Identification and Transcriptome Analysis of Bursaphelenchus xylophilus with Excellent Low Temperature Resistance
Abstract
1. Introduction
2. Results
2.1. Reproductivity Variations of B. xylophilus Isolates Under Different Ambient Temperatures
2.2. Transcriptome Sequencing of SC13 Under Different Temperatures
2.3. Identification and Functional Annotation of Differentially Expressed Genes in SC13
2.4. Experimental Verification of DE Genes and Corresponding Morphological Changes
3. Discussion
4. Materials and Methods
4.1. Sampling Information of B. xylophilus
4.2. Reproductivity Test of B. xylophilus Isolates
4.3. RNA-Seq Analysis of SC13 Isolate
4.4. Quantitative PCR Analysis of Temperature Resistance Gene Candidates
4.5. B. xylophilus Data Measurement
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abelleira, A.; Picoaga, A.; Mansilla, J.P.; Aguin, O. Detection of Bursaphelenchus xylophilus, Causal Agent of Pine Wilt Disease on Pinus pinaster in Northwestern Spain. Plant Dis. 2011, 95, 776. [Google Scholar] [CrossRef] [PubMed]
- Robinet, C.; Roques, A.; Pan, H.Y.; Fang, G.F.; Ye, J.R.; Zhang, Y.Z.; Sun, J. Role of human-mediated dispersal in the spread of the pine wood nematode in China. PLoS ONE 2009, 4, e4646. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.L.; Ye, J.R.; Wu, X.; Huang, L.; Zhu, L.H.; Lin, S.X. Deep sequencing analyses of pine wood nematode Bursaphelenchus xylophilus microRNAs reveal distinct miRNA expression patterns during the pathological process of pine wilt disease. Gene 2015, 555, 346–356. [Google Scholar] [CrossRef] [PubMed]
- Mamiya, Y. Pathology of the Pine Wilt Disease Caused by Bursaphelenchus xylophilus. Annu. Rev. Phytopathol. 1983, 21, 201–220. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.N.; Liu, P.X.; Shi, Y.; Wu, H.; Yu, H.Y.; Jiang, S.W. Difference analysis on pine wilt disease between Liaoning Province of northeastern China and other epidemic areas in China. J. Beijing For. Univ. 2021, 43, 155–160. [Google Scholar]
- Ohsawa, M.; Akiba, M. Possible altitude and temperature limits on pine wilt disease: The reproduction of vector sawyer beetles (Monochamus alternatus), survival of causal nematode (Bursaphelenchus xylophilus), and occurrence of damage caused by the disease. Eur. J. For. Res. 2014, 133, 225–233. [Google Scholar] [CrossRef]
- Ye, J.R.; Wu, X.Q. Research progress on Pine Wilt Disease. Chin. For. Pests Dis. 2022, 41, 1–10. [Google Scholar]
- Ye, J.R. Epidemic Status of Pine Wilt Disease in China and Its Prevention and Control Techniques and Counter Measures. Sci. Silvae Sin. 2019, 55, 1–10. [Google Scholar]
- Zhao, H.X.; Xian, X.Q.; Yang, N.W.; Guo, J.Y.; Zhao, L.L.; Sun, J.H.; Shi, J.; Liu, W.X. Continuum of global to local dispersal frameworks highlights the increasing threat of pine wilt disease in China. Glob. Ecol. Conserv. 2024, 54, e03059. [Google Scholar] [CrossRef]
- Wu, H.Y.; Tan, Q.Q.; Jiang, S.X. First Report of Pine Wilt Disease Caused by Bursaphelenchus xylophilus on Pinus thunbergii in the Inland City of Zibo, Shandong, China. Plant Dis. 2013, 97, 1126. [Google Scholar] [CrossRef]
