Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate
Abstract
1. Introduction
2. Results
2.1. Targeting Construct and Strategy to Generate Gabre-cre Mice
2.2. Expression Analysis of Gabre-cre Mediated Recombination

2.3. Colocalization of Cre with Gabre in Different Brain Regions

2.4. GABRE Expression in the Primate Brain
2.5. Chemogenetic Activation of mPOAGABRE Neurons Decreases Body Temperature
2.6. Chemogenetic Inhibition of mPOAGABRE Neurons Decreases Heart Rate Under Isoflurane Anesthesia
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Generation of Gabre-cre Mice
4.3. Tissue Preparation
4.4. In Situ Hybridization
4.5. Image Acquisition
4.6. Immunohistochemistry
4.7. Virus Injection and Chemogenetic Activation
4.8. Detection of Splice Variants
4.9. Thermal Image Acquisition and Rectal Temperature Measurement
4.10. Heart Rate Measurement
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sternson, S.M. Hypothalamic Survival Circuits: Blueprints for Purposive Behaviors. Neuron 2013, 77, 810–824. [Google Scholar] [CrossRef] [PubMed]
- McKinley, M.J.; Pennington, G.L.; Ryan, P.J. The Median Preoptic Nucleus: A Major Regulator of Fluid, Temperature, Sleep, and Cardiovascular Homeostasis. In Handbook of Clinical Neurology; Elsevier: Amsterdam, The Netherlands, 2021; Volume 179, pp. 435–454. ISBN 9780128199756. [Google Scholar]
- Nakamura, K.; Nakamura, Y.; Kataoka, N. A Hypothalamomedullary Network for Physiological Responses to Environmental Stresses. Nat. Rev. Neurosci. 2022, 23, 35–52. [Google Scholar] [CrossRef] [PubMed]
- Mei, L.; Osakada, T.; Lin, D. Hypothalamic Control of Innate Social Behaviors. Science 2023, 382, 399–404. [Google Scholar] [CrossRef] [PubMed]
- Song, K.; Wang, H.; Kamm, G.B.; Pohle, J.; Reis, F.D.C.; Heppenstall, P.; Wende, H.; Siemens, J. The TRPM2 Channel Is a Hypothalamic Heat Sensor That Limits Fever and Can Drive Hypothermia. Science 2016, 353, 1393–1398. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.L.; Cooke, E.K.; Leib, D.E.; Lin, Y.-C.; Daly, G.E.; Zimmerman, C.A.; Knight, Z.A. Warm-Sensitive Neurons That Control Body Temperature. Cell 2016, 167, 47–59.e15. [Google Scholar] [CrossRef]
- Allen, W.E.; DeNardo, L.A.; Chen, M.Z.; Liu, C.D.; Loh, K.M.; Fenno, L.E.; Ramakrishnan, C.; Deisseroth, K.; Luo, L. Thirst-Associated Preoptic Neurons Encode an Aversive Motivational Drive. Science 2017, 357, 1149–1155. [Google Scholar] [CrossRef]
- Chung, S.; Weber, F.; Zhong, P.; Tan, C.L.; Nguyen, T.N.; Beier, K.T.; Hörmann, N.; Chang, W.-C.; Zhang, Z.; Do, J.P.; et al. Identification of Preoptic Sleep Neurons Using Retrograde Labelling and Gene Profiling. Nature 2017, 545, 477–481. [Google Scholar] [CrossRef]
- Takahashi, T.M.; Sunagawa, G.A.; Soya, S.; Abe, M.; Sakurai, K.; Ishikawa, K.; Yanagisawa, M.; Hama, H.; Hasegawa, E.; Miyawaki, A.; et al. A Discrete Neuronal Circuit Induces a Hibernation-like State in Rodents. Nature 2020, 583, 109–114. [Google Scholar] [CrossRef]
- Zeng, H. What Is a Cell Type and How to Define It? Cell 2022, 185, 2739–2755. [Google Scholar] [CrossRef]
