Inhibiting De Novo Biosynthesis of Ceramide by L-Cycloserine Can Prevent Light-Induced Retinal Degeneration in Albino BALB/c Mice
Abstract
1. Introduction
2. Results
2.1. L-Cycloserine Protects BALB/c Mice Retina from Light-Induced Degeneration
2.2. L-Cycloserine Up to a Dose of 40 mg/kg Shows No Toxicity in BALB/c Mice Retina
2.3. L-Cycloserine Distributes to Various Tissues and Reaches the Target Tissue—The Retina
2.4. Light Stress Alters Specific Sphingolipid Species in BALB/c Retina
2.5. L-Cycloserine Modulates Expression of Specific Genes in Light-Damaged BALB/c Mice Retina
2.6. L-Cycloserine Modulates Expression of Specific Proteins in Light-Damaged BALB/c Mice Retina
3. Discussion
4. Materials and Methods
4.1. Animal Care and L-Cycloserine Treatment
4.2. Electroretinography (ERG)
4.3. Histology
4.4. Bio Distribution Study of L-Cycloserine in BALB/c Mice
4.5. L-Cycloserine Quantification by LC-MS/MS
4.6. Mass Spectrometry Analysis of Sphingolipids
4.7. Gene Expression Analysis by Quantitative RT-PCR
4.8. Western Blot Analysis
4.9. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bhattacharyya, A. The detrimental effects of progression of retinal degeneration in the visual cortex. Front. Cell. Neurosci. 2022, 16, 904175. [Google Scholar] [CrossRef] [PubMed]
- Wert, K.J.; Lin, J.H.; Tsang, S.H. General pathophysiology in retinal degeneration. Dev. Ophthalmol. 2014, 53, 33–43. [Google Scholar] [CrossRef]
- Daiger, S.P. Retinal Information Network. 1996–2022. Available online: https://web.sph.uth.edu/RetNet/ (accessed on 1 March 2024).
- John, M.C.; Quinn, J.; Hu, M.L.; Cehajic-Kapetanovic, J.; Xue, K. Gene-agnostic therapeutic approaches for inherited retinal degenerations. Front. Mol. Neurosci. 2022, 15, 1068185. [Google Scholar] [CrossRef]
- Ohanian, J.; Ohanian, V. Sphingolipids in mammalian cell signalling. Cell. Mol. Life Sci. CMLS 2001, 58, 2053–2068. [Google Scholar] [CrossRef] [PubMed]
- Yadav, R.S.; Tiwari, N.K. Lipid Integration in Neurodegeneration: An Overview of Alzheimer’s Disease. Mol. Neurobiol. 2014, 50, 168–176. [Google Scholar] [CrossRef]
- Stiles, M.; Qi, H.; Sun, E.; Tan, J.; Porter, H.; Allegood, J.; Chalfant, C.E.; Yasumura, D.; Matthes, M.T.; LaVail, M.M.; et al. Sphingolipid profile alters in retinal dystrophic P23H-1 rats and systemic FTY720 can delay retinal degeneration. J. Lipid Res. 2016, 57, 818–831. [Google Scholar] [CrossRef]
- Garanto, A.; Mandal, N.A.; Egido-Gabás, M.; Marfany, G.; Fabriàs, G.; Anderson, R.E.; Casas, J.; Gonzàlez-Duarte, R. Specific sphingolipid content decrease in Cerkl knockdown mouse retinas. Exp. Eye Res. 2013, 110, 96–106. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Tran, J.-T.A.; Brush, R.S.; Saadi, A.; Rahman, A.K.; Yu, M.; Yasumura, D.; Matthes, M.T.; Ahern, K.; Yang, H.; et al. Ceramide signaling in retinal degeneration. Adv. Exp. Med. Biol. 2012, 723, 553–558. [Google Scholar] [PubMed]
- German, O.L.; Miranda, G.E.; Abrahan, C.E.; Rotstein, N.P. Ceramide is a Mediator of Apoptosis in Retina Photoreceptors. Investig. Ophthalmol. Vis. Sci. 2006, 47, 1658–1668. [Google Scholar] [CrossRef]