- Gruffudd, H.R.; Jenkins, T.A.R.; Evans, H.F. Using an evapo-transpiration model (ETpN) to predict the risk and expression of symptoms of pine wilt disease (PWD) across Europe. Biol. Invasions 2016, 18, 2823–2840. [Google Scholar] [CrossRef]
- Lu, Q.; Wang, W.D.; Liang, J.; Yan, D.H.; Jia, X.Z.; Zhang, X.Y. Potential suitability assessment of Bursaphelenchus xylophilus in China. Forest Research 2005, 18, 460–464. [Google Scholar]
- Panov, V.; Krylov, P.; Riccardi, N. Role of diapause in dispersal and invasion success by aquatic invertebrates. J. Limnol. 2004, 63, 56–69. [Google Scholar] [CrossRef]
- Andreadis, S.S.; Athanassiou, C.G. A review of insect cold hardiness and its potential in stored product insect control. Crop Prot. 2017, 91, 93–99. [Google Scholar] [CrossRef]
- Zhao, L.L.; Wei, W.; Kulhavy, D.L.; Zhang, X.Y.; Sun, J.H. Low temperature induces two growth-arrested stages and change of secondary metabolites in Bursaphelenchus xylophilus. Nematology 2007, 9, 663–670. [Google Scholar] [CrossRef]
- Liu, Z.; Li, Y.; Pan, L.; Meng, F.; Zhang, X. Cold adaptive potential of pine wood nematodes overwintering in plant hosts. Biol. Open 2019, 8, bio041616. [Google Scholar] [CrossRef]
- Xiao, R.; Zhang, B.; Dong, Y.; Gong, J.; Xu, T.; Liu, J.; Xu, X.Z. A genetic program promotes C. elegans longevity at cold temperatures via a thermosensitive TRP channel. Cell 2013, 152, 806–817. [Google Scholar] [CrossRef]
- Kuhara, A.; Okumura, M.; Kimata, T.; Tanizawa, Y.; Takano, R.; Kimura, K.D.; Inada, H.; Matsumoto, K.; Mori, I. Temperature Sensing by an Olfactory Neuron in a Circuit Controlling Behavior of C. elegans. Science 2008, 320, 803–807. [Google Scholar] [CrossRef]
- Ohta, A.; Ujisawa, T.; Sonoda, S.; Kuhara, A. Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans. Nat. Commun. 2014, 5, 4412. [Google Scholar] [CrossRef]
- Murray, P.; Hayward, S.A.L.; Govan, G.G.; Gracey, A.Y.; Cossins, A.R. An explicit test of the phospholipid saturation hypothesis of acquired cold tolerance in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 2007, 104, 5489–5494. [Google Scholar] [CrossRef]
- Zhao, D.; Zheng, C.; Shi, F.; Xu, Y.; Zong, S.; Tao, J. Expression analysis of genes related to cold tolerance in Dendroctonus valens. PeerJ 2021, 9, e10864. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.L.; Zhang, R.Z.; Li, D.L.; Wang, F.; Jiang, S.W.; Wang, J.N. Trehalose in pine wood nematode participates in DJ3 formation and confers resistance to low-temperature stress. BMC Genom. 2021, 22, 13. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.W.; Hao, X.; Xu, J.Y.; Wang, B.Y.; Ma, W.; Liu, X.F.; Ma, L. Cytochrome P450 metabolism mediates low-temperature resistance in pinewood nematode. FEBS Open Bio. 2020, 10, 1171–1179. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Ma, L.; Wang, F.; Wang, B.; Hao, X.; Xu, J.; Ma, Y. Low Temperature Extends the Lifespan of Bursaphelenchus xylophilus through the cGMP Pathway. Int. J. Mol. Sci. 2017, 18, 2320. [Google Scholar] [CrossRef]