- Moffitt, J.R.; Bambah-Mukku, D.; Eichhorn, S.W.; Vaughn, E.; Shekhar, K.; Perez, J.D.; Rubinstein, N.D.; Hao, J.; Regev, A.; Dulac, C.; et al. Molecular, Spatial, and Functional Single-Cell Profiling of the Hypothalamic Preoptic Region. Science 2018, 362, eaau5324. [Google Scholar] [CrossRef]
- Lein, E.S.; Hawrylycz, M.J.; Ao, N.; Ayres, M.; Bensinger, A.; Bernard, A.; Boe, A.F.; Boguski, M.S.; Brockway, K.S.; Byrnes, E.J.; et al. Genome-Wide Atlas of Gene Expression in the Adult Mouse Brain. Nature 2007, 445, 168–176. [Google Scholar] [CrossRef] [PubMed]
- Yao, Z.; van Velthoven, C.T.J.; Kunst, M.; Zhang, M.; McMillen, D.; Lee, C.; Jung, W.; Goldy, J.; Abdelhak, A.; Aitken, M.; et al. A High-Resolution Transcriptomic and Spatial Atlas of Cell Types in the Whole Mouse Brain. Nature 2023, 624, 317–332. [Google Scholar] [CrossRef] [PubMed]
- Olsen, R.W.; Sieghart, W. GABAA Receptors: Subtypes Provide Diversity of Function and Pharmacology. Neuropharmacology 2009, 56, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Wisden, W.; Laurie, D.; Monyer, H.; Seeburg, P. The Distribution of 13 GABAA Receptor Subunit mRNAs in the Rat Brain. I. Telencephalon, Diencephalon, Mesencephalon. J. Neurosci. 1992, 12, 1040–1062. [Google Scholar] [CrossRef] [PubMed]
- Sieghart, W.; Sperk, G. Subunit composition, distribution and function of GABA-A receptor subtypes. Curr. Top. Med. Chem. 2002, 2, 795–816. [Google Scholar] [CrossRef]
- Davies, P.A.; Hanna, M.C.; Hales, T.G.; Kirkness, E.F. Insensitivity to anaesthetic agents conferred by a class of GABAA receptor subunit. Nature 1997, 385, 820–823. [Google Scholar] [CrossRef]
- Whiting, P.J.; McAllister, G.; Vassilatis, D.; Bonnert, T.P.; Heavens, R.P.; Smith, D.W.; Hewson, L.; O’Donnell, R.; Rigby, M.R.; Sirinathsinghji, D.J.; et al. Neuronally restricted RNA splicing regulates the expression of a novel GABAA receptor subunit conferring atypical functional properties. J. Neurosci. 1997, 17, 5027–5037. [Google Scholar] [CrossRef]
- Garret, M.; Bascles, L.; Boue-Grabot, E.; Sartor, P.; Charron, G.; Bloch, B.; Margolskee, R.F. An mRNA Encoding a Putative GABA-Gated Chloride Channel Is Expressed in the Human Cardiac Conduction System. J. Neurochem. 1997, 68, 1382–1389. [Google Scholar] [CrossRef]
- Wilke, K.; Gaul, R.; Klauck, S.M.; Poustka, A. A Gene in Human Chromosome Band Xq28 (GABRE) Defines a Putative New Subunit Class of the GABAANeurotransmitter Receptor. Genomics 1997, 45, 1–10. [Google Scholar] [CrossRef]
- Moragues, N.; Ciofi, P.; Lafon, P.; Odessa, M.F.; Tramu, G.; Garret, M. cDNA cloning and expression of a γ-aminobutyric acid A receptor ε-subunit in rat brain. Eur. J. Neurosci. 2000, 12, 4318–4330. [Google Scholar]
- Moragues, N.; Ciofi, P.; Tramu, G.; Garret, M. Localisation of GABAA Receptor ϵ-Subunit in Cholinergic and Aminergic Neurones and Evidence for Co-Distribution with the θ-Subunit in Rat Brain. Neuroscience 2002, 111, 657–669. [Google Scholar] [CrossRef] [PubMed]
- Sergeeva, O.A.; Eriksson, K.S.; Sharonova, I.N.; Vorobjev, V.S.; Haas, H.L. GABAA Receptor Heterogeneity in Histaminergic Neurons. Eur. J. Neurosci. 2002, 16, 1472–1482. [Google Scholar] [CrossRef] [PubMed]