- Sanvicens, N.; Cotter, T.G. Ceramide is the key mediator of oxidative stress-induced apoptosis in retinal photoreceptor cells. J. Neurochem. 2006, 98, 1432–1444. [Google Scholar] [CrossRef]
- Prado Spalm, F.H.; Vera, M.S.; Dibo, M.J.; Simón, M.V.; Politi, L.E.; Rotstein, N.P. Ceramide Induces the Death of Retina Photoreceptors Through Activation of Parthanatos. Mol. Neurobiol. 2019, 56, 4760–4777. [Google Scholar] [CrossRef] [PubMed]
- Sugano, E.; Edwards, G.; Saha, S.; Wilmott, L.A.; Grambergs, R.C.; Mondal, K.; Qi, H.; Stiles, M.; Tomita, H.; Mandal, N. Overexpression of acid ceramidase (ASAH1) protects retinal cells (ARPE19) from oxidative stress [S]. J. Lipid Res. 2019, 60, 30–43. [Google Scholar] [CrossRef]
- Tahia, F.; Basu, S.K.; Prislovsky, A.; Mondal, K.; Ma, D.; Kochat, H.; Brown, K.; Stephenson, D.J.; Chalfant, C.E.; Mandal, N. Sphingolipid biosynthetic inhibitor L-Cycloserine prevents oxidative-stress-mediated death in an in vitro model of photoreceptor-derived 661W cells. Exp. Eye Res. 2024, 242, 109852. [Google Scholar] [CrossRef] [PubMed]
- Strettoi, E.; Gargini, C.; Novelli, E.; Sala, G.; Piano, I.; Gasco, P.; Ghidoni, R. Inhibition of ceramide biosynthesis preserves photoreceptor structure and function in a mouse model of retinitis pigmentosa. Proc. Natl. Acad. Sci. USA 2010, 107, 18706–18711. [Google Scholar] [CrossRef]
- Ranty, M.L.; Carpentier, S.; Cournot, M.; Rico-Lattes, I.; Malecaze, F.; Levade, T.; Delisle, M.B.; Quintyn, J.C. Ceramide production associated with retinal apoptosis after retinal detachment. Graefe’s Arch. Clin. Exp. Ophthalmol. 2009, 247, 215–224. [Google Scholar] [CrossRef]
- Lewandowski, D.; Foik, A.T.; Smidak, R.; Choi, E.H.; Zhang, J.; Hoang, T.; Tworak, A.; Suh, S.; Leinonen, H.; Dong, Z.; et al. Inhibition of ceramide accumulation in AdipoR1–/– mice increases photoreceptor survival and improves vision. JCI Insight 2022, 7, e156301. [Google Scholar] [CrossRef]
- Acharya, U.; Patel, S.; Koundakjian, E.; Nagashima, K.; Han, X.; Acharya, J.K. Modulating sphingolipid biosynthetic pathway rescues photoreceptor degeneration. Science 2003, 299, 1740–1743. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Tran, J.A.; Eckerd, A.; Huynh, T.P.; Elliott, M.H.; Brush, R.S.; Mandal, N.A. Inhibition of de novo ceramide biosynthesis by FTY720 protects rat retina from light-induced degeneration. J. Lipid Res. 2013, 54, 1616–1629. [Google Scholar] [CrossRef]
- Cruickshanks, K.J.; Klein, R.; Klein, B.E. Sunlight and age-related macular degeneration. The Beaver Dam Eye Study. Arch. Ophthalmol. 1993, 111, 514–518. [Google Scholar] [CrossRef]
- Cruickshanks, K.J.; Klein, R.; Klein, B.E.; Nondahl, D.M. Sunlight and the 5-year incidence of early age-related maculopathy: The beaver dam eye study. Arch. Ophthalmol. 2001, 119, 246–250. [Google Scholar]
- Hafezi, F.; Marti, A.; Munz, K.; Remé, C.E. Light-induced apoptosis: Differential timing in the retina and pigment epithelium. Exp. Eye Res. 1997, 64, 963–970. [Google Scholar] [CrossRef] [PubMed]
- Hollyfield, J.G.; Bonilha, V.L.; Rayborn, M.E.; Yang, X.; Shadrach, K.G.; Lu, L.; Ufret, R.L.; Salomon, R.G.; Perez, V.L. Oxidative damage-induced inflammation initiates age-related macular degeneration. Nat. Med. 2008, 14, 194–198. [Google Scholar] [CrossRef]