- Wang, B.; Hao, X.; Xu, J.; Ma, Y.; Ma, L. Transcriptome-Based Analysis Reveals a Crucial Role of BxGPCR17454 in Low Temperature Response of Pine Wood Nematode (Bursaphelenchus xylophilus). Int. J. Mol. Sci. 2019, 20, 2898. [Google Scholar] [CrossRef]
- Hu, L.-J.; Wu, X.-Q.; Ding, X.-L.; Ye, J.-R. Comparative transcriptomic analysis of candidate effectors to explore the infection and survival strategy of Bursaphelenchus xylophilus during different interaction stages with pine trees. BMC Plant Biol. 2021, 21, 224. [Google Scholar] [CrossRef]
- Qiu, Y.J.; Wu, X.Q.; Wen, T.Y.; Hu, L.J.; Rui, L.; Zhang, Y.; Ye, J.R. The Bursaphelenchus xylophilus candidate effector BxLip-3 targets the class I chitinases to suppress immunity in pine. Mol. Plant. Pathol. 2023, 24, 1033–1046. [Google Scholar] [CrossRef]
- Pan, L.; Cui, R.; Li, Y.X.; Feng, Y.Q.; Zhang, X.Y. Investigation of Pinewood Nematodes in Pinus tabuliformis Carr. under Low-Temperature Conditions in Fushun, China. Forests 2020, 11, 993. [Google Scholar] [CrossRef]
- Pan, L.; Cui, R.; Li, Y.X.; Zhang, W.; Bai, J.W.; Li, J.W.; Zhang, X.Y. Third-Stage dispersal juveniles of Bursaphelenchus xylophilus can resist low-temperature stress by entering cryptobiosis. Biology 2021, 10, 785. [Google Scholar] [CrossRef]
- Li, Z.; Tao, J.; Zong, S. Cold Tolerance in Pinewood Nematode Bursaphelenchus xylophilus Promoted Multiple Invasion Events in Mid-Temperate Zone of China. Forests 2022, 13, 1100. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Ohta, A.; Kuhara, A. Molecular mechanism for trimetric G protein-coupled thermosensation and synaptic regulation in the temperature response circuit of Caenorhabditis elegans. Neurosci. Res. 2013, 76, 119–124. [Google Scholar] [CrossRef] [PubMed]
- Fernando, T.; Flibotte, S.; Xiong, S.; Yin, J.H.; Yzeiraj, L.R.; Moerman, D.G.; Melendez, A.; Savage-Dunn, C. C. elegans ADAMTS ADT-2 regulates body size by modulating TGF beta signaling and cuticle collagen organization. Dev. Biol. 2011, 352, 92–103. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, S.; Gill, S.S.; Jain, P.K.; Sirohi, A. Isolation, cloning, and characterization of a cuticle collagen gene, Mi-col-5, in Meloidogyne incognita. 3 Biotech 2017, 7, 64. [Google Scholar] [CrossRef]
- Madaan, U.; Yzeiraj, E.; Meade, M.; Clark, J.F.; Rushlow, C.A.; Savage-Dunn, C. BMP signaling determines body size via transcriptional regulation of collagen genes in Caenorhabditis elegans. Genetics 2018, 210, 1355–1367. [Google Scholar] [CrossRef]
- Chen, Y.; Zhou, X.; Guo, K.; Chen, S.N.; Su, X. Transcriptomic insights into the effects of CytCo, a novel nematotoxic protein, on the pine wood nematode Bursaphelenchus xylophilus. BMC Genom. 2021, 22, 394. [Google Scholar] [CrossRef]
- Chen, J.; Hao, X.; Wang, B.Y.; Ma, L. Transcriptomics and coexpression network profiling of the effects of levamisole hydrochloride on Bursaphelenchus xylophilus. Pestic. Biochem. Phys. 2022, 181, 105019. [Google Scholar] [CrossRef]
- Gravato-Nobre, M.J.; Vaz, F.; Filipe, S.; Chalmers, R.; Hodgkin, J. The invertebrate lysozyme effector ILYS-3 is systemically activated in response to danger signals and confers antimicrobial protection in response to danger signals and confers antimicrobial protection in C. elegans. PLoS Pathog. 2016, 12, e1005826. [Google Scholar]
