Guo, S.; Liu, G.; Pei, M.; Liao, Y.; Wang, J.; Zhang, J.; Yang, D.; Qiao, Z.; Li, Z.; et al. TGM2 inhibits the proliferation, migration and tumorigenesis of MDCK cells. PLoS ONE 2023, 18, e0285136. [Google Scholar] [CrossRef]
  5. Feng, S.Z.; Jiao, P.R.; Qi, W.B.; Fan, H.Y.; Liao, M. Development and strategies of cell-culture technology for influenza vaccine. Appl. Microbiol. Biotechnol. 2011, 89, 893–902. [Google Scholar] [CrossRef] [PubMed]
  6. Yang, Z.; Yu, S.; Xu, Y.; Zhao, Y.; Li, L.; Sun, J.; Wang, X.; Guo, Y.; Zhang, Y. The Screening and Mechanism of Influenza-Virus Sensitive MDCK Cell Lines for Influenza Vaccine Production. Diseases 2024, 12, 20. [Google Scholar] [CrossRef]
  7. Bruckhoff, B. The production of influenza vaccines from MDCK cell cultures. Pharm. Unserer Zeit 2011, 40, 140–142. [Google Scholar] [CrossRef]
  8. Ma, G.L.; Qiao, Z.L.; He, D.; Wang, J.; Kong, Y.Y.; Xin, X.Y.; Wen, F.Q.; Bao, S.J.; Ma, Z.R.; Wang, F.S.; et al. Establishment of a low-tumorigenic MDCK cell line and study of differential molecular networks. Biologicals 2020, 68, 112–121. [Google Scholar] [CrossRef]
  9. Short, S.M.; Derrien, A.; Narsimhan, R.P.; Lawler, J.; Ingber, D.E.; Zetter, B.R. Inhibition of endothelial cell migration by thrombospondin-1 type-1 repeats is mediated by beta1 integrins. J. Cell Biol. 2005, 168, 643–653. [Google Scholar] [CrossRef] [PubMed]
  10. Takahashi, K.; Sumarriva, K.; Kim, R.; Jiang, R.; Brantley-Sieders, D.M.; Chen, J.; Mernaugh, R.L.; Takahashi, T. Determination of the CD148-Interacting Region in Thrombospondin-1. PLoS ONE 2016, 11, e0154916. [Google Scholar] [CrossRef]
  11. Jiang, D.; Guo, B.; Lin, F.; Hui, Q.; Tao, K. Effect of THBS1 on the Biological Function of Hypertrophic Scar Fibroblasts. BioMed Res. Int. 2020, 2020, 8605407. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, Y.; Xu, Y.; Xiao, F.; Zhang, J.; Wang, Y.; Yao, Y.; Yang, J. Comprehensive Analysis of a circRNA-miRNA-mRNA Network to Reveal Potential Inflammation-Related Targets for Gastric Adenocarcinoma. Mediat. Inflamm. 2020, 2020, 9435608. [Google Scholar] [CrossRef]
  13. Isenberg, J.S.; Roberts, D.D. THBS1 (thrombospondin-1). Atlas Genet. Cytogenet. Oncol. Haematol. 2020, 24, 291–299. [Google Scholar] [CrossRef]
  14. Rosini, S.; Pugh, N.; Bonna, A.M.; Hulmes, D.J.S.; Farndale, R.W.; Adams, J.C. Thrombospondin-1 promotes matrix homeostasis by interacting with collagen and lysyl oxidase precursors and collagen cross-linking sites. Sci. Signal. 2018, 11, eaar2566. [Google Scholar] [CrossRef]
  15. Isenberg, J.S.; Hyodo, F.; Ridnour, L.A.; Shannon, C.S.; Wink, D.A.; Krishna, M.C.; Roberts, D.D. Thrombospondin 1 and vasoactive agents indirectly alter tumor blood flow. Neoplasia 2008, 10, 886–896. [Google Scholar] [CrossRef] [PubMed]
  16. Lv, Y.; Huang, Y.; Fan, H.; Zhao, Y.; Ma, L.; Lan, Y.; Li, C.; Chen, P.; Lou, Z.; Zhou, J. 17β-Estradiol inhibits hydrogen peroxide-induced senescence and apoptosis in human umbilical vein endothelial cells by regulating the THBS1/TGF-β/Smad axis. Mol. Cell Endocrinol. 2024, 580, 112111. [Google Scholar] [CrossRef]
  17. Rouanne, M.; Adam, J.; Goubar, A.; Robin, A.; Ohana, C.; Louvet, E.; Cormier, J.; Mercier, O.; Dorfmüller, P.; Fattal, S.; et al. Osteopontin and thrombospondin-1 play opposite roles in promoting tumor aggressiveness of primary resected non-small cell lung cancer. BMC Cancer 2016, 16, 483. [Google Scholar] [CrossRef] [PubMed]
  18. Nakao, T.; Kurita, N.; Komatsu, M.; Yoshikawa, K.; Iwata, T.; Utsunomiya, T.; Shimada, M. Expression of thrombospondin-1 and Ski are prognostic factors in advanced gastric cancer. Int. J. Clin. Oncol. 2011, 16, 145–152. [Google Scholar] [CrossRef] [PubMed]