- Shen, J.K.; Dong, A.; Hackett, S.F.; Bell, W.R.; Green, W.R.; Campochiaro, P.A. Oxidative damage in age-related macular degeneration. Histol. Histopathol. 2007, 22, 1301–1308. [Google Scholar] [CrossRef] [PubMed]
- Totan, Y.; Yağci, R.; Bardak, Y.; Ozyurt, H.; Kendir, F.; Yilmaz, G.; Sahin, S.; Sahin Tiğ, U. Oxidative macromolecular damage in age-related macular degeneration. Curr. Eye Res. 2009, 34, 1089–1093. [Google Scholar] [CrossRef]
- Winkler, B.S.; Boulton, M.E.; Gottsch, J.D.; Sternberg, P. Oxidative damage and age-related macular degeneration. Mol. Vis. 1999, 5, 32. [Google Scholar]
- Donoso, L.A.; Kim, D.; Frost, A.; Callahan, A.; Hageman, G. The role of inflammation in the pathogenesis of age-related macular degeneration. Surv. Ophthalmol. 2006, 51, 137–152. [Google Scholar] [CrossRef] [PubMed]
- Wenzel, A.; Grimm, C.; Samardzija, M.; Remé, C.E. Molecular mechanisms of light-induced photoreceptor apoptosis and neuroprotection for retinal degeneration. Prog. Retin. Eye Res. 2005, 24, 275–306. [Google Scholar] [CrossRef]
- Wenzel, A.; Reme, C.E.; Williams, T.P.; Hafezi, F.; Grimm, C. The Rpe65 Leu450Met variation increases retinal resistance against light-induced degeneration by slowing rhodopsin regeneration. J. Neurosci. 2001, 21, 53–58. [Google Scholar] [CrossRef] [PubMed]
- Mandal, M.N.; Moiseyev, G.P.; Elliott, M.H.; Kasus-Jacobi, A.; Li, X.; Chen, H.; Zheng, L.; Nikolaeva, O.; Floyd, R.A.; Ma, J.X.; et al. Alpha-phenyl-N-tert-butylnitrone (PBN) prevents light-induced degeneration of the retina by inhibiting RPE65 protein isomerohydrolase activity. J. Biol. Chem. 2011, 286, 32491–32501. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Baksheeva, V.E.; Tiulina, V.V.; Goriainov, S.V.; Azbukina, N.V.; Gancharova, O.S.; Arifulin, E.A.; Komarov, S.V.; Chistyakov, V.V.; Tikhomirova, N.K.; et al. Mechanisms and Treatment of Light-Induced Retinal Degeneration-Associated Inflammation: Insights from Biochemical Profiling of the Aqueous Humor. Int. J. Mol. Sci. 2020, 21, 704. [Google Scholar] [CrossRef]
- Ozawa, Y. Oxidative stress in the light-exposed retina and its implication in age-related macular degeneration. Redox Biol. 2020, 37, 101779. [Google Scholar] [CrossRef] [PubMed]
- Noell, W.K.; Walker, V.S.; Kang, B.S.; Berman, S. Retinal damage by light in rats. Investig. Ophthalmol. 1966, 5, 450–473. [Google Scholar]
- Piano, I.; Novelli, E.; Gasco, P.; Ghidoni, R.; Strettoi, E.; Gargini, C. Cone survival and preservation of visual acuity in an animal model of retinal degeneration. Eur. J. Neurosci. 2013, 37, 1853–1862. [Google Scholar] [CrossRef] [PubMed]
- Piano, I.; D’Antongiovanni, V.; Novelli, E.; Biagioni, M.; Dei Cas, M.; Paroni, R.C.; Ghidoni, R.; Strettoi, E.; Gargini, C. Myriocin Effect on Tvrm4 Retina, an Autosomal Dominant Pattern of Retinitis Pigmentosa. Front. Neurosci. 2020, 14, 372. [Google Scholar] [CrossRef] [PubMed]