- Xiong, H.J.; Pears, C.; Woollard, A. An enhanced C. elegans based platform for toxicity assessment. Sci. Rep. 2017, 7, 9839. [Google Scholar] [CrossRef]
- Rui, L.; Liu, H.; Liang, R.; Wu, X. Resistance genes mediate differential resistance to pine defensive substances α-Pinene and H2O2 in Bursaphelenchus xylophilus with different levels of virulence. J. For. Res. 2021, 32, 1753–1762. [Google Scholar] [CrossRef]
- Ding, X.; Guo, Y.; Ye, J.; Wu, X.; Lin, S.; Chen, F.; Zhu, L.; Huang, L.; Song, X.; Zhang, Y.; et al. Population differentiation and epidemic tracking of Bursaphelenchus xylophilus in China based on chromosome-level assembly and whole-genome sequencing data. Pest Manag. Sci. 2022, 78, 1213–1226. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wang, L.S.; Fang, J.N.; Du, G.C.; Zhang, T.T.; Li, R.G. Transcriptomic profiling of Bursaphelenchus xylophilus reveals differentially expressed genes in response to ethanol. Mol. Biochem. Parasitol. 2022, 248, 111460. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.H.; Madaan, U.; Park, A.; Aftab, N.; Savage-Dunn, C. Multiple cis elements and GATA factors regulate a cuticle collagen gene in Caenorhabditis elegans. Genesis 2015, 53, 278–284. [Google Scholar] [CrossRef] [PubMed]
- Mesbahi, H.; Pho, K.B.; Tench, A.J.; Guerrero, V.L.L.; MacNeil, L.T. Cuticle collagen expression is regulated in response to environmental stimuli by the GATA transcription factor ELT-3 in Caenorhabditis elegans. Genetics 2020, 215, 483–495. [Google Scholar] [CrossRef]
- Detienne, G.; De Haes, W.; Ernst, U.R.; Schoofs, L.; Temmerman, L. Royalactin extends lifespan of Caenorhabditis elegans through epidermal growth factor signaling. Exp. Gerontol. 2014, 60, 129–135. [Google Scholar] [CrossRef]
- Hill, A.J.; Mansfield, R.; Lopez, J.; Raizen, D.M.; Van Buskirk, C. Cellular Stress Induces a Protective Sleep-like State in C. elegans. Curr. Biol. 2014, 24, 2399–2405. [Google Scholar] [CrossRef]
- Mereu, L.; Morf, M.K.; Spiri, S.; Gutierrez, P.; Escobar-Restrepo, J.M.; Daube, M.; Walser, M.; Hajnal, A. Polarized epidermal growth factor secretion ensures robust vulval cell fate specification in Caenorhabditis elegans. Development 2020, 147, dev175760. [Google Scholar] [CrossRef]
- Li, Y.X.; Feng, Y.Q.; Wang, X.; Cui, J.; Deng, X.; Zhang, X.Y. Adaptation of pine wood nematode Bursaphelenchus xylophilus to β-pinene stress. BMC Genom. 2020, 21, 478. [Google Scholar] [CrossRef]
- Ding, X.; Ye, J.; Lin, S.; Wu, X.; Li, D.; Nian, B. Deciphering the Molecular Variations of Pine Wood Nematode Bursaphelenchus xylophilus with Different Virulence. PLoS ONE 2016, 11, e0156040. [Google Scholar] [CrossRef]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
ID | Sampling Location | Host | Sampling Time |
---|---|---|---|
HN11 | Shaoyang County, Jiugongqiao Town, Jiugongqiao Village, Guangxi Province | Pinus massoniana | 29 March 2019 |
GX03 | Shinan Town, Xingye County, Guangxi Zhuang Autonomous Region | P. massoniana | 12 August 2016 |
