Author Contributions
Conceptualization, K.B., E.A.P. and M.G.-H.; methodology, M.G.-H.; validation, K.B. and M.G.-H.; formal analysis, K.B. and M.G.-H.; investigation, R.C.-C., H.M.A.B., N.E., T.M., A.O.-G. and M.J.S.; resources, E.A.P., K.B. and M.G.-H.; writing—original draft preparation, R.C.-C., K.B. and M.G.-H.; writing—review and editing, K.B., E.A.P. and M.G.-H.; visualization, R.C.-C. and M.G.-H.; supervision, M.G.-H.; project administration, M.G.-H.; funding acquisition, M.G.-H. and E.A.P. All authors have read and agreed to the published version of the manuscript.
Figure 1.
PE3 prime editing strategy to generate the isogenic model for an NMNAT1 c.25G>A (p.V9M) mutation. (A). WGS analysis of the genome of the hiPSC line IMR90-clone 4 depicts no variants in the region of interest for NMNAT1 editing compared to the reference human genome hg38. (B). Two gRNAs out of ten were selected for molecular cloning based on the distance to the desired edit position (C). pegRNA1 and (D). pegRNA2 anneal to the complementary DNA strand. Cas9 Nickase nicks the opposite strand, allowing for PBS annealing and reverse transcription along the RT template that incorporates the desired single nucleotide edit (red letter).
Figure 1.
PE3 prime editing strategy to generate the isogenic model for an NMNAT1 c.25G>A (p.V9M) mutation. (A). WGS analysis of the genome of the hiPSC line IMR90-clone 4 depicts no variants in the region of interest for NMNAT1 editing compared to the reference human genome hg38. (B). Two gRNAs out of ten were selected for molecular cloning based on the distance to the desired edit position (C). pegRNA1 and (D). pegRNA2 anneal to the complementary DNA strand. Cas9 Nickase nicks the opposite strand, allowing for PBS annealing and reverse transcription along the RT template that incorporates the desired single nucleotide edit (red letter).
Figure 2.
Validation of PE in HEK-293T cells. (A). Each pegRNA has 3 key components: a gRNA or spacer, a scaffold, and an extension with the PBS and the RTT sequence, which introduces the desired edit. (B). Confluent HEK cells were co-transfected using Lipofectamine 3000 with the pegRNA, the PEmax editor, and a nicking guide plasmid harboring a reporter EGFP cassette. Then, 48 h post-transfection, approximately 80–90% of the HEK cells expressed GFP. Scale bar = 50 μm. (C). Three days after plasmid delivery, genomic DNA was extracted, and PE was analyzed by NGS. pegRNA1 was designed to introduce a G>A edit at +3 position from the nicking site in NMNAT1, and pegRNA2 was designed to introduce the same edit at +14 position from the nicking site. (D). Editing efficiencies were determined by NGS and expressed as the percentage of alleles with G•C target converted to T•A. NGS showed editing only occurred with PE3 with low efficiency: 3.40% for pegRNA1 and 0.42% for peg RNA2.
Figure 2.
Validation of PE in HEK-293T cells. (A). Each pegRNA has 3 key components: a gRNA or spacer, a scaffold, and an extension with the PBS and the RTT sequence, which introduces the desired edit. (B). Confluent HEK cells were co-transfected using Lipofectamine 3000 with the pegRNA, the PEmax editor, and a nicking guide plasmid harboring a reporter EGFP cassette. Then, 48 h post-transfection, approximately 80–90% of the HEK cells expressed GFP. Scale bar = 50 μm. (C). Three days after plasmid delivery, genomic DNA was extracted, and PE was analyzed by NGS. pegRNA1 was designed to introduce a G>A edit at +3 position from the nicking site in NMNAT1, and pegRNA2 was designed to introduce the same edit at +14 position from the nicking site. (D). Editing efficiencies were determined by NGS and expressed as the percentage of alleles with G•C target converted to T•A. NGS showed editing only occurred with PE3 with low efficiency: 3.40% for pegRNA1 and 0.42% for peg RNA2.