- Moragues, N.; Ciofi, P.; Lafon, P.; Tramu, G.; Garret, M. GABAA Receptor ε Subunit Expression in Identified Peptidergic Neurons of the Rat Hypothalamus. Brain Res. 2003, 967, 285–289. [Google Scholar] [CrossRef] [PubMed]
- Neelands, T.R.; Fisher, J.L.; Bianchi, M.; Macdonald, R.L. Spontaneous and γ-Aminobutyric Acid (GABA)-Activated GABA A Receptor Channels Formed by ε Subunit-Containing Isoforms. Mol. Pharmacol. 1999, 55, 168–178. [Google Scholar] [CrossRef] [PubMed]
- Davies, P.A.; McCartney, M.R.; Wang, W.; Hales, T.G.; Kirkness, E.F. Alternative Transcripts of the GABAA Receptor ε Subunit in Human and Rat. Neuropharmacology 2002, 43, 467–475. [Google Scholar] [CrossRef]
- Thompson, S.A.; Bonnert, T.P.; Cagetti, E.; Whiting, P.J.; Wafford, K.A. Overexpression of the GABAA Receptor ε Subunit Results in Insensitivity to Anaesthetics. Neuropharmacology 2002, 43, 662–668. [Google Scholar] [CrossRef]
- Wagner, D.A.; Goldschen-Ohm, M.P.; Hales, T.G.; Jones, M.V. Kinetics and Spontaneous Open Probability Conferred by the ϵ Subunit of the GABA A Receptor. J. Neurosci. 2005, 25, 10462–10468. [Google Scholar] [CrossRef]
- Germann, A.L.; Burbridge, A.B.; Pierce, S.R.; Akk, G. Activation of the Rat A1β2ε GABAA Receptor by Orthosteric and Allosteric Agonists. Biomolecules 2022, 12, 868. [Google Scholar] [CrossRef]
- Sergeeva, O.A.; Andreeva, N.; Garret, M.; Scherer, A.; Haas, H.L. Pharmacological Properties of GABA A Receptors in Rat Hypothalamic Neurons Expressing the ϵ-Subunit. J. Neurosci. 2005, 25, 88–95. [Google Scholar] [CrossRef]
- Kasparov, S.; Davies, K.A.; Patel, U.A.; Boscan, P.; Garret, M.; Paton, J.F.R. GABAA Receptor ε-subunit May Confer Benzodiazepine Insensitivity to the Caudal Aspect of the Nucleus Tractus Solitarii of the Rat. J. Physiol. 2001, 536, 785–796. [Google Scholar] [CrossRef]
- Hengen, K.B.; Nelson, N.R.; Stang, K.M.; Johnson, S.M.; Crader, S.M.; Watters, J.J.; Mitchell, G.S.; Behan, M. Increased GABAA Receptor ε-Subunit Expression on Ventral Respiratory Column Neurons Protects Breathing During Pregnancy. PLoS ONE 2012, 7, e30608. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhou, Y.-N.; Lu, X.-Z.; Li, R.-J.; Xiong, Y.-F.; Sheng, X.; Zhu, W.-W. Cognitive Dysfunction in Schizophrenia Patients Caused by Down-Regulation of γ-Aminobutyric Acid Receptor Subunits. World J. Psychiatry 2024, 14, 784–793. [Google Scholar] [CrossRef] [PubMed]
- Markus, F.; Angelini, C.; Trimouille, A.; Rudolf, G.; Lesca, G.; Goizet, C.; Lasseaux, E.; Arveiler, B.; van Slegtenhorst, M.; Brooks, A.S.; et al. Rare variants in the GABAA receptor subunit ε identified in patients with a wide spectrum of epileptic phenotypes. Mol. Genet. Genom. Med. 2020, 8, e1388. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Du, X.; Bin, R.; Yu, S.; Xia, Z.; Zheng, G.; Zhong, J.; Zhang, Y.; Jiang, Y.; Wang, Y. Genetic Variants Identified from Epilepsy of Unknown Etiology in Chinese Children by Targeted Exome Sequencing. Sci. Rep. 2017, 7, 40319. [Google Scholar] [CrossRef]