- Lowther, J.; Yard, B.A.; Johnson, K.A.; Carter, L.G.; Bhat, V.T.; Raman, M.C.; Clarke, D.J.; Ramakers, B.; McMahon, S.A.; Naismith, J.H.; et al. Inhibition of the PLP-dependent enzyme serine palmitoyltransferase by cycloserine: Evidence for a novel decarboxylative mechanism of inactivation. Mol. Biosyst. 2010, 6, 1682–1693. [Google Scholar] [CrossRef]
- Sundaram, K.S.; Lev, M. Inhibition of sphingolipid synthesis by cycloserine in vitro and in vivo. J. Neurochem. 1984, 42, 577–581. [Google Scholar] [CrossRef] [PubMed]
- Geekiyanage, H.; Upadhye, A.; Chan, C. Inhibition of serine palmitoyltransferase reduces Aβ and tau hyperphosphorylation in a murine model: A safe therapeutic strategy for Alzheimer’s disease. Neurobiol. Aging 2013, 34, 2037–2051. [Google Scholar] [CrossRef]
- Granzotto, A.; Bomba, M.; Castelli, V.; Navarra, R.; Massetti, N.; d’Aurora, M.; Onofrj, M.; Cicalini, I.; Del Boccio, P.; Gatta, V.; et al. Inhibition of de novo ceramide biosynthesis affects aging phenotype in an in vitro model of neuronal senescence. Aging 2019, 11, 6336–6357. [Google Scholar] [CrossRef]
- Meyer, S.G.; de Groot, H. Cycloserine and threo-dihydrosphingosine inhibit TNF-alpha-induced cytotoxicity: Evidence for the importance of de novo ceramide synthesis in TNF-alpha signaling. Biochim. Biophys. Acta 2003, 1643, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Stith, J.L.; Velazquez, F.N.; Obeid, L.M. Advances in determining signaling mechanisms of ceramide and role in disease. J. Lipid Res. 2019, 60, 913–918. [Google Scholar] [CrossRef] [PubMed]
- Parver, L.M.; Auker, C.R.; Fine, B.S.; Doyle, T. Dexamethasone protection against photochemical retinal injury. Arch. Ophthalmol. 1984, 102, 772–777. [Google Scholar] [CrossRef]
- Yang, L.-P.; Wu, L.-M.; Guo, X.-J.; Li, Y.; Tso, M.O.M. Endoplasmic reticulum stress is activated in light-induced retinal degeneration. J. Neurosci. Res. 2008, 86, 910–919. [Google Scholar] [CrossRef] [PubMed]
- Simón, M.V.; Prado Spalm, F.H.; Vera, M.S.; Rotstein, N.P. Sphingolipids as Emerging Mediators in Retina Degeneration. Front. Cell. Neurosci. 2019, 13, 246. [Google Scholar] [CrossRef] [PubMed]
- Polc, P.; Pieri, L.; Bonetti, E.P.; Scherschlicht, R.; Moehler, H.; Kettler, R.; Burkard, W.; Haefely, W. L-cycloserine: Behavioural and biochemical effects after single and repeated administration to mice, rats and cats. Neuropharmacology 1986, 25, 411–418. [Google Scholar] [CrossRef] [PubMed]
- Hussain, M.M.; Jin, W.; Jiang, X.C. Mechanisms involved in cellular ceramide homeostasis. Nutr. Metab. 2012, 9, 71. [Google Scholar] [CrossRef] [PubMed]
- Qian, X.; Srinivasan, T.; He, J.; Chen, R. The Role of Ceramide in Inherited Retinal Disease Pathology. Adv. Exp. Med. Biol. 2023, 1415, 303–307. [Google Scholar] [CrossRef] [PubMed]
- Qian, X.; Liu, H.; Fu, S.; Lu, J.; Hung, Y.-T.; Turner, C.; Gu, H.; Chen, R. AAV8-Mediated Gene Therapy Rescues Retinal Degeneration Phenotype in a Tlcd3b Knockout Mouse Model. Investig. Ophthalmol. Vis. Sci. 2022, 63, 11. [Google Scholar] [CrossRef]
- LeVine, S.M.; Tsau, S. Substrate Reduction Therapy for Krabbe Disease: Exploring the Repurposing of the Antibiotic D-Cycloserine. Front. Pediatr. 2021, 9, 807973. [Google Scholar] [CrossRef] [PubMed]
- Available online: https://go.drugbank.com/drugs/DB00260 (accessed on 1 April 2024).