Figure 3.
Optimization of PE of hiPSCs for NMNAT1 c.25G>A. (A). Optimization of electroporation conditions for the efficient delivery of PE components in the cells using 1 μg of PEmax editor, 90 ng of nicking guide RNA, and 240 ng of pegRNA1. Three different electroporation parameters were tested. The best condition was 1100 V, 20 ms, and 2 pulses, resulting in the highest cell survival and the highest percentage of edited alleles detected by next-generation sequencing (NGS). (B). Combinatorial screening of different concentrations of PE components. Using the optimal electroporation parameters, a total of 9 different combinations of PE components were assessed to optimize PE efficiency. PEmax was set at 900 ng, and three doses of pegRNA (low, 120 ng; medium (mid), 180 ng; and high, 240 ng) and three doses of nicking guide RNA (low, 90 ng; medium (mid), 120 ng; and high 180 ng) were included. (C). NGS analysis of the bulk electroporated hiPSCs showed the maximum editing efficiency (9.60%) was achieved with high pegRNA1 and low nicking gRNA. (D). PE efficiency under optimized conditions demonstrated a substantial increase in the percentage of GFP-positive cells (66.80%) post-electroporation that translated into a notable increase in editing efficiency. Scale bar = 50 μm.
Figure 3.
Optimization of PE of hiPSCs for NMNAT1 c.25G>A. (A). Optimization of electroporation conditions for the efficient delivery of PE components in the cells using 1 μg of PEmax editor, 90 ng of nicking guide RNA, and 240 ng of pegRNA1. Three different electroporation parameters were tested. The best condition was 1100 V, 20 ms, and 2 pulses, resulting in the highest cell survival and the highest percentage of edited alleles detected by next-generation sequencing (NGS). (B). Combinatorial screening of different concentrations of PE components. Using the optimal electroporation parameters, a total of 9 different combinations of PE components were assessed to optimize PE efficiency. PEmax was set at 900 ng, and three doses of pegRNA (low, 120 ng; medium (mid), 180 ng; and high, 240 ng) and three doses of nicking guide RNA (low, 90 ng; medium (mid), 120 ng; and high 180 ng) were included. (C). NGS analysis of the bulk electroporated hiPSCs showed the maximum editing efficiency (9.60%) was achieved with high pegRNA1 and low nicking gRNA. (D). PE efficiency under optimized conditions demonstrated a substantial increase in the percentage of GFP-positive cells (66.80%) post-electroporation that translated into a notable increase in editing efficiency. Scale bar = 50 μm.
![Ijms 26 00114 g003 Ijms 26 00114 g003]()
Figure 4.
Generation of NMNAT1V9M/V9M isogenic clones. (A). Genotype confirmation and (B). determination of the PE efficiency for NMNAT1 c.25 G>A using Sanger sequencing. PE3 efficiency accounted for over 25.00% of edited clones. Data in (A) are representative of n ≥ 2 independent replicates.
Figure 4.
Generation of NMNAT1V9M/V9M isogenic clones. (A). Genotype confirmation and (B). determination of the PE efficiency for NMNAT1 c.25 G>A using Sanger sequencing. PE3 efficiency accounted for over 25.00% of edited clones. Data in (A) are representative of n ≥ 2 independent replicates.
Figure 5.
Prime editing strategy to generate the isogenic model for PRPF3 c.1482C>T (p.T494M) mutation and for PRPF8 c.6926A>C (p.H2309P) mutation. (A). The gRNA1 anneals with the complementary DNA strand. Cas9 Nickase nicks the PAM-containing strand of the target DNA. The PBS anneals with the PAM-containing strand, and RTase extends the 3′ end using the RT template. (B). pegRNA was selected for molecular cloning based on the distance to the mutation and sequence length. (C). The gRNA1 anneals with the complementary DNA strand. Cas9 Nickase nicks the PAM-containing strand of the target DNA. The PBS anneals with the PAM-containing strand, and RTase extends the 3′ end using the RT template. (D). pegRNA was selected for molecular cloning based on the distance to the mutation and sequence length.