  19. Isenberg, J.S.; Martin-Manso, G.; Maxhimer, J.B.; Roberts, D.D. Regulation of nitric oxide signalling by thrombospondin 1: Implications for anti-angiogenic therapies. Nat. Rev. Cancer 2009, 9, 182–194. [Google Scholar] [CrossRef]
  20. Poon, R.T.; Chung, K.K.; Cheung, S.T.; Lau, C.P.; Tong, S.W.; Leung, K.L.; Yu, W.C.; Tuszynski, G.P.; Fan, S.T. Clinical significance of thrombospondin 1 expression in hepatocellular carcinoma. Clin. Cancer Res. 2004, 10 Pt 1, 4150–4157. [Google Scholar] [CrossRef] [PubMed]
  21. Panetti, T.S.; Chen, H.; Misenheimer, T.M.; Getzler, S.B.; Mosher, D.F. Endothelial cell mitogenesis induced by LPA: Inhibition by thrombospondin-1 and thrombospondin-2. J. Lab. Clin. Med. 1997, 129, 208–216. [Google Scholar] [CrossRef] [PubMed]
  22. Zhao, H.Y.; Ooyama, A.; Yamamoto, M.; Ikeda, R.; Haraguchi, M.; Tabata, S.; Furukawa, T.; Che, X.F.; Zhang, S.; Oka, T.; et al. Molecular basis for the induction of an angiogenesis inhibitor, thrombospondin-1, by 5-fluorouracil. Cancer Res. 2008, 68, 7035–7041. [Google Scholar] [CrossRef]
  23. Dailey, L.; Ambrosetti, D.; Mansukhani, A.; Basilico, C. Mechanisms underlying differential responses to FGF signaling. Cytokine Growth Factor. Rev. 2005, 16, 233–247. [Google Scholar] [CrossRef] [PubMed]
  24. Lawler, J. Counter regulation of tumor angiogenesis by vascular endothelial growth factor and thrombospondin-1. Semin. Cancer Biol. 2022, 86 Pt 2, 126–135. [Google Scholar] [CrossRef]
  25. Shih, H.J.; Chen, C.L.; Torng, P.L. IGFBP3 inhibits angiogenesis through intracellular regulation of THBS1 expression. Am. J. Cancer Res. 2020, 10, 1728–1744. [Google Scholar]
  26. Wang, Y.; Chen, J.; Gao, W.Q.; Yang, R. METTL14 promotes prostate tumorigenesis by inhibiting THBS1 via an m6A-YTHDF2-dependent mechanism. Cell Death Discov. 2022, 8, 143. [Google Scholar] [CrossRef] [PubMed]
  27. Li, C.; Yue, L.; Ju, Y.; Wang, J.; Lu, H.; Li, L.; Chen, M.; Wang, C.; Li, S.; Liu, T.; et al. Transcriptomic analysis for the retested positive COVID-19 patients with long-term persistent SARS-CoV-2 but without symptoms in Wuhan. Clin. Transl. Med. 2023, 13, e1172. [Google Scholar] [CrossRef]
  28. Li, F.; Liu, B.; Xiong, Y.; Zhang, Z.; Zhang, Q.; Qiu, R.; Peng, F.; Nian, X.; Wu, D.; Li, X.; et al. Enhanced Downstream Processing for a Cell-Based Avian Influenza (H5N1) Vaccine. Vaccines 2024, 12, 138. [Google Scholar] [CrossRef]
  29. Omeir, R.; Thomas, R.; Teferedegne, B.; Williams, C.; Foseh, G.; Macauley, J.; Brinster, L.; Beren, J.; Peden, K.; Breen, M.; et al. A novel canine kidney cell line model for the evaluation of neoplastic development: Karyotype evolution associated with spontaneous immortalization and tumorigenicity. Chromosome Res. 2015, 23, 663–680. [Google Scholar] [CrossRef] [PubMed]
  30. Jian, S.; Di, Y.; Lingwei, H.; Zhenbin, L.; Jiamin, W.; Zhiyong, M.; Ayimuguli, A.; Zhihua, Q. MiR-2779-x, a Key microRNA that is Related to the Tumorigenicity of the MDCK Cell Line. Res. Sq. 2024. [Google Scholar] [CrossRef]
  31. Liu, Z.; Pei, M.; Liu, G.; Qiu, Z.; Wang, S.; Qiao, Z.; Wang, J.; Jin, D.; Zhang, J.; Duan, K.; et al. CDC20 is a potential target gene to inhibit the tumorigenesis of MDCK cells. Biologicals 2023, 83, 101697. [Google Scholar] [CrossRef] [PubMed]
  32. Qiao, Z.; Yang, D.; Liu, L.; Liu, Z.; Wang, J.; He, D.; Wu, H.; Wang, J.; Ma, Z. Genome-wide identification and characterization of long non-coding RNAs in MDCK cell lines with high and low tumorigenicities. Genomics 2020, 112, 1077–1086. [Google Scholar] [CrossRef] [PubMed]