- Mulubwa, M.; Mugabo, P. Amount of Cycloserine Emanating from Terizidone Metabolism and Relationship with Hepatic Function in Patients with Drug-Resistant Tuberculosis. Drugs R&D 2019, 19, 289–296. [Google Scholar] [CrossRef]
- Pant, D.C.; Aguilera-Albesa, S.; Pujol, A. Ceramide signalling in inherited and multifactorial brain metabolic diseases. Neurobiol. Dis. 2020, 143, 105014. [Google Scholar] [CrossRef]
- Chimin, P.; Andrade, M.L.; Belchior, T.; Paschoal, V.A.; Magdalon, J.; Yamashita, A.S.; Castro, É.; Castoldi, A.; Chaves-Filho, A.B.; Yoshinaga, M.Y.; et al. Adipocyte mTORC1 deficiency promotes adipose tissue inflammation and NLRP3 inflammasome activation via oxidative stress and de novo ceramide synthesis. J. Lipid Res. 2017, 58, 1797–1807. [Google Scholar] [CrossRef]
- Hannun, Y.A.; Obeid, L.M. Principles of bioactive lipid signalling: Lessons from sphingolipids. Nat. Rev. Mol. Cell Biol. 2008, 9, 139–150. [Google Scholar] [CrossRef]
- Stiles, M.; Moiseyev, G.P.; Budda, M.L.; Linens, A.; Brush, R.S.; Qi, H.; White, G.L.; Wolf, R.F.; Ma, J.-x.; Floyd, R.; et al. PBN (Phenyl-N-Tert-Butylnitrone)-Derivatives Are Effective in Slowing the Visual Cycle and Rhodopsin Regeneration and in Protecting the Retina from Light-Induced Damage. PLoS ONE 2015, 10, e0145305. [Google Scholar] [CrossRef]
- Uche, L.E.; Gooris, G.S.; Bouwstra, J.A.; Beddoes, C.M. Increased Levels of Short-Chain Ceramides Modify the Lipid Organization and Reduce the Lipid Barrier of Skin Model Membranes. Langmuir 2021, 37, 9478–9489. [Google Scholar] [CrossRef] [PubMed]
- Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.; Rahu, N. Oxidative Stress and Inflammation: What Polyphenols Can Do for Us? Oxidative Med. Cell. Longev. 2016, 2016, 7432797. [Google Scholar] [CrossRef] [PubMed]
- Ruttkay-Nedecky, B.; Nejdl, L.; Gumulec, J.; Zitka, O.; Masarik, M.; Eckschlager, T.; Stiborova, M.; Adam, V.; Kizek, R. The role of metallothionein in oxidative stress. Int. J. Mol. Sci. 2013, 14, 6044–6066. [Google Scholar] [CrossRef]
- Suzuki, M.; Aoshiba, K.; Nagai, A. Oxidative stress increases Fas ligand expression in endothelial cells. J. Inflamm. 2006, 3, 11. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Santiago-Sánchez, G.S.; Pita-Grisanti, V.; Quiñones-Díaz, B.; Gumpper, K.; Cruz-Monserrate, Z.; Vivas-Mejía, P.E. Biological Functions and Therapeutic Potential of Lipocalin 2 in Cancer. Int. J. Mol. Sci. 2020, 21, 4365. [Google Scholar] [CrossRef] [PubMed]
- Motterlini, R.; Foresti, R.; Bassi, R.; Calabrese, V.; Clark, J.E.; Green, C.J. Endothelial heme oxygenase-1 induction by hypoxia. Modulation by inducible nitric-oxide synthase and S-nitrosothiols. J. Biol. Chem. 2000, 275, 13613–13620. [Google Scholar] [CrossRef]
- Choi, A.M.; Alam, J. Heme oxygenase-1: Function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. Am. J. Respir. Cell Mol. Biol. 1996, 15, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, S. Endothelial Signaling in Vascular Dysfunction and Disease: From Bench to Bedside; Elsevier Science: Amsterdam, The Netherlands, 2021. [Google Scholar]