Figure 5.
Prime editing strategy to generate the isogenic model for PRPF3 c.1482C>T (p.T494M) mutation and for PRPF8 c.6926A>C (p.H2309P) mutation. (A). The gRNA1 anneals with the complementary DNA strand. Cas9 Nickase nicks the PAM-containing strand of the target DNA. The PBS anneals with the PAM-containing strand, and RTase extends the 3′ end using the RT template. (B). pegRNA was selected for molecular cloning based on the distance to the mutation and sequence length. (C). The gRNA1 anneals with the complementary DNA strand. Cas9 Nickase nicks the PAM-containing strand of the target DNA. The PBS anneals with the PAM-containing strand, and RTase extends the 3′ end using the RT template. (D). pegRNA was selected for molecular cloning based on the distance to the mutation and sequence length.
Figure 6.
Generation of PRPF3 isogenic clones. (A). Genotype confirmation and (B). determination of the PE efficiency with high pegRNA for PRPF3 c.1482 C>T (p.T494M) using NGS and Sanger sequencing. Data in (A) are representative of n ≥ 2 independent replicates.
Figure 6.
Generation of PRPF3 isogenic clones. (A). Genotype confirmation and (B). determination of the PE efficiency with high pegRNA for PRPF3 c.1482 C>T (p.T494M) using NGS and Sanger sequencing. Data in (A) are representative of n ≥ 2 independent replicates.
Figure 7.
Generation of PRPF8 isogenic clones. (A). Genotype confirmation and (B). determination of the PE efficiency with high and maximal pegRNAs for PRPF8 c.6926 A>C (p.H2309P) using NGS and Sanger sequencing. Data in (A) are representative of n ≥ 2 independent replicates.
Figure 7.
Generation of PRPF8 isogenic clones. (A). Genotype confirmation and (B). determination of the PE efficiency with high and maximal pegRNAs for PRPF8 c.6926 A>C (p.H2309P) using NGS and Sanger sequencing. Data in (A) are representative of n ≥ 2 independent replicates.
Figure 8.
Characterization of hiPSC wild-type NMNAT1+/+, and homozygous NMNAT1−/− clones showing immunofluorescence (IF) images of SOX2+, SSEA4+, OCT+, and NANOG+ cells for pluripotency markers; embryoid bodies exhibiting NESTIN+ and GFAP+ (ectoderm), SMA+ (mesoderm), and SOX17+ (endoderm) for germ layer makers; and chromosomal copy number variation analysis. Representative images from n > 5. Scale bar = 100 μm.
Figure 8.
Characterization of hiPSC wild-type NMNAT1+/+, and homozygous NMNAT1−/− clones showing immunofluorescence (IF) images of SOX2+, SSEA4+, OCT+, and NANOG+ cells for pluripotency markers; embryoid bodies exhibiting NESTIN+ and GFAP+ (ectoderm), SMA+ (mesoderm), and SOX17+ (endoderm) for germ layer makers; and chromosomal copy number variation analysis. Representative images from n > 5. Scale bar = 100 μm.
Figure 9.
Prime editing (PE) pipeline. Our PE pipeline includes the in silico design of the pegRNA components and molecular cloning to ensemble the pegRNAs, the nicking, and the PEmax editor plasmids. We also performed a full QC analysis of the hiPSC lines prior to editing, including evaluating pluripotency and chromosomal abnormalities and assessing the differentiation capacity. Electroporation with different combinations of PE components was performed on highly confluent cultures to generate isogenic models for the NMNAT1, PRPF3, and PRPF8 mutations. After 2–5 days, electroporated hiPSC lines were dissociated into single cells and passaged at low-density seeding (LDS). In parallel, NGS was performed to confirm editing has occurred in the bulk cultures and estimate the number of clones that need to be recovered from the LDS cultures. Single colonies from LDS cultures were manually dissected and passaged by mechanical disruption into 96-well plates, where the desired edit was confirmed through Sanger sequencing analysis. Confirmed edited clones were expanded first to 12-well plates and then to 6-well plates for banking. Cryopreserved seed and master banks were obtained in parallel to the QC analysis of the selected clones.