  33. Le, Y.; Zhang, J.; Gong, Z.; Zhang, Z.; Nian, X.; Li, X.; Yu, D.; Ma, N.; Zhou, R.; Zhang, G.; et al. TRAF3 deficiency in MDCK cells improved sensitivity to the influenza A virus. Heliyon 2023, 9, e19246. [Google Scholar] [CrossRef] [PubMed]
  34. Lin, Y.; Wharton, S.A.; Whittaker, L.; Dai, M.; Ermetal, B.; Lo, J.; Pontoriero, A.; Baumeister, E.; Daniels, R.S.; McCauley, J.W. The characteristics and antigenic properties of recently emerged subclade 3C. 3a and 3C.2a human influenza A(H3N2) viruses passaged in MDCK cells. Influenza Other Respir. Viruses 2017, 11, 263–274. [Google Scholar] [CrossRef] [PubMed]
  35. Jing, W.; Zhang, X.; Sun, W.; Hou, X.; Yao, Z.; Zhu, Y. CRISPR/CAS9-Mediated Genome Editing of miRNA-155 Inhibits Proinflammatory Cytokine Production by RAW264.7 Cells. BioMed Res. Int. 2015, 2015, 1–7. [Google Scholar] [CrossRef] [PubMed]
  36. Teng, Y.; Luo, M.; Yu, T.; Chen, L.; Huang, Q.; Chen, S.; Xie, L.; Zeng, Y.; Luo, F.; Xiong, H.; et al. CRISPR/Cas9-mediated deletion of miR-146a enhances antiviral response in HIV-1 infected cells. Genes. Immun. 2019, 20, 327–337. [Google Scholar] [CrossRef] [PubMed]
  37. Chang, H.; Yi, B.; Ma, R.; Zhang, X.; Zhao, H.; Xi, Y. CRISPR/cas9, a novel genomic tool to knock down microRNA in vitro and in vivo. Sci. Rep. 2016, 6, 22312. [Google Scholar] [CrossRef]
  38. Jiang, D.; Guo, B.; Lin, F.; Lin, S.; Tao, K. miR-205 inhibits the development of hypertrophic scars by targeting THBS1. Aging 2020, 12, 22046–22058. [Google Scholar] [CrossRef] [PubMed]
  39. Jiang, Y.; Pagadala, J.; Miller, D.D.; Steinle, J.J. Insulin-like growth factor-1 binding protein 3 (IGFBP-3) promotes recovery from trauma-induced expression of inflammatory and apoptotic factors in retina. Cytokine 2014, 70, 115–119. [Google Scholar] [CrossRef][Green Version]
  40. Resovi, A.; Pinessi, D.; Chiorino, G.; Taraboletti, G. Current understanding of the thrombospondin-1 interactome. Matrix Biol. 2014, 37, 83–91. [Google Scholar] [CrossRef]
  41. Calzada, M.J.; Roberts, D.D. Novel integrin antagonists derived from thrombospondins. Curr. Pharm. Des. 2005, 11, 849–866. [Google Scholar] [CrossRef] [PubMed]
  42. Bender, H.R.; Campbell, G.E.; Aytoda, P.; Mathiesen, A.H.; Duffy, D.M. Thrombospondin 1 (THBS1) Promotes Follicular Angiogenesis, Luteinization, and Ovulation in Primates. Front. Endocrinol. 2019, 10, 727. [Google Scholar] [CrossRef] [PubMed]
  43. Wu, X.Y.; Fang, Y.; Zheng, F.X.; Zhang, Y.Z.; Li, Q.L. LncRNA NEAT1 facilitates the progression of sepsis through up-regulating TSP-1 via sponging miR-370-3p. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 333–344. [Google Scholar] [CrossRef]
  44. Kamijo, H.; Miyagaki, T.; Takahashi-Shishido, N.; Nakajima, R.; Oka, T.; Suga, H.; Sugaya, M.; Sato, S. Thrombospondin-1 promotes tumor progression in cutaneous T-cell lymphoma via CD47. Leukemia 2020, 34, 845–856. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, W. TGF-β Regulation of T Cells. Annu. Rev. Immunol. 2023, 41, 483–512. [Google Scholar] [CrossRef] [PubMed]
  46. Chen, W.; Ten Dijke, P. Immunoregulation by members of the TGFβ superfamily. Nat. Rev. Immunol. 2016, 16, 723–740. [Google Scholar] [CrossRef] [PubMed]
  47. Kulkarni, A.B.; Huh, C.G.; Becker, D.; Geiser, A.; Lyght, M.; Flanders, K.C.; Roberts, A.B.; Sporn, M.B.; Ward, J.M.; Karlsson, S. Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proc. Natl. Acad. Sci. USA 1993, 90, 770–774. [Google Scholar] [CrossRef] [PubMed]
