CYP9Q1 Modulates Dopamine to Increase Sugar Responsiveness in Honeybees (Apis mellifera)
Abstract
1. Introduction
2. Results
2.1. Detection of Dopamine in the Brains of Honeybees Under Different Starvation Conditions
2.2. Sequencing Analysis and Quality Control
2.3. Real-Time Quantitative PCR (qPCR) of Differentially Expressed Genes (DEGs)
2.4. Analysis of Differentially Expressed Genes (DEGs)
2.5. GO and KEEG Enrichment in Honeybees Under Different Food Desire States
2.6. Inhibition of CYP9Q1 in Honeybees
2.7. CYP9Q1 Affects Honeybees’ Consumption of Sugar Water
2.8. CYP9Q1 Affects Honeybees’ Sensitivity to Sugar Water
2.9. CYP9Q1 Regulates the Expression of TH and IRS
3. Discussion
4. Materials and Methods
4.1. Honeybee Husbandry
4.2. Honeybee Labeling
4.3. Dissection of Honeybee Brains
4.4. High-Performance Liquid Chromatography (HPLC) Analyses of Dopamine Levels in the Honeybee Brain
4.5. Library Preparation and RNA Sequencing
4.6. siRNA Preparation and Feeding
4.7. Testing Sensitivity to Sugar Water
4.8. Quantification of Transcript Expression After siRNA Feeding
4.9. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Giurfa, M. Behavioral and neural analysis of associative learning in the honeybee: A taste from the magic well. J. Comp. Physiol. A Neuroethol. Sens. Neural Behav. Physiol. 2007, 193, 801–824. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, M.V. Honey bees as a model for vision, perception, and cognition. Annu. Rev. Entomol. 2010, 55, 267–284. [Google Scholar] [CrossRef]
- Pearson, J.M.; Watson, K.K.; Platt, M.L. Decision making: The neuroethological turn. Neuron 2014, 82, 950–965. [Google Scholar] [CrossRef]
- Wu, Q.; Wen, T.; Lee, G.; Park, J.H.; Cai, H.N.; Shen, P. Developmental control of foraging and social behavior by the Drosophila neuropeptide Y-like system. Neuron 2003, 39, 147–161. [Google Scholar] [CrossRef] [PubMed]
- Lin, S. Internal-state-dependent modulation of olfactory responses: A tale of dopamine neurons in the adult Drosophila mushroom body. Curr. Opin. Insect Sci. 2023, 59, 101104. [Google Scholar] [CrossRef] [PubMed]
- Grozinger, C.M.; Sharabash, N.M.; Whitfield, C.W.; Robinson, G.E. Pheromone-mediated gene expression in the honey bee brain. Proc. Natl. Acad. Sci. USA 2003, 100 (Suppl. S2), 14519–14525. [Google Scholar] [CrossRef] [PubMed]
- Beggs, K.T.; Glendining, K.A.; Marechal, N.M.; Vergoz, V.; Nakamura, I.; Slessor, K.N.; Mercer, A.R. Queen pheromone modulates brain dopamine function in worker honey bees. Proc. Natl. Acad. Sci. USA 2007, 104, 2460–2464. [Google Scholar] [CrossRef]
- Bromberg-Martin, E.S.; Matsumoto, M.; Hikosaka, O. Dopamine in motivational control: Rewarding, aversive, and alerting. Neuron 2010, 68, 815–834. [Google Scholar] [CrossRef]
- Pendleton, R.G.; Rasheed, A.; Sardina, T.; Tully, T.; Hillman, R. Effects of tyrosine hydroxylase mutants on locomotor activity in Drosophila: A study in functional genomics. Behav. Genet. 2002, 32, 89–94. [Google Scholar] [CrossRef]
- Reynolds, J.N.; Hyland, B.I.; Wickens, J.R. A cellular mechanism of reward-related learning. Nature 2001, 413, 67–70. [Google Scholar] [CrossRef]
- Macedo-Lima, M.; Remage-Healey, L. Dopamine modulation of motor and sensory cortical plasticity among vertebrates. Integr. Comp. Biol. 2021, 61, 316–336. [Google Scholar] [CrossRef]
- Huang, J.; Zhang, Z.; Feng, W.; Zhao, Y.; Aldanondo, A.; de Brito Sanchez, M.G.; Paoli, M.; Rolland, A.; Li, Z.; Nie, H.; et al. Food wanting is mediated by transient activation of dopaminergic signaling in the honey bee brain. Science 2022, 376, 508–512. [Google Scholar] [CrossRef] [PubMed]