Figure 9.
Prime editing (PE) pipeline. Our PE pipeline includes the in silico design of the pegRNA components and molecular cloning to ensemble the pegRNAs, the nicking, and the PEmax editor plasmids. We also performed a full QC analysis of the hiPSC lines prior to editing, including evaluating pluripotency and chromosomal abnormalities and assessing the differentiation capacity. Electroporation with different combinations of PE components was performed on highly confluent cultures to generate isogenic models for the NMNAT1, PRPF3, and PRPF8 mutations. After 2–5 days, electroporated hiPSC lines were dissociated into single cells and passaged at low-density seeding (LDS). In parallel, NGS was performed to confirm editing has occurred in the bulk cultures and estimate the number of clones that need to be recovered from the LDS cultures. Single colonies from LDS cultures were manually dissected and passaged by mechanical disruption into 96-well plates, where the desired edit was confirmed through Sanger sequencing analysis. Confirmed edited clones were expanded first to 12-well plates and then to 6-well plates for banking. Cryopreserved seed and master banks were obtained in parallel to the QC analysis of the selected clones.
![Ijms 26 00114 g009 Ijms 26 00114 g009]()
Table 1.
Plasmid combination concentration tested for electroporation.
Table 1.
Plasmid combination concentration tested for electroporation.
| hiPSCs | Low Peg | Low Peg, Medium Nick | Low Peg, High Nick | Medium Peg | Medium Peg, Medium Nick | Medium Peg, High nick | High Peg | High Peg, Medium Nick | High Peg, High Nick |
|---|
| pegRNA (ng) | 120 | 120 | 120 | 180 | 180 | 180 | 240 | 240 | 240 |
| Nicking guide (ng) | 90 | 120 | 180 | 90 | 120 | 180 | 90 | 120 | 180 |
| Editor (ng) | 900 | 900 | 900 | 900 | 900 | 900 | 900 | 900 | 900 |
Table 2.
Candidate primary editing sgRNAs for PRPF3.
Table 2.
Candidate primary editing sgRNAs for PRPF3.
| sgRNA Sequence | Orientation | Distance to Edit Start |
|---|
| AGCTGTTCAAGACCCCACGA | sense | +1 |
| CGTGGGCTTCTACCTTCGTG | antisense | −0 |
| ACGTGGGCTTCTACCTTCGT | antisense | −1 |
| GACGTGGGCTTCTACCTTCG | antisense | −2 |
| TGCCATCTGAGCTCTGACGT | antisense | −17 |
| TTGCCATCTGAGCTCTGACG | antisense | −18 |
| TCTAATTTGATGCGAGTATT | sense | +29 |
| GAGGTTTCCACCCAATCCCA | antisense | −58 |
| TTGGGAAAGGTACTTGCCCG | antisense | −77 |
| CCCCCAGAAGAGTTTGGGAA | antisense | −90 |
| TGGACCCCCCAGAAGAGTTT | antisense | −95 |
| ATGGACCCCCCAGAAGAGTT | antisense | −96 |
| CTCTCCCCTCCCTCCAAATA | antisense | −115 |
| CTGAGGGAAAGAGAGAGCAA | antisense | −142 |
Table 3.
Candidate primary editing sgRNAs for PRPF8.
Table 3.