  48. Zhao, B.; Yin, J.; Ding, L.; Luo, J.; Luo, J.; Mu, J.; Pan, S.; Du, J.; Zhong, Y.; Zhang, L.; et al. SPAG6 regulates cell proliferation and apoptosis via TGF-β/Smad signal pathway in adult B-cell acute lymphoblastic leukemia. Int. J. Hematol. 2024, 119, 119–129. [Google Scholar] [CrossRef] [PubMed]
  49. Siegel, P.M.; Massagué, J. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer 2003, 3, 807–821. [Google Scholar] [CrossRef]
  50. Lin, H.K.; Bergmann, S.; Pandolfi, P.P. Deregulated TGF-beta signaling in leukemogenesis. Oncogene 2005, 24, 5693–5700. [Google Scholar] [CrossRef] [PubMed]
  51. Ikushima, H.; Miyazono, K. TGF-β signal transduction spreading to a wider field: A broad variety of mechanisms for context-dependent effects of TGF-β. Cell Tissue Res. 2012, 347, 37–49. [Google Scholar] [CrossRef] [PubMed]
  52. Spender, L.C.; Inman, G.J. TGF-beta induces growth arrest in Burkitt lymphoma cells via transcriptional repression of E2F-1. J. Biol. Chem. 2009, 284, 1435–1442. [Google Scholar] [CrossRef]
  53. Naka, K.; Hirao, A. Regulation of Hematopoiesis and Hematological Disease by TGF-β Family Signaling Molecules. Cold Spring Harb. Perspect. Biol. 2017, 9, a027987. [Google Scholar] [CrossRef] [PubMed]
  54. Derynck, R.; Zhang, Y.E. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 2003, 425, 577–584. [Google Scholar] [CrossRef] [PubMed]
  55. Massagué, J. TGFbeta signaling: Receptors, transducers, and Mad proteins. Cell 1996, 85, 947–950. [Google Scholar] [CrossRef] [PubMed]
  56. Takimoto, T.; Wakabayashi, Y.; Sekiya, T.; Inoue, N.; Morita, R.; Ichiyama, K.; Takahashi, R.; Asakawa, M.; Muto, G.; Mori, T.; et al. Smad2 and Smad3 are redundantly essential for the TGF-beta-mediated regulation of regulatory T plasticity and Th1 development. J. Immunol. 2010, 185, 842–855. [Google Scholar] [CrossRef] [PubMed]
  57. Lee, S.M.; Han, Y.; Cho, K.H. Deep learning untangles the resistance mechanism of p53 reactivator in lung cancer cells. iScience 2023, 26, 108377. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Proliferation- and apoptosis-related gene detection in CL23 cells and M60 cells. (a) Proliferation- and apoptosis-related genes were expressed at the mRNA level in CL23 cells and M60 cells. (b) Proliferation- and apopto sis-related genes were expressed at the protein level in CL23 cells and M60 cells. (c) THBS1 and EPHB2 protein level expression in CL23 cells and tumourigenic M60 cells. Differential grey value analysis. * indicates statistically significant difference (*** p < 0.001) and no * indicates no difference.
Figure 1. Proliferation- and apoptosis-related gene detection in CL23 cells and M60 cells. (a) Proliferation- and apoptosis-related genes were expressed at the mRNA level in CL23 cells and M60 cells. (b) Proliferation- and apopto sis-related genes were expressed at the protein level in CL23 cells and M60 cells. (c) THBS1 and EPHB2 protein level expression in CL23 cells and tumourigenic M60 cells. Differential grey value analysis. * indicates statistically significant difference (*** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g001
Figure 2. Analysis of proliferation, apoptosis, and migration ability of M60 cells and CL23 cells. (a) Growth curves of M60 cells and CL23 cells. (b,c) Levels of apoptosis of M60 cells and CL23 cells. (d,e) Levels of migration of M60 cells and CL23 cells. * indicates a statistically significant difference between tumour-free MDCK cells and tumour-forming MDCK cells (* p < 0.05; *** p < 0.001) and no * indicates no difference.