- Barron, A.; Fahrbach, S.E.; Mercer, A.R.; Mesce, K.A.; Schulz, D.J.; Smith, B.H.; Søvik, E. Comment on “Food wanting is mediated by transient activation of dopaminergic signaling in the honey bee brain”. Science 2023, 381, eadg3916. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.J.; Wang, Z.L.; Wu, Z.H.; He, X.J.; Zhang, Y.; Huang, Q.; Zhang, L.Z.; Wu, X.B.; Yan, W.Y.; Zeng, Z.J. Phenotypic dimorphism between honeybee queen and worker is regulated by complicated epigenetic modifications. iScience 2023, 26, 106308. [Google Scholar] [CrossRef]
- Kohno, H.; Kubo, T. Genetics in the honey bee: Achievements and prospects toward the functional analysis of molecular and neural mechanisms underlying social behaviors. Insects 2019, 10, 348. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Xu, Y.; Zhang, W. Transcriptome analysis of Apis mellifera antennae reveals molecular divergence underlying the division of labour in worker bees. Insect Mol. Biol. 2024, 33, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Kropf, J.; Kelber, C.; Bieringer, K.; Rössler, W. Olfactory subsystems in the honeybee: Sensory supply and sex specificity. Cell Tissue Res. 2014, 357, 583–595. [Google Scholar] [CrossRef] [PubMed]
- Moreno, E.; José Corriale, M.; Arenas, A. Differences in olfactory sensitivity and odor detection correlate with foraging task specialization in honeybees Apis mellifera. J. Insect Physiol. 2022, 141, 104416. [Google Scholar] [CrossRef]
- Muth, F.; Francis, J.S.; Leonard, A.S. Bees use the taste of pollen to determine which flowers to visit. Biol. Lett. 2016, 12, 20160356. [Google Scholar] [CrossRef] [PubMed]
- Sabandal, J.M.; Sabandal, P.R.; Kim, Y.C.; Han, K.A. Concerted actions of octopamine and dopamine receptors drive olfactory learning. J. Neurosci. Off. J. Soc. Neurosci. 2020, 40, 4240–4250. [Google Scholar] [CrossRef]
- Berry, J.A.; Cervantes-Sandoval, I.; Nicholas, E.P.; Davis, R.L. Dopamine is required for learning and forgetting in Drosophila. Neuron 2012, 74, 530–542. [Google Scholar] [CrossRef] [PubMed]
- Noyes, N.C.; Davis, R.L. Innate and learned odor-guided behaviors utilize distinct molecular signaling pathways in a shared dopaminergic circuit. Cell Rep. 2023, 42, 112026. [Google Scholar] [CrossRef]
- Liu, F.; Zhao, H.; Li, Q.; Wu, L.; Cao, D.; Zhang, Y.; Huang, Z.Y. MicroRNA ame-let-7 targets Amdop2 to increase sucrose sensitivity in honey bees (Apis mellifera). Front. Zool. 2023, 20, 41. [Google Scholar] [CrossRef] [PubMed]
- Xiao, G.; Zhao, M.; Liu, Z.; Du, F.; Zhou, B. Zinc antagonizes iron-regulation of tyrosine hydroxylase activity and dopamine production in Drosophila melanogaster. BMC Biol. 2021, 19, 236. [Google Scholar] [CrossRef] [PubMed]
- Molinoff, P.B.; Axelrod, J. Biochemistry of catecholamines. Annu. Rev. Biochem. 1971, 40, 465–500. [Google Scholar] [CrossRef] [PubMed]
- Daubner, S.C.; Le, T.; Wang, S. Tyrosine hydroxylase and regulation of dopamine synthesis. Arch. Biochem. Biophys. 2011, 508, 1–12. [Google Scholar] [CrossRef]
- Oldham, S.; Hafen, E. Insulin/IGF and target of rapamycin signaling: A TOR de force in growth control. Trends Cell Biol. 2003, 13, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Nilsen, K.A.; Ihle, K.E.; Frederick, K.; Fondrk, M.K.; Smedal, B.; Hartfelder, K.; Amdam, G.V. Insulin-like peptide genes in honey bee fat body respond differently to manipulation of social behavioral physiology. J. Exp. Biol. 2011, 214, 1488–1497. [Google Scholar] [CrossRef]