- Ghit, A.; Assal, D.; Al-Shami, A.S.; Hussein, D.E.E. GABAA Receptors: Structure, Function, Pharmacology, and Related Disorders. J. Genet. Eng. Biotechnol. 2021, 19, 123. [Google Scholar] [CrossRef]
- Morrison, S.F. Central Neural Control of Thermoregulation and Brown Adipose Tissue. Auton. Neurosci. 2016, 196, 14–24. [Google Scholar] [CrossRef]
- Armbruster, B.N.; Li, X.; Pausch, M.H.; Herlitze, S.; Roth, B.L. Evolving the Lock to Fit the Key to Create a Family of G Protein-Coupled Receptors Potently Activated by an Inert Ligand. Proc. Natl. Acad. Sci. USA 2007, 104, 5163–5168. [Google Scholar] [CrossRef]
- Janssen, B.J.; De Celle, T.; Debets, J.J.; Brouns, A.E.; Callahan, M.F.; Smith, T.L. Effects of Anesthetics on Systemic Hemodynamics in Mice. Am. J. Physiol. Heart Circ. Physiol. 2004, 287, H1618–H1624. [Google Scholar] [CrossRef]
- Tossell, K.; Dodhia, R.A.; Galet, B.; Tkachuk, O.; Ungless, M.A. Tonic GABAergic Inhibition, via GABAA Receptors Containing αβε Subunits, Regulates Excitability of Ventral Tegmental Area Dopamine Neurons. Eur. J. Neurosci. 2021, 53, 1722–1737. [Google Scholar] [CrossRef]
- Sinkkonen, S.T.; Hanna, M.C.; Kirkness, E.F.; Korpi, E.R. GABAA receptor ε and θ subunits display unusual structural variation between species and are enriched in the rat locus ceruleus. J. Neurosci. 2000, 20, 3588–3595. [Google Scholar] [CrossRef]
- Fang, H.; Wang, Z.; Bu, Y.; Yuan, Z.; Wang, G.; Guo, Y.; Cheng, X.; Qiu, W. Repeated Inhalation of Sevoflurane Inhibits the Information Transmission of Purkinje Cells and Delays Motor Development via the GABAA Receptor ε Subunit in Neonatal Mice. Mol. Med. Rep. 2017, 17, 1083–1092. [Google Scholar] [CrossRef] [PubMed]
- Hengen, K.B.; Nelson, N.R.; Stang, K.M.; Johnson, S.M.; Smith, S.M.; Watters, J.J.; Mitchell, G.S.; Behan, M. Daily Isoflurane Exposure Increases Barbiturate Insensitivity in Medullary Respiratory and Cortical Neurons via Expression of ε-Subunit Containing GABA ARs. PLoS ONE 2015, 10, e0119351. [Google Scholar] [CrossRef] [PubMed]
- Sequeira, A.; Shen, K.; Gottlieb, A.; Limon, A. Human Brain Transcriptome Analysis Finds Region- and Subject-Specific Expression Signatures of GABAAR Subunits. Commun. Biol. 2019, 2, 153. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.L.; Knight, Z.A. Regulation of Body Temperature by the Nervous System. Neuron 2018, 98, 31–48. [Google Scholar] [CrossRef] [PubMed]
- Boulant, J.A. Neuronal Basis of Hammel’s Model for Set-Point Thermoregulation. J. Appl. Physiol. 2006, 100, 1347–1354. [Google Scholar] [CrossRef]
- Siemens, J.; Kamm, G.B. Cellular Populations and Thermosensing Mechanisms of the Hypothalamic Thermoregulatory Center. Pflügers Arch. Eur. J. Physiol. 2018, 470, 809–822. [Google Scholar] [CrossRef]
- Lockwood, C.; Conroy-Hiller, T.; Page, T. Vital Signs. JBI Evid. Synth. 2004, 2, 1–38. [Google Scholar] [CrossRef]
- Schulkin, J.; Sterling, P. Allostasis: A Brain-Centered, Predictive Mode of Physiological Regulation. Trends Neurosci. 2019, 42, 740–752. [Google Scholar] [CrossRef]
- Kim, J.J.; Gharpure, A.; Teng, J.; Zhuang, Y.; Howard, R.J.; Zhu, S.; Noviello, C.M.; Walsh, R.M.; Lindahl, E.; Hibbs, R.E. Shared Structural Mechanisms of General Anaesthetics and Benzodiazepines. Nature 2020, 585, 303–308. [Google Scholar] [CrossRef]