Figure 2. Analysis of proliferation, apoptosis, and migration ability of M60 cells and CL23 cells. (a) Growth curves of M60 cells and CL23 cells. (b,c) Levels of apoptosis of M60 cells and CL23 cells. (d,e) Levels of migration of M60 cells and CL23 cells. * indicates a statistically significant difference between tumour-free MDCK cells and tumour-forming MDCK cells (* p < 0.05; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g002aIjms 26 00395 g002b
Figure 3. Construction and characterisation of MDCK cell lines stably knocking down and overexpressing THBS1. (a) Bright field and fluorescence expression of cells after puromycin screening of knockdown control cells THBS1-sh-con puromycin; bright field and fluorescence expression of cells after puromycin screening of knockdown cells THBS1-sh-122484 locus; knockdown cells THBS1-sh-122485 locus puromycin screened for cell bright field and fluorescence expression; knockdown cells THBS1-sh-122486 locus puromycin screened for cell bright field and fluorescence expression; overexpression of control cells THBS1-OE-con puromycin screened for cell bright field and fluorescence expression; overexpression of THBS1-OE cells’ bright field and fluorescence expression after puromycin screening. (b) Differential expression of THBS1 mRNA levels in stable knockdown THBS1 cells. (c) Differential expression of THBS1 mRNA levels in stable overexpression THBS1 cells. (d) Differential expression of THBS1 protein levels in stable knockdown and overexpression THBS1 cells. (e,f) Differential expression of THBS1 protein levels in stable knockdown and overexpression cells. Grey scale value analysis of THBS1 protein level expression differences in THBS1 cells. * indicates statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 3. Construction and characterisation of MDCK cell lines stably knocking down and overexpressing THBS1. (a) Bright field and fluorescence expression of cells after puromycin screening of knockdown control cells THBS1-sh-con puromycin; bright field and fluorescence expression of cells after puromycin screening of knockdown cells THBS1-sh-122484 locus; knockdown cells THBS1-sh-122485 locus puromycin screened for cell bright field and fluorescence expression; knockdown cells THBS1-sh-122486 locus puromycin screened for cell bright field and fluorescence expression; overexpression of control cells THBS1-OE-con puromycin screened for cell bright field and fluorescence expression; overexpression of THBS1-OE cells’ bright field and fluorescence expression after puromycin screening. (b) Differential expression of THBS1 mRNA levels in stable knockdown THBS1 cells. (c) Differential expression of THBS1 mRNA levels in stable overexpression THBS1 cells. (d) Differential expression of THBS1 protein levels in stable knockdown and overexpression THBS1 cells. (e,f) Differential expression of THBS1 protein levels in stable knockdown and overexpression cells. Grey scale value analysis of THBS1 protein level expression differences in THBS1 cells. * indicates statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g003aIjms 26 00395 g003bIjms 26 00395 g003c
Figure 4. Effects of knockdown of THBS1 on proliferation, apoptosis, migration, and cell cycle of CL23 cells. (a) Growth curves of stably knocked down THBS1 cell lines. (b) Analysis of migratory ability of stably knocked down THBS1 cell lines. (c) Analysis of apoptotic ability of stably knocked down THBS1 cell lines. (d) Analysis of cell cycle of stably knocked down THBS1 cell lines. * denotes statistically significant difference (* p < 0.05; ** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 4. Effects of knockdown of THBS1 on proliferation, apoptosis, migration, and cell cycle of CL23 cells. (a) Growth curves of stably knocked down THBS1 cell lines. (b) Analysis of migratory ability of stably knocked down THBS1 cell lines. (c) Analysis of apoptotic ability of stably knocked down THBS1 cell lines. (d) Analysis of cell cycle of stably knocked down THBS1 cell lines. * denotes statistically significant difference (* p < 0.05; ** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g004
Figure 5. Effects of overexpression of THBS1 on proliferation, apoptosis, migration, and cell cycle of M60 cells. (a) Growth curves of stable overexpression of THBS1 cell lines. (b) Analysis of migration ability of stable overexpression of THBS1 cell lines. (c) Analysis of apoptosis ability of stable overexpression of THBS1 cell lines. (d) Analysis of cell cycle of stable overexpression of THBS1 cell lines. * denotes statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 5. Effects of overexpression of THBS1 on proliferation, apoptosis, migration, and cell cycle of M60 cells. (a) Growth curves of stable overexpression of THBS1 cell lines. (b) Analysis of migration ability of stable overexpression of THBS1 cell lines. (c) Analysis of apoptosis ability of stable overexpression of THBS1 cell lines. (d) Analysis of cell cycle of stable overexpression of THBS1 cell lines. * denotes statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g005aIjms 26 00395 g005b
Figure 6. Effect of knockdown and overexpression of THBS1 on H1N1 influenza virus replication in MDCK cells. (a,b) Differences in expression of NP and NS1 mRNA levels across time of H1N1 influenza virus infection in stably knocked down THBS1 cell lines. (c,d) Differences in expression of NP protein levels across time of H1N1 influenza virus infection in stably knocked down THBS1 cell lines. (e,f) Stable overexpression of THBS1 cell lines infected with H1N1 influenza virus different time period NP and NS1 mRNA level expression differences. (g,h) Stable overexpression of THBS1 cell lines infected with H1N1 influenza virus different time period NP protein level expression differences. * indicates statistically significant difference (* p < 0.05; *** p < 0.001) and no * indicates no difference.