- Wang, Y.; Mutti, N.S.; Ihle, K.E.; Siegel, A.; Dolezal, A.G.; Kaftanoglu, O.; Amdam, G.V. Down-regulation of honey bee IRS gene biases behavior toward food rich in protein. PLoS Genet. 2010, 6, e1000896. [Google Scholar] [CrossRef] [PubMed]
- Kamhi, J.F.; Arganda, S.; Moreau, C.S.; Traniello, J.F.A. Origins of aminergic regulation of behavior in complex insect social systems. Front. Syst. Neurosci. 2017, 11, 74. [Google Scholar] [CrossRef]
- Perry, C.J.; Barron, A.B. Neural mechanisms of reward in insects. Annu. Rev. Entomol. 2013, 58, 543–562. [Google Scholar] [CrossRef] [PubMed]
- Dong, S.; Gu, G.; Lin, T.; Wang, Z.; Li, J.; Tan, K.; Nieh, J.C. An inhibitory signal associated with danger reduces honeybee dopamine levels. Curr. Biol. 2023, 33, 2081–2087. [Google Scholar] [CrossRef]
- Linn, M.; Glaser, S.M.; Peng, T.; Grüter, C. Octopamine and dopamine mediate waggle dance following and information use in honeybees. Proc. Biol. Sci. 2020, 287, 20201950. [Google Scholar] [CrossRef]
- da Silva, R.C.; Bestea, L.; de Brito Sanchez, G.; Giurfa, M. When the society dictates food search—Neural signalling underlying appetitive motivation in honey bees. Curr. Opin. Neurobiol. 2024, 89, 102930. [Google Scholar] [CrossRef] [PubMed]
- Finkelstein, A.B.; Brent, C.S.; Giurfa, M.; Amdam, G.V. Foraging experiences durably modulate honey bees’ sucrose responsiveness and antennal lobe biogenic amine levels. Sci. Rep. 2019, 9, 5393. [Google Scholar] [CrossRef] [PubMed]
- Wallace, C.W.; Fordahl, S.C. Obesity and dietary fat influence dopamine neurotransmission: Exploring the convergence of metabolic state, physiological stress, and inflammation on dopaminergic control of food intake. Nutr. Res. Rev. 2022, 35, 236–251. [Google Scholar] [CrossRef] [PubMed]
- Landayan, D.; Feldman, D.S.; Wolf, F.W. Satiation state-dependent dopaminergic control of foraging in Drosophila. Sci. Rep. 2018, 8, 5777. [Google Scholar] [CrossRef]
- Hernandez, G.; Trujillo-Pisanty, I.; Cossette, M.P.; Conover, K.; Shizgal, P. Role of dopamine tone in the pursuit of brain stimulation reward. J. Neurosci. Off. J. Soc. Neurosci. 2012, 32, 11032–11041. [Google Scholar] [CrossRef]
- Jovanoski, K.D.; Duquenoy, L.; Mitchell, J.; Kapoor, I.; Treiber, C.D.; Croset, V.; Dempsey, G.; Parepalli, S.; Cognigni, P.; Otto, N.; et al. Dopaminergic systems create reward seeking despite adverse consequences. Nature 2023, 623, 356–365. [Google Scholar] [CrossRef] [PubMed]
- Klappenbach, M.; Kaczer, L.; Locatelli, F. Dopamine interferes with appetitive long-term memory formation in honey bees. Neurobiol. Learn. Mem. 2013, 106, 230–237. [Google Scholar] [CrossRef] [PubMed]
- Kuban, W.; Daniel, W.A. Cytochrome P450 expression and regulation in the brain. Drug Metab. Rev. 2021, 53, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, C.S.; Tyndale, R.F. Cytochrome P450 enzymes in the brain: Emerging evidence of biological significance. Trends Pharmacol. Sci. 2011, 32, 708–714. [Google Scholar] [CrossRef] [PubMed]
- Bromek, E.; Haduch, A.; Daniel, W.A. The ability of cytochrome P450 2D isoforms to synthesize dopamine in the brain: An in vitro study. Eur. J. Pharmacol. 2010, 626, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Rauschenbach, I.Y.; Karpova, E.K.; Burdina, E.V.; Adonyeva, N.V.; Bykov, R.A.; Ilinsky, Y.Y.; Menshanov, P.N.; Gruntenko, N.E. Insulin-like peptide DILP6 regulates juvenile hormone and dopamine metabolism in Drosophila females. Gen. Comp. Endocrinol. 2017, 243, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Gruntenko, N.E.; Rauschenbach, I.Y. The role of insulin signalling in the endocrine stress response in Drosophila melanogaster: A mini-review. Gen. Comp. Endocrinol. 2018, 258, 134–139. [Google Scholar] [CrossRef]