- David, K.K.; Andrabi, S.A.; Dawson, T.M.; Dawson, V.L. Parthanatos, a messenger of death. Front. Biosci. 2009, 14, 1116–1128. [Google Scholar] [CrossRef]
- Tsukuba, T.; Okamoto, K.; Yasuda, Y.; Morikawa, W.; Nakanishi, H.; Yamamoto, K. New Functional Aspects of Cathepsin D and Cathepsin E. Mol. Cells 2000, 10, 601–611. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Stearns, R.; González-Flecha, B. Lysosomal and mitochondrial pathways in H2O2-induced apoptosis of alveolar type II cells. J. Cell. Biochem. 2005, 94, 433–445. [Google Scholar] [CrossRef]
- Deiss, L.P.; Galinka, H.; Berissi, H.; Cohen, O.; Kimchi, A. Cathepsin D protease mediates programmed cell death induced by interferon-gamma, Fas/APO-1 and TNF-alpha. EMBO J. 1996, 15, 3861–3870. [Google Scholar] [CrossRef] [PubMed]
- Kanan, Y.; Moiseyev, G.; Agarwal, N.; Ma, J.-X.; Al-Ubaidi, M.R. Light Induces Programmed Cell Death by Activating Multiple Independent Proteases in a Cone Photoreceptor Cell Line. Investig. Ophthalmol. Vis. Sci. 2007, 48, 40–51. [Google Scholar] [CrossRef]
- Mandal, N.; Grambergs, R.; Mondal, K.; Basu, S.K.; Tahia, F.; Dagogo-Jack, S. Role of ceramides in the pathogenesis of diabetes mellitus and its complications. J. Diabetes Its Complicat. 2021, 35, 107734. [Google Scholar] [CrossRef]
- Mondal, K.; Porter, H.; Cole, J.; Pandya, H.K.; Basu, S.K.; Khanam, S.; Chiu, C.-Y.; Shah, V.; Stephenson, D.J.; Chalfant, C.E.; et al. Hydroxychloroquine Causes Early Inner Retinal Toxicity and Affects Autophagosome–Lysosomal Pathway and Sphingolipid Metabolism in the Retina. Mol. Neurobiol. 2022, 59, 3873–3887. [Google Scholar] [CrossRef]
- Qi, H.; Cole, J.; Grambergs, R.C.; Gillenwater, J.R.; Mondal, K.; Khanam, S.; Dutta, S.; Stiles, M.; Proia, R.L.; Allegood, J.; et al. Sphingosine Kinase 2 Phosphorylation of FTY720 is Unnecessary for Prevention of Light-Induced Retinal Damage. Sci. Rep. 2019, 9, 7771. [Google Scholar] [CrossRef]
- Mandal, M.N.; Patlolla, J.M.; Zheng, L.; Agbaga, M.P.; Tran, J.T.; Wicker, L.; Kasus-Jacobi, A.; Elliott, M.H.; Rao, C.V.; Anderson, R.E. Curcumin protects retinal cells from light-and oxidant stress-induced cell death. Free. Radic. Biol. Med. 2009, 46, 672–679. [Google Scholar] [CrossRef]
- Galor, A.; Sanchez, V.; Jensen, A.; Burton, M.; Maus, K.; Stephenson, D.; Chalfant, C.; Mandal, N. Meibum sphingolipid composition is altered in individuals with meibomian gland dysfunction-a side by side comparison of Meibum and Tear Sphingolipids. Ocul. Surf. 2022, 23, 87–95. [Google Scholar] [CrossRef]
- Qi, H.; Priyadarsini, S.; Nicholas, S.E.; Sarker-Nag, A.; Allegood, J.; Chalfant, C.E.; Mandal, N.A.; Karamichos, D. Analysis of sphingolipids in human corneal fibroblasts from normal and keratoconus patients. J. Lipid Res. 2017, 58, 636–648. [Google Scholar] [CrossRef] [PubMed]