Figure 6. Effect of knockdown and overexpression of THBS1 on H1N1 influenza virus replication in MDCK cells. (a,b) Differences in expression of NP and NS1 mRNA levels across time of H1N1 influenza virus infection in stably knocked down THBS1 cell lines. (c,d) Differences in expression of NP protein levels across time of H1N1 influenza virus infection in stably knocked down THBS1 cell lines. (e,f) Stable overexpression of THBS1 cell lines infected with H1N1 influenza virus different time period NP and NS1 mRNA level expression differences. (g,h) Stable overexpression of THBS1 cell lines infected with H1N1 influenza virus different time period NP protein level expression differences. * indicates statistically significant difference (* p < 0.05; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g006aIjms 26 00395 g006b
Figure 7. Differential expression of target genes downstream of PI3K/Akt, P53, and TGF-β/Smad signalling pathways, as well as the predicted THBS1-interacting gene, SCARB2, in M60 and CL23 cells. (a,b) Differential expression of target genes downstream of the PI3K/Akt, P53, and TGF-β/Smad signalling pathways, as well as SCARB2 at mRNA level. (c,d) Differential expression of target genes downstream of the TGF-β/Smad signalling pathway and SCARB2 at the protein level. * indicates statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 7. Differential expression of target genes downstream of PI3K/Akt, P53, and TGF-β/Smad signalling pathways, as well as the predicted THBS1-interacting gene, SCARB2, in M60 and CL23 cells. (a,b) Differential expression of target genes downstream of the PI3K/Akt, P53, and TGF-β/Smad signalling pathways, as well as SCARB2 at mRNA level. (c,d) Differential expression of target genes downstream of the TGF-β/Smad signalling pathway and SCARB2 at the protein level. * indicates statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g007
Figure 8. Effects of knockdown and overexpression of THBS1 on the differential expression of target genes downstream of TGF-β/Smad, PI3K/Akt, P53 signalling pathways, and SCARB2 in MDCK cells. (a,b) Effects of knockdown of THBS1 on the differential expression of target genes downstream of PI3K/Akt, P53, TGF-β/Smad signalling, and the SCARB2 mRNA level expression differences in CL23 cells. (c,d) Differential effects of overexpression of THBS1 on the expression of target genes downstream of PI3K/Akt, P53, TGF-β/Smad signalling, and SCARB2 at the mRNA level in M60 cells. (e) Differential effects of knockdown and overexpression of THBS1 on the expression of target genes downstream of the PI3K/Akt, P53, TGF-β/Smad signalling pathways in MDCK cells, and the SCARB2 protein level expression differences. (f,g) Grey value analysis of knockdown and overexpression of THBS1 on the expression of target genes downstream of the PI3K/Akt, P53, and TGF-β/Smad signalling pathways, as well as SCARB2 protein level in MDCK cells. * indicates statistically significant difference (* p < 0.05; ** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 8. Effects of knockdown and overexpression of THBS1 on the differential expression of target genes downstream of TGF-β/Smad, PI3K/Akt, P53 signalling pathways, and SCARB2 in MDCK cells. (a,b) Effects of knockdown of THBS1 on the differential expression of target genes downstream of PI3K/Akt, P53, TGF-β/Smad signalling, and the SCARB2 mRNA level expression differences in CL23 cells. (c,d) Differential effects of overexpression of THBS1 on the expression of target genes downstream of PI3K/Akt, P53, TGF-β/Smad signalling, and SCARB2 at the mRNA level in M60 cells. (e) Differential effects of knockdown and overexpression of THBS1 on the expression of target genes downstream of the PI3K/Akt, P53, TGF-β/Smad signalling pathways in MDCK cells, and the SCARB2 protein level expression differences. (f,g) Grey value analysis of knockdown and overexpression of THBS1 on the expression of target genes downstream of the PI3K/Akt, P53, and TGF-β/Smad signalling pathways, as well as SCARB2 protein level in MDCK cells. * indicates statistically significant difference (* p < 0.05; ** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g008aIjms 26 00395 g008b
Figure 9. Determination of optimal concentration of TGF-β activator SRI-011381 on THBS1-sh-122484 cells and inhibitor LY2109761 on THBS1-OE cells, and its effect on the expression of target genes, THBS1, downstream of TGF-β/Smad signalling. (a) Effect of different concentrations of SRI-011381 on the growth status of THBS1-sh-122484 cells. (b) Effects of different concentrations of LY2109761 on the growth status of THBS1-OE cells. (c) Effects of different concentrations of SRI-011381 on the differential expression of target genes downstream of TGF-β/Smad signalling and THBS1 mRNA levels in THBS1-sh-122484 cells. (d) Effects of different concentrations of LY2109761 on the expression of target genes downstream of TGF-β/Smad signalling and THBS1, and effects of different concentrations of LY2109761 on the expression of target genes downstream of THBS1-Sh-122484 cells. LY2109761 on THBS1-OE cells TGF-β/Smad signalling downstream target genes and THBS1 mRNA level expression differences. (e) Effect of different concentrations of SRI-011381 on THBS1-sh-122484 cells and different concentrations of LY2109761 on THBS1-OE cells TGF-β/Smad signalling downstream target genes and THBS1 protein level expression differences. (f) Grey scale analysis of the effects of different concentrations of SRI-011381 on the expression of target genes and THBS1 protein level downstream of TGF-β/Smad signalling in THBS1-sh-122484 cells. (g) The effects of different concentrations of LY2109761 on the expression of TGF-β/Smad signalling downstream of TGF-β/Smad protein in THBS1-OE cells target gene and THBS1 protein level expression grey value analysis. * indicates statistically significant difference (* p < 0.05; ** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 9. Determination of optimal concentration of