- Ihle, K.E.; Baker, N.A.; Amdam, G.V. Insulin-like peptide response to nutritional input in honey bee workers. J. Insect Physiol. 2014, 69, 49–55. [Google Scholar] [CrossRef]
- Ihle, K.E.; Mutti, N.S.; Kaftanoglu, O.; Amdam, G.V. Insulin receptor substrate gene knockdown accelerates behavioural maturation and shortens lifespan in honeybee workers. Insects 2019, 10, 390. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, K.; Yokoi, K.; Toga, K. Bumble bee queens activate dopamine production and gene expression in nutritional signaling pathways in the brain. Sci. Rep. 2021, 11, 552. [Google Scholar] [CrossRef]
- Carlesso, D.; Smargiassi, S.; Sassoli, L.; Cappa, F.; Cervo, R.; Baracchi, D. Exposure to a biopesticide interferes with sucrose responsiveness and learning in honey bees. Sci. Rep. 2020, 10, 19929. [Google Scholar] [CrossRef]
- Matsumoto, Y.; Menzel, R.; Sandoz, J.C.; Giurfa, M. Revisiting olfactory classical conditioning of the proboscis extension response in honey bees: A step toward standardized procedures. J. Neurosci. Methods 2012, 211, 159–167. [Google Scholar] [CrossRef]









| Sample | Raw Data | Valid Data | Valid Data (%) | Q20 (%) | Q30 (%) |
|---|---|---|---|---|---|
| F2-1 | 42,238,106 | 41,724,032 | 98.78% | 97.26% | 92.65% |
| F2-2 | 47,008,752 | 46,466,338 | 98.85% | 97.54% | 93.15% |
| F2-3 | 43,534,018 | 42,778,170 | 98.26% | 97.64% | 93.31% |
| H2-1 | 44,119,100 | 43,403,162 | 98.38% | 97.44% | 93.01% |
| H2-2 | 41,698,078 | 40,825,646 | 97.91% | 97.36% | 92.79% |
| H2-3 | 40,543,520 | 39,902,528 | 98.42% | 97.32% | 92.67% |
| Gene Name | Primer Sequences (5′ → 3′) | Product Size (bp) |
|---|---|---|
| CYP9Q1-F | GACCGTGACTGACATAGCCAATC | 135 |
| CYP9Q1-R | ATCTCCTCCTGAAGCCTCTGTTG | |
| TH-F | TGAGATACTGGACAGCGTGGAC | 87 |
| TH-R | TTGTTGACAGCGTTCGTGAGATG | |
| IRS-F | GTCGCATGGTGGCAGTAGTTG | 143 |
| IRS-R | TGGAATAGGCTCTTGCTGGTCTC | |
| β-Actin-F | CCTAGCACCATCCACCATGAA | 87 |
| β-Actin-R | GAAGCAAGAATTGACCCACCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.-L.; Geng, L.; Zeng, Z.-Y.; Wu, Z.; Li, L.-F.; Tang, S.-H.; Wang, Z.-J.; Shi, H.-H.; Li, Z.-G.; Nie, H.-Y.; et al. CYP9Q1 Modulates Dopamine to Increase Sugar Responsiveness in Honeybees (Apis mellifera). Int. J. Mol. Sci. 2024, 25, 13550. https://doi.org/10.3390/ijms252413550
Xu X-L, Geng L, Zeng Z-Y, Wu Z, Li L-F, Tang S-H, Wang Z-J, Shi H-H, Li Z-G, Nie H-Y, et al. CYP9Q1 Modulates Dopamine to Increase Sugar Responsiveness in Honeybees (Apis mellifera). International Journal of Molecular Sciences. 2024; 25(24):13550. https://doi.org/10.3390/ijms252413550
Chicago/Turabian StyleXu, Xue-Ling, Long Geng, Zhao-Yang Zeng, Zun Wu, Lin-Feng Li, Shao-Han Tang, Zi-Jing Wang, Han-Hui Shi, Zhi-Guo Li, Hong-Yi Nie, and et al. 2024. "CYP9Q1 Modulates Dopamine to Increase Sugar Responsiveness in Honeybees (Apis mellifera)" International Journal of Molecular Sciences 25, no. 24: 13550. https://doi.org/10.3390/ijms252413550
APA StyleXu, X.-L., Geng, L., Zeng, Z.-Y., Wu, Z., Li, L.-F., Tang, S.-H., Wang, Z.-J., Shi, H.-H., Li, Z.-G., Nie, H.-Y., & Su, S.-K. (2024). CYP9Q1 Modulates Dopamine to Increase Sugar Responsiveness in Honeybees (Apis mellifera). International Journal of Molecular Sciences, 25(24), 13550. https://doi.org/10.3390/ijms252413550