- Mondal, K.; Takahashi, H.; Cole, J.; Del Mar, N.A.; Li, C.; Stephenson, D.J.; Allegood, J.; Cowart, L.A.; Chalfant, C.E.; Reiner, A.; et al. Systemic Elevation of n-3 Polyunsaturated Fatty Acids (n-3-PUFA) Is Associated with Protection against Visual, Motor, and Emotional Deficits in Mice following Closed-Head Mild Traumatic Brain Injury. Mol. Neurobiol. 2021, 58, 5564–5580. [Google Scholar] [CrossRef] [PubMed]
- Mandal, M.N.; Vasireddy, V.; Jablonski, M.M.; Wang, X.; Heckenlively, J.R.; Hughes, B.A.; Reddy, G.B.; Ayyagari, R. Spatial and temporal expression of MFRP and its interaction with CTRP5. Investig. Ophthalmol. Vis. Sci. 2006, 47, 5514–5521. [Google Scholar] [CrossRef] [PubMed]







| Compound | DP (eV) | CE (eV) | Q1 Mass | Q3 Mass | TR (min) |
|---|---|---|---|---|---|
| L-Cycloserine | 6 | 11 | 103.1 | 75 | 0.69 |
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| Trx1 | GTGTGGACCTTGCAAAATGA | CCCAACCTTTTGACCCTTTT |
| Cfos | GAAACGGAGAATCCGAAGG | TGGGCTGCCAAAATAAACTC |
| Fosl | AGAGCGGAACAAGCTAGCAG | CAAGTACGGGTCCTGGAGAA |
| MnSOD | CTGGACAAACCTGAGCCCTA | CTGTAAGCGACCTTGCTCCT |
| Mt2 | GCCTGCAAATGCAAACAAT | CGGAAGCCTCTTTGCAGAT |
| Lcn2 | CCAGTTCGCCATGGTATTTT | GCTCTCTGGCAACAGGAAAG |
| Spt2 | CATTGAGTCCAGAGCCAGAT | ACACACTGTCCTGGGAGGAA |
| Sphk1 | GATGCATGAGGTGGTGAATG | AACAGCAGTGTGCAGTTGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tahia, F.; Ma, D.; Stephenson, D.J.; Basu, S.K.; Del Mar, N.A.; Lenchik, N.; Kochat, H.; Brown, K.; Chalfant, C.E.; Mandal, N. Inhibiting De Novo Biosynthesis of Ceramide by L-Cycloserine Can Prevent Light-Induced Retinal Degeneration in Albino BALB/c Mice. Int. J. Mol. Sci. 2024, 25, 13389. https://doi.org/10.3390/ijms252413389
Tahia F, Ma D, Stephenson DJ, Basu SK, Del Mar NA, Lenchik N, Kochat H, Brown K, Chalfant CE, Mandal N. Inhibiting De Novo Biosynthesis of Ceramide by L-Cycloserine Can Prevent Light-Induced Retinal Degeneration in Albino BALB/c Mice. International Journal of Molecular Sciences. 2024; 25(24):13389. https://doi.org/10.3390/ijms252413389
Chicago/Turabian StyleTahia, Faiza, Dejian Ma, Daniel J. Stephenson, Sandip K. Basu, Nobel A. Del Mar, Nataliya Lenchik, Harry Kochat, Kennard Brown, Charles E. Chalfant, and Nawajes Mandal. 2024. "Inhibiting De Novo Biosynthesis of Ceramide by L-Cycloserine Can Prevent Light-Induced Retinal Degeneration in Albino BALB/c Mice" International Journal of Molecular Sciences 25, no. 24: 13389. https://doi.org/10.3390/ijms252413389
APA StyleTahia, F., Ma, D., Stephenson, D. J., Basu, S. K., Del Mar, N. A., Lenchik, N., Kochat, H., Brown, K., Chalfant, C. E., & Mandal, N. (2024). Inhibiting De Novo Biosynthesis of Ceramide by L-Cycloserine Can Prevent Light-Induced Retinal Degeneration in Albino BALB/c Mice. International Journal of Molecular Sciences, 25(24), 13389. https://doi.org/10.3390/ijms252413389