- Irnaten, M.; Walwyn, W.M.; Wang, J.; Venkatesan, P.; Evans, C.; Chang, K.S.K.; Andresen, M.C.; Hales, T.G.; Mendelowitz, D. Pentobarbital Enhances GABAergic Neurotransmission to Cardiac Parasympathetic Neurons, Which Is Prevented by Expression of GABAAε Subunit. Anesthesiology 2002, 97, 717–724. [Google Scholar] [CrossRef]
- Veerakumar, A.; Yung, A.R.; Liu, Y.; Krasnow, M.A. Molecularly Defined Circuits for Cardiovascular and Cardiopulmonary Control. Nature 2022, 606, 739–746. [Google Scholar] [CrossRef] [PubMed]
- Jiang-Xie, L.-F.; Yin, L.; Zhao, S.; Prevosto, V.; Han, B.-X.; Dzirasa, K.; Wang, F. A Common Neuroendocrine Substrate for Diverse General Anesthetics and Sleep. Neuron 2019, 102, 1053–1065.e4. [Google Scholar] [CrossRef]
- Mondino, A.; Hambrecht-Wiedbusch, V.S.; Li, D.; York, A.K.; Pal, D.; González, J.; Torterolo, P.; Mashour, G.A.; Vanini, G. Glutamatergic Neurons in the Preoptic Hypothalamus Promote Wakefulness, Destabilize NREM Sleep, Suppress REM Sleep, and Regulate Cortical Dynamics. J. Neurosci. 2021, 41, 3462–3478. [Google Scholar] [CrossRef] [PubMed]
- Reitz, S.L.; Wasilczuk, A.Z.; Beh, G.H.; Proekt, A.; Kelz, M.B. Activation of Preoptic Tachykinin 1 Neurons Promotes Wakefulness over Sleep and Volatile Anesthetic-Induced Unconsciousness. Curr. Biol. 2021, 31, 394–405.e4. [Google Scholar] [CrossRef] [PubMed]
- Reitz, S.L.; Kelz, M.B. Preoptic Area Modulation of Arousal in Natural and Drug Induced Unconscious States. Front. Neurosci. 2021, 15, 644330. [Google Scholar] [CrossRef]
- Piñol, R.A.; Mogul, A.S.; Hadley, C.K.; Saha, A.; Li, C.; Škop, V.; Province, H.S.; Xiao, C.; Gavrilova, O.; Krashes, M.J.; et al. Preoptic BRS3 Neurons Increase Body Temperature and Heart Rate via Multiple Pathways. Cell Metab. 2021, 33, 1389–1403.e6. [Google Scholar] [CrossRef]
- Jorge, J.C.; McIntyre, K.L.; Henderson, L.P. The Function and the Expression of Forebrain GABA A Receptors Change with Hormonal State in the Adult Mouse. J. Neurobiol. 2002, 50, 137–149. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, H.; Zhang, X.; Wang, S.; Wang, D.; Wang, J.; Tong, T.; Zhang, Z.; Yang, Q.; Dong, H. Estrogen Receptor-A in Medial Preoptic Area Contributes to Sex Difference of Mice in Response to Sevoflurane Anesthesia. Neurosci. Bull. 2022, 38, 703–719. [Google Scholar] [CrossRef]
- Li, M.; Yang, L.; Qian, W.; Ray, S.; Lu, Z.; Liu, T.; Zou, Y.-Y.; Naumann, R.K.; Wang, H. A Novel Rat Model of Dravet Syndrome Recapitulates Clinical Hallmarks. Neurobiol. Dis. 2023, 184, 106193. [Google Scholar] [CrossRef]





| Abbreviation | Full Name |
|---|---|
| aca | Anterior commissure, anterior part |
| AcbC | Accumbens nucleus, core region |
| AcbSh | Accumbens nucleus, shell region |
| acp | Anterior commissure, posterior limb |
| AHC | Anterior hypothalamic nucleus, central |
| Amb | Ambiguus nucleus |
| Aq | Aqueduct |
| Arc | Arcuate hypothalamic nucleus |
| Bar | Barrington’s nucleus |
| CeA | Central amygdalar nucleus |
| CPu | Caudate putamen |
| DLPAG | Dorsolateral periaqueductal gray |