TGF-β activator SRI-011381 on THBS1-sh-122484 cells and inhibitor LY2109761 on THBS1-OE cells, and its effect on the expression of target genes, THBS1, downstream of TGF-β/Smad signalling. (a) Effect of different concentrations of SRI-011381 on the growth status of THBS1-sh-122484 cells. (b) Effects of different concentrations of LY2109761 on the growth status of THBS1-OE cells. (c) Effects of different concentrations of SRI-011381 on the differential expression of target genes downstream of TGF-β/Smad signalling and THBS1 mRNA levels in THBS1-sh-122484 cells. (d) Effects of different concentrations of LY2109761 on the expression of target genes downstream of TGF-β/Smad signalling and THBS1, and effects of different concentrations of LY2109761 on the expression of target genes downstream of THBS1-Sh-122484 cells. LY2109761 on THBS1-OE cells TGF-β/Smad signalling downstream target genes and THBS1 mRNA level expression differences. (e) Effect of different concentrations of SRI-011381 on THBS1-sh-122484 cells and different concentrations of LY2109761 on THBS1-OE cells TGF-β/Smad signalling downstream target genes and THBS1 protein level expression differences. (f) Grey scale analysis of the effects of different concentrations of SRI-011381 on the expression of target genes and THBS1 protein level downstream of TGF-β/Smad signalling in THBS1-sh-122484 cells. (g) The effects of different concentrations of LY2109761 on the expression of TGF-β/Smad signalling downstream of TGF-β/Smad protein in THBS1-OE cells target gene and THBS1 protein level expression grey value analysis. * indicates statistically significant difference (* p < 0.05; ** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g009aIjms 26 00395 g009b
Figure 10. Effect of SRI-011381 (5 μg/mL) on the expression of PI3K/Akt, target genes downstream of P53 signalling pathway, SCARB2 in knockdown THBS1 cells (THBS1-sh-122484), and LY2109761 (10 μg/mL) in overexpressing THBS1 (THBS1-OE) cells. (a) SRI-011381 (5 μg/mL) intervention in THBS1-sh-122484 cells showed differential expression of PI3K/Akt, target genes downstream of P53 signalling, and SCARB2 at the mRNA level. (b) LY2109761 (10 μg/mL) intervention in THBS1-OE cells showed differential expression of PI3K/Akt, target genes downstream of P53 signalling, and SCARB2 expression differences at the mRNA level. (c) PI3K/Akt, P53 signalling downstream target genes, and SCARB2 expression differences at the protein level after SRI-011381 (5 μg/mL) intervention in THBS1-sh-122484 cells and LY2109761 (10 μg/mL) intervention in THBS1-OE cells. (d) SRI-011381 (5 μg/mL) intervention in THBS1-sh-122484 cells after PI3K/Akt, P53 signalling downstream target genes, and SCARB2 expression differences at protein level grey value analysis. (e) LY2109761 (10 μg/mL) intervention in THBS1-OE cells after PI3K/Akt, P53 signalling downstream target genes, and SCARB2 expression difference at protein level grey value analysis. * indicates statistically significant difference (* p < 0.05; *** p < 0.001) and no * indicates no difference.
Figure 10. Effect of SRI-011381 (5 μg/mL) on the expression of PI3K/Akt, target genes downstream of P53 signalling pathway, SCARB2 in knockdown THBS1 cells (THBS1-sh-122484), and LY2109761 (10 μg/mL) in overexpressing THBS1 (THBS1-OE) cells. (a) SRI-011381 (5 μg/mL) intervention in THBS1-sh-122484 cells showed differential expression of PI3K/Akt, target genes downstream of P53 signalling, and SCARB2 at the mRNA level. (b) LY2109761 (10 μg/mL) intervention in THBS1-OE cells showed differential expression of PI3K/Akt, target genes downstream of P53 signalling, and SCARB2 expression differences at the mRNA level. (c) PI3K/Akt, P53 signalling downstream target genes, and SCARB2 expression differences at the protein level after SRI-011381 (5 μg/mL) intervention in THBS1-sh-122484 cells and LY2109761 (10 μg/mL) intervention in THBS1-OE cells. (d) SRI-011381 (5 μg/mL) intervention in THBS1-sh-122484 cells after PI3K/Akt, P53 signalling downstream target genes, and SCARB2 expression differences at protein level grey value analysis. (e) LY2109761 (10 μg/mL) intervention in THBS1-OE cells after PI3K/Akt, P53 signalling downstream target genes, and SCARB2 expression difference at protein level grey value analysis. * indicates statistically significant difference (* p < 0.05; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g010aIjms 26 00395 g010b
Figure 11. Effects of SRI-011381 on knockdown THBS1 cells (THBS1-sh-122484) and LY2109761 on proliferation and migration ability of overexpressing THBS1 cells (THBS1-OE). (a) Growth curve of SRI-011381 intervention knockdown THBS1 cells (THBS1-sh-122484). (b,c) SRI-011381 intervention knockdown THBS1 cells (THBS1-sh-122484) migration ability assay. (d) SRI-011381 intervention knockdown THBS1 cells (THBS1-sh-122484) apoptosis ability assay. (e) LY2109761 intervention overexpression THBS1 cells (THBS1-OE) growth curve. (f,g) LY2109761 intervention overexpression THBS1 cells (THBS1-OE) migration ability assay. (h) LY2109761 intervention overexpression THBS1 cells (THBS1-OE) apoptosis ability assay. * indicates statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Figure 11. Effects of SRI-011381 on knockdown THBS1 cells (THBS1-sh-122484) and LY2109761 on proliferation and migration ability of overexpressing THBS1 cells (THBS1-OE). (a) Growth curve of SRI-011381 intervention knockdown THBS1 cells (THBS1-sh-122484). (b,c) SRI-011381 intervention knockdown THBS1 cells (THBS1-sh-122484) migration ability assay. (d) SRI-011381 intervention knockdown THBS1 cells (THBS1-sh-122484) apoptosis ability assay. (e) LY2109761 intervention overexpression THBS1 cells (THBS1-OE) growth curve. (f,g) LY2109761 intervention overexpression THBS1 cells (THBS1-OE) migration ability assay. (h) LY2109761 intervention overexpression THBS1 cells (THBS1-OE) apoptosis ability assay. * indicates statistically significant difference (** p < 0.01; *** p < 0.001) and no * indicates no difference.