Candidate primary editing sgRNAs for PRPF8.
| sgRNA Sequence | Orientation | Distance to Edit Start | PAM Edit |
|---|
| AGTTCTACCACGAGGTGCAC | sense | +2 | 1 (G>A) |
| GCAAAGTTGAGGAAGTGAGA | antisense | −6 | 0 |
| AGCAAAGTTGAGGAAGTGAG | antisense | −7 | 0 |
| CCCCAAAGAGTTCTACCACG | sense | +9 | 0 |
| CCTGCAGGAGAGCAAAGTTG | antisense | −17 | 0 |
| AGTAAACCTCCCCCTCCTGC | antisense | −32 | 0 |
| CATGAAATATGAGCTACAGC | sense | +36 | 0 |
| TCCTTCTCCCCGAAGGTGTT | sense | +70 | 0 |
| AGGGAAACGGTCAGGCATAC | antisense | −71 | 0 |
| GGCTGTTTCCTTCTCCCCGA | sense | +77 | 0 |
Table 4.
Candidate primary editing sgRNAs for NMNAT1.
Table 4.
Candidate primary editing sgRNAs for NMNAT1.
| sgRNA Sequence | Orientation | Distance to Edit Start |
|---|
| AAATTCCGAGAAGACTGAAG | sense | +3 |
| GATTGAATGAACCACAAGCA | antisense | −14 |
| ACAACTTCAAGTTCTTACCA | sense | +26 |
| CTGAGGTGCATGTTGGTGAT | antisense | −35 |
| CCTGAGGTGCATGTTGGTGA | antisense | −36 |
| AAACAACCTGAGGTGCATGT | antisense | −42 |
| TGGCCAGCTCAAACAACCTG | antisense | −52 |
| TGTTCCATTCATGTAGTCCT | antisense | −72 |
| TCCTTTGTAGACAACAAGGG | sense | +73 |
| TTTTCCTTTGTAGACAACAA | sense | +76 |
Table 5.
Candidate secondary nicking sgRNAs (PE3) for NMNAT1.
Table 5.
Candidate secondary nicking sgRNAs (PE3) for NMNAT1.
| Nicking sgRNA Sequence | Orientation | Distance to pegRNA Nick |
|---|
| TGGCCAGCTCAAACAACCTG | antisense | −55 |
| AAACAACCTGAGGTGCATGT | antisense | −45 |
| TGTTCCATTCATGTAGTCCT | antisense | −75 |
| CTTGAAGTTGTTGATCTAAA | antisense | −47 |
| ACCTCCCTTGTTGTCTACAA | antisense | −81 |
Table 6.
Primer design for NGS to target region of interest for NMNAT1, PRPF3, and PRPF8.
Table 6.
Primer design for NGS to target region of interest for NMNAT1, PRPF3, and PRPF8.
| Gene | Forward Primer | Reverse Primer |
|---|
| NMNAT1 | ACAACAAGGGAGGTGTCACAG | GACTACATGAATGGAACAGGTA |
| PRPF3 | CACTAGATGCTGTGATCAGTGTG | GGAAGTTTGGCCCAGTATGGA |
| PRPF8 | GCCCTGTTAACATTGGCTGTT | AGGGAAACGGTCAGGCATAC |
Table 7.
EB media formulation for hiPSCs.
Table 7.
EB media formulation for hiPSCs.
| Days 3 to 6 (250 mL) | Days 7 to 14 (250 mL) |
|---|
| DMEM/F12/GlutaMAX™ 196.75 mL (Life Technologies Corporation; Grand Island, NY, USA) | DMEM/F12/GlutaMAX™ 171.75 mL |
| Penicillin-Streptomycin (0.1%) 0.25 mL (Sigma-Aldrich; Saint Louis, MO, USA) | Penicillin-Streptomycin (0.1%) 0.25 mL |
| KnockOut™ Serum Replacement (KOSR) (20%) 50 mL (Life Technologies Corporation; Grand Island, NY, USA) | KOSR (20%) 50 mL |
| Minimum Essential Medium (MEM) Non-essential Amino Acids (NEAA) (1×) 2.5 mL (Life Technologies Corporation; Grand Island, NY, USA) | MEM NEAA (1X) 2.5 mL |
| 2-Mercaptoethanol (50 mM) 0.5 mL (Life Technologies Corporation; Grand Island, NY, USA) | 2-Mercaptoethanol (50 mM) 0.5 mL |
| | Fetal Bovine Serum 25 mL (Life Technologies Corporation; Paisley, Scotland, UK) |
Table 8.