| DMH | Dorsomedial hypothalamic nucleus |
| DMPAG | Dorsomedial periaqueductal gray |
| DRD | Dorsal raphe nucleus, ventral part |
| DRL | Dorsal raphe nucleus, lateral part |
| f | Fornix |
| Fu | Bed nucleus of the stria terminalis, fusiform part |
| LC | Locus coeruleus |
| LPAG | Lateral periaqueductal gray |
| LPO | Lateral preoptic area |
| LS | Lateral septum |
| LV | Lateral ventricle |
| MM | Medial mammillary nucleus |
| MnPO | Median preoptic nucleus |
| MPA | Medial preoptic area |
| MPOL | Medial preoptic nucleus, lateral part |
| MPOM | Medial preoptic nucleus, medial part |
| MS | Medial septum |
| MTu | Medial tuberal nucleus |
| NTS | Solitary tract nucleus |
| PAG | Periaqueductal gray |
| PDTg | Posterodosal tegmental nucleus |
| Pe | Periventricular hypothalamic nucleus |
| POA | Preoptic area |
| PrEW | Pre-Edinger–Westphal nucleus |
| PS | Parastrial nucleus |
| PV | Paraventricular thalamic nucleus |
| PVH | Paraventricular hypothalamic nucleus |
| SCh | Suprachiasmatic nucleus |
| scp | Superior cerebellar peduncle |
| SFO | Subfornical organ |
| SHy | Septohypothalamic nucleus |
| ST | Bed nucleus of the stria terminalis |
| STLV | Bed nucleus of the stria terminalis, lateral division, ventral part |
| STMV | Bed nucleus of the stria terminalis, medial division, ventral part |
| VLPAG | Ventrolateral periaqueductal gray |
| VMHC | Ventromedial hypothalamic nucleus, central part |
| VMHDM | Ventromedial hypothalamic nucleus, dorsomedial part |
| VMHVL | Ventromedial hypothalamic nucleus, ventrolateral part |
| VMPO | Ventromedial preoptic nucleus |
| 3V | 3rd ventricle |
| 4V | 4th ventricle |
| Brain Region | Gabre-cre::Ai14 tdT Cells | Gabre-cre::Ai14 tdT Neuropil | tdT ISH Cells | Gabre ISH Cells |
|---|---|---|---|---|
| Cerebral Cortex | ||||
| Motor Cortex | + | − | + | − |
| Somatosensory Cortex | + | − | + | − |
| Intermediate Endopiriform Nucleus | + | + | + | − |
| Cerebral Nuclei | ||||
| Lateral Septum | +++ | ++ | +++ | ++ |
| Medial Septum | − | + | + | − |
| Medial Amygdalar Nucleus | +++ | ++ | ++ | − |
| Anterior Amygdalar Area | +++ | + | ++ | − |
| Intercalated Amygdalar Nucleus | +++ | ++ | ++ | − |
| Central Amygdalar Nucleus | +++ | ++ | +++ | ++ |
| Nucleus Accumbens | + | + | + | − |
| Bed Nucleus of the Stria Terminalis | ++ | ++ | ++ | + |
| Thalamus | ||||
| Intergeniculate Leaflet | ++ | − | + | − |
| Lateral Geniculate Complex, Ventral Part | + | − | + | − |
| Medial Geniculate Nucleus, Medial | + | + | ++ | − |
| Suprageniculate Thalamic Nucleus | + | + | + | − |
| Paraventricular Thalamic Nucleus | +++ | ++ | + | − |
| Intermediodorsal Thalamic Nucleus | + | − | + | − |
| Reuniens Thalamic Nucleus | + | + | + | − |
| Central Medial Thalamic Nucleus | + | + | + | − |
| Hypothalamus | ||||
| Median Eminence | ++ | +++ | ++ | + |
| Arcuate Hypothalamic Nucleus | +++ | +++ | +++ | +++ |
| Medial Tuberal Nucleus | ++ | +++ | + | + |
| Dorsomedial Hypothalamic Nucleus | +++ | +++ | +++ | +++ |
| Ventromedial Hypothalamic Nucleus | ++ | ++ | +++ | + |
| Zona Incerta | + | +++ | + | + |