GX11 | Shaqi Village, Shatou Town, Cangwu County, Wuzhou, Guangxi Province | unknown | 24 March 2019 |
SC03 | Jinchong, Zhou’an Village, Fushan Town, Fushun County, Zigong City, Sichuan Province | P. massoniana | 20 March 2015 |
SC07 | Dachong, Wuli Village, Shuangyi Town, Yibin County, Yibin City, Sichuan Province | P. massoniana | 30 March 2015 |
SC13 | Yibin City, Sichuan Province | P. massoniana | November 2015 |
FJ05 | Fengze District, Quanzhou City, Fujian Province | P. massoniana | December 2014 |
LN04 | Dalian, Liaoning Province | unknown | 20 October 2016 |
LN08 | Dongling, Shenyang, Liaoning Province | Pinus tabuliformis | 20 August 2017 |
LN15 | Hongtoushan, Qingyuan County, Fushun, Liaoning Province | Larix gmelinii | 25 September 2018 |
JS05 | Sun Yat-sen Mausoleum in Nanjing, Jiangsu Province | P. massoniana | December 2014 |
JS20 | Changshu City, Jiangsu Province, Yushan Forest Farm Lost Property Stream Protection Shed | P. massoniana | 11 October 2017 |
AH15 | Huangshan City, Anhui Province Huangshan District Town Taiping Lake Township (forest) Nan’an Village | P. massoniana | 18 October 2016 |
AH18 | Back hill of Hu Jia house, Zhangcun, Jiaocun Town, Anhui Province | P. massoniana | 26 July 2017 |
AH33 | Huangshan North Gate Area, Anhui Province | P. massoniana | 31 October 2018 |
SX15 | Shaping Wusi Village, Dahe Ba Town, Foping County, Hanzhong City, Shaanxi Province | P. massoniana | 13 August 2017 |
SX20 | Ningshan County, Shanxi Province | P. tabuliformis | 19 August 2017 |
AMA3 | Anhui Province | Pinus thunbergii | 10 July 2004 |
Gene | Primer ID | Primer Sequence |
---|---|---|
ACTIN | ACTIN-F | GCAACACGGAGTTCGTTGTA |
ACTIN-R | GTATCGTCACCAACTGGGAT | |
Epidermal growth factor | QEGF-F | GTGCCGGGACATCAATTC |
QEGF-R | GCCTCAAGCTTTTGTCAGC | |
G-protein-coupled receptor | QGPCR-F | GCATACACACAGCCTGTAGTC |
QGPCR-R | GAGTGCCAAGCCTTGAGGTAG | |
Nematode cuticle collagen | QNCC-F | CGGGAGTGCTCTTGTCATTG |
QNCC-R | GGAACTCCACCATCTCCACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Zhao, R.; Jing, T.; Lin, S.; Ding, X. Identification and Transcriptome Analysis of Bursaphelenchus xylophilus with Excellent Low Temperature Resistance. Int. J. Mol. Sci. 2024, 25, 13732. https://doi.org/10.3390/ijms252413732
Zhang Y, Zhao R, Jing T, Lin S, Ding X. Identification and Transcriptome Analysis of Bursaphelenchus xylophilus with Excellent Low Temperature Resistance. International Journal of Molecular Sciences. 2024; 25(24):13732. https://doi.org/10.3390/ijms252413732
Chicago/Turabian StyleZhang, Yue, Ruiwen Zhao, Tingting Jing, Sixi Lin, and Xiaolei Ding. 2024. "Identification and Transcriptome Analysis of Bursaphelenchus xylophilus with Excellent Low Temperature Resistance" International Journal of Molecular Sciences 25, no. 24: 13732. https://doi.org/10.3390/ijms252413732
APA StyleZhang, Y., Zhao, R., Jing, T., Lin, S., & Ding, X. (2024). Identification and Transcriptome Analysis of Bursaphelenchus xylophilus with Excellent Low Temperature Resistance. International Journal of Molecular Sciences, 25(24), 13732. https://doi.org/10.3390/ijms252413732