Primary antibody list.
Table 8.
Primary antibody list.
| Antibody | Species | Company | Cat. No. | Dilution |
|---|
| GFAP | Rabbit | Agilent Dako (Santa Clara, CA, USA) | Z0334 | 1 in 200 |
| NANOG | Rabbit | Cell Signaling (Danvers, MA, USA) | 4903S | 1 in 200 |
| NESTIN | Mouse | Novus Biologicals (Toronto, ON, USA) | NBP1-92717 | 1 in 500 |
| OCT4 | Mouse | Cell Signaling | 75463S | 1 in 250 |
| SMA | Mouse | Agilent Dako | M0851 | 1 in 200 |
| SOX17 | Goat | R&D Systems (Minneapolis, MN, USA) | AF1924 | 1 in 500 |
| SOX17 | Rabbit | Abcam (Cambridge, UK) | ab224637 | 1 in 500 |
| SOX2 | Rabbit | Cell Signaling | 3579S | 1 in 400 |
| SSEA4 | Mouse | Cell Signaling | 4755T | 1 in 400 |
Table 9.
Secondary antibody list.
Table 9.
Secondary antibody list.
| Host | Against | Conjugate | Isotype | Company | Cat. No | Dilution |
|---|
| Goat | Rabbit | Alexa Fluor 488 | IgG | Invitrogen | A11034 | 1 in 500 |
| Goat | Rabbit | Alexa Fluor 555 | IgG | Invitrogen | A21429 | 1 in 500 |
| Goat | Mouse | Alexa Fluor 488 | IgG | Invitrogen | A21121 | 1 in 500 |
| Goat | Mouse | Alexa Fluor 555 | IgG | Invitrogen | A21422 | 1 in 500 |
| Donkey | Goat | Alexa Fluor 488 | IgG | Invitrogen | A11055 | 1 in 500 |
| Rabbit | Goat | Alexa Fluor 555 | IgG | Invitrogen | A21431 | 1 in 500 |
Table 10.
Off-target analysis and the primers used for the selected off-target sequencing.
Table 10.
Off-target analysis and the primers used for the selected off-target sequencing.
| Reference Sequence | Target Sequence | Gene | Hit DNA Sequence | Chromosome Position | Mismatches | Forward Primer | Reverse Primer |
|---|
| NMNAT1 | TGGCCAGCTCAAACAACCTG | GPR98 | AAATaCCGAGAAatCTGAAAGGG | chr5, −90646382 | 3 | | |
| ELP4 | AAATTagaAGAAGACTGAAAGGG | chr11, +90646382 | 3 | 5′ TCTGCGTTGTGAATGGGGTT 3′ | 5′ GCCCTGTTTGTTCAAGCACC 3′ |
| DAB1 | AAAaTCaaAGAAGACTGAAATGG | chr1, −57325067 | 3 | | |
| NEGR1 | AAATTCtGAaAAGtCTGAAATGG | chr1, −71465063 | 3 | | |
| SPATA17 | AAATTCaGtGAAaACTGAAAAGG | chr1, +217793809 | 3 | | |
| LMNA | GaACCTgAGGaTGTTTGAGCAGG | chr1, −156133617 | 3 | | |
| TSHR | TGGCtAGtTCAAACAACCTGAGG | chr14, −81032599 | 2 | | |
| PRPF3 | AGCTGTTCAAGACCCCACGANGG | PPP1R42 | AGCTGTTCAAGACCCCACGAAGG | chr8, −66984739 | 0 | 5′ CAGCTCAATGCTCCAGTGACA 3′ | 5′ CCCCTTCCACTACTACCACGTT 3′ |
| NEDD4L | gGCTtTTCAAGACCCCACGgAGG | chr18, +58187120 | 3 | | |