| Lateral Hypothalamic Area | +++ | +++ | ++ | + |
| Periventricular Hypothalamic Nucleus | +++ | +++ | + | ++ |
| Parastrial Nucleus | + | ++ | + | + |
| Medial Preoptic Nucleus, Medial Part | +++ | ++ | +++ | ++ |
| Medial Preoptic Nucleus, Lateral Part | ++ | ++ | ++ | + |
| Ventromedial Preoptic Nucleus | +++ | ++ | +++ | ++ |
| Septohypothalamic Nucleus | + | ++ | ++ | ++ |
| Lateral Preoptic Area | + | ++ | + | - |
| Medial Preoptic Area | + | ++ | ++ | ++ |
| Median Preoptic Nucleus | +++ | ++ | ++ | + |
| Posterior Hypothalamic Nucleus | ++ | +++ | ++ | + |
| Medial Mamillary Nucleus | + | ++ | + | + |
| Paraventricular Hypothalamic Nucleus | ++ | ++ | +++ | − |
| Subfornical Organ | +++ | +++ | +++ | + |
| Suprachiasmatic Area | ++ | + | +++ | + |
| Anterior Hypothalamic Nucleus | ++ | ++ | ++ | + |
| Midbrain | ||||
| Pariaqueductal Gray | +++ | +++ | ++ | + |
| Pre-Edinger–Westphal Nucleus | ++ | + | ++ | + |
| Mesencephalic Reticular Formation | − | ++ | + | − |
| Isthmic Reticular Formation | − | ++ | + | − |
| Pedunculotegmental Nucleus | − | + | + | − |
| Interpeduncular Nucleus, Rostral Subnucleus | + | + | + | − |
| Dorsal Raphe Nucleus | + | + | ++ | + |
| Hindbrain | ||||
| Locus Coeruleus | ++ | +++ | +++ | +++ |
| Solitary Tract Nucleus | +++ | + | +++ | + |
| Intermediate Reticular Nucleus | − | + | ++ | + |
| Ambiguus Nucleus | + | + | ++ | − |
| Botzinger Complex | + | + | + | − |
| Raphe Pallidus Nucleus | ++ | − | ++ | + |
| Inferior Olive, Principal Nucleus | + | + | ++ | + |
| Area Postrema | + | + | +++ | − |
| Fiber tracts | ||||
| Superior Cerebellar Peduncle | − | + | − | − |
| Primer | Sequence (5′→3′) |
|---|---|
| P1 | TTCCAACCAATAGCCGTGCTAATG |
| P2 | TGGACCAATGTGAACATAGTGATGAACTAC |
| P3 | CTGCTATACTGTTGCTCTGTGCATTCTG |
| Primer | Sequence (5′→3′) |
|---|---|
| Gabre mouse forward | ATACTCGAGTTGACATCATCTTCCACCAGACCTG |
| Gabre mouse reverse | TGGTTGGAAGTTGGTAGACCTTTAGAGAAGC |
| tdT forward | ATGGTGAGCAAGGGCGAGGA |
| tdT reverse | GGCATGGACGAGCTGTACAAG |
| GABRE macaque forward | TCTTCAAGGAGCATCCGTGATGC |
| GABRE macaque reverse | GTGACAGTGGGCTCTTGGATAGCTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Li, L.; Li, M.; Lu, Z.; Qin, L.; Naumann, R.K.; Wang, H. Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate. Int. J. Mol. Sci. 2024, 25, 13061. https://doi.org/10.3390/ijms252313061
Wang Z, Li L, Li M, Lu Z, Qin L, Naumann RK, Wang H. Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate. International Journal of Molecular Sciences. 2024; 25(23):13061. https://doi.org/10.3390/ijms252313061
Chicago/Turabian StyleWang, Ziyue, Lanxiang Li, Miao Li, Zhonghua Lu, Lihua Qin, Robert Konrad Naumann, and Hong Wang. 2024. "Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate" International Journal of Molecular Sciences 25, no. 23: 13061. https://doi.org/10.3390/ijms252313061
APA StyleWang, Z., Li, L., Li, M., Lu, Z., Qin, L., Naumann, R. K., & Wang, H. (2024). Chemogenetic Modulation of Preoptic Gabre Neurons Decreases Body Temperature and Heart Rate. International Journal of Molecular Sciences, 25(23), 13061. https://doi.org/10.3390/ijms252313061