Ijms 26 00395 g011aIjms 26 00395 g011b
Table 1. Primer sequences.
Table 1. Primer sequences.
Gene NamePrimer Sequence (5′→3′)
Ataxin-1 (ATXN1)F: CTGAAGAAGGTGGAGGACTTG
R: CCGACGGCAAACTGTATCA
BCL2-Associated X (Bax)F: TCCCCGTGAGGTCTTCTTCC
R: GGGCCTTGAGCACCAGTTT
B-cell lymphoma-2 (Bcl2)F: TCATCCAAGAATGCAAAGCAC
R: CCCGGTTATCGTACCCTGTT
Cyclin D1F: TGCCAGTGGCAGAGGAGAA
R: TGGAGGGTGGGTTGGAAAT
EPH receptor B2 (EPHB2)F: GTACCTGGCAGACATGAACTAC
R: GAAAGCGTGAAAGCCCAAAG
Glyceraldehyde-3-phosphatedehydrogenase (GAPDH)F: TGACGACATCAAGAAGGTAGTG
R: AGTGGGTGTCACTGTTGAAG
Nucleoprotein (NP)F: TGTCAGCTATTATGGAGCTGTTAG
R: TGTCAGCTATTATGGAGCTGTTAG
Non-Structural Protein 1 (NS1)F: CGAAATTTCACCATTGCCTT
R: GTGGAGGTCTCCCATTCTCA
Scavenger Receptor Class B, Member 2 (SCARB2)F: AAGAGCACCCCTCATACGAAC
R: CTCCTCCCTCCTCACTACAACA
Mothers against decapentaplegic homolog 2 (Smad2)F: AGACCTTCCACGCATCACA
R: CACTATCACTTAGGCACTCAGCA
Mothers against decapentaplegic homolog 3 (Smad3)F: TGACCACCAGATGAACCACA
R: TCGCAGTAGGTGACAGGCT
Transforming growth factor-β1 (TGF-β1)F: CTGCCCACCTGGAACCTACT
R: TTCCTTCAAGTCCCAAATGCT
Thrombosponin-1 (THBS1)F: CTATGACAAGGACGGGATTGG
R: ATACTGGGCTGGGTTGTAATG
TP53F: GTTGGCCTGCACAGTTGGT
R: GTTGGCCTGCACAGTTGGT
Uroplakin3A (UPK3A)F: GTGGCCTTTGGCCTGAT
R: GAGGTACGCGTTCAGGATTT
β-actinF: CTGCCCACCTGGAACCTACT
R: TTCCTTCAAGTCCCAAATGCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, R.; Zhang, F.; Wang, L.; Wang, S.; Zhou, M.; Wang, J.; Zhang, Y.; Tan, X.; Chen, W.; Yang, K.; et al. Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling. Int. J. Mol. Sci. 2025, 26, 395. https://doi.org/10.3390/ijms26010395

AMA Style

Li R, Zhang F, Wang L, Wang S, Zhou M, Wang J, Zhang Y, Tan X, Chen W, Yang K, et al. Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling. International Journal of Molecular Sciences. 2025; 26(1):395. https://doi.org/10.3390/ijms26010395

Chicago/Turabian Style

Li, Rui, Fan Zhang, Lijin Wang, Siya Wang, Manlin Zhou, Jun Wang, Yiyang Zhang, Xiao Tan, Weiji Chen, Kun Yang, and et al. 2025. "Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling" International Journal of Molecular Sciences 26, no. 1: 395. https://doi.org/10.3390/ijms26010395

APA Style

Li, R., Zhang, F., Wang, L., Wang, S., Zhou, M., Wang, J., Zhang, Y., Tan, X., Chen, W., Yang, K., & Qiao, Z. (2025). Mechanism of THBS1 Regulation of MDCK Cell Proliferation and Apoptosis Through TGF-β/Smad Signalling. International Journal of Molecular Sciences, 26(1), 395. https://doi.org/10.3390/ijms26010395

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop