Next Article in Journal
Synthesis of Bis(isodecyl Terephthalate) from Waste Poly(ethylene Terephthalate) Catalyzed by Lewis Acid Catalysts
Previous Article in Journal
Protein Dynamics in Plant Immunity: Insights into Plant–Pest Interactions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Natural Inhibitors of Salmonella MDR Efflux Pumps AcrAB and AcrD: An Integrated In Silico, Molecular, and In Vitro Investigation

1
Laboratory of Biotechnology, Department of Microbiology, Agricultural Research Center (ARC), Animal Health Research Institute (AHRI), Zagazig 44516, Egypt
2
Department of Botany and Microbiology, Faculty of Science, Zagazig University, Zagazig 44519, Egypt
3
Research Department, Natural and Health Sciences Research Center, Princess Nourah bint Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia
4
Department of Biology, College of Sciences, Princess Nourah bint Abdulrahman University, Riyadh 13415, Saudi Arabia
5
Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, KasrEl-Aini Street, Cairo 11562, Egypt
6
Infection Control and Epidemiology Surveillance Unit, Aweash El-Hagar Family Medicine Center, Ministry of Health and Population (MOHP), Mansoura 35711, Egypt
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(23), 12949; https://doi.org/10.3390/ijms252312949
Submission received: 25 October 2024 / Revised: 23 November 2024 / Accepted: 26 November 2024 / Published: 2 December 2024
(This article belongs to the Section Molecular Biology)

Abstract

Multidrug-resistant (MDR) Salmonella remains a significant global health threat. This study aimed to explore the potential of essential oil components as novel inhibitors of the Salmonella MDR efflux pumps AcrAB and AcrD. Salmonella isolates were characterized for serotype, antibiotic resistance, and efflux pump activity. Essential oil components were screened for inhibitory effects using phenotypic and genotypic methods. In silico docking and molecular dynamics simulations were conducted to investigate binding interactions and stability. Salmonella Typhimurium was the predominant serotype with high MDR rates. Efflux pump activity was prevalent. Cumin and cinnamon oils demonstrated promising inhibitory effects on these pumps. Molecular docking simulations revealed strong binding affinities of analyzed compounds to the AcrAB and AcrD binding pocket. The 2-methyl-1-(p-tolyl)propan-2-ol exhibited higher stability within the AcrAB binding pocket compared to (1S,3R,5R)-1-isopropyl-4-methylenebicyclo[3.1.0]hexan-3-ol within the AcrD binding pocket. Treatment with these oils significantly downregulated efflux pump genes (robA, acrB, mdtB, acrF, acrD, soxS, mdsB, marA). The novel approach of combining in silico and molecular dynamics simulations with precise gene expression analysis provides a valuable framework for future studies aimed at combating MDR Salmonella efflux pumps.

Graphical Abstract

1. Introduction

Salmonella enterica serovars are a significant global health concern, causing an estimated three million cases of foodborne illness annually, according to the WHO [1]. The emergence of multidrug-resistant (MDR) Salmonella strains has exacerbated this problem, limiting treatment options [2,3,4]. Efflux pumps, which actively expel antibiotics from bacterial cells, are key contributors to MDR. These protein channels embedded in the bacterial cell membrane reduce the intracellular concentration of antibiotics, rendering them less effective [5].
Among the various efflux pump families in Salmonella, resistance-nodulation-division (RND) pumps play a pivotal role in multidrug resistance. The AcrAB-TolC complex is the most well-studied RND pump in Salmonella. However, another RND pump, AcrD, has also been implicated in conferring multidrug resistance. AcrD is a tripartite complex consisting of an inner membrane efflux pump, a membrane fusion protein, and a TolC-like outer membrane protein. While homologous to the AcrB subunit of the AcrAB-TolC complex, AcrD exhibits distinct substrate specificity and regulatory mechanisms [6,7,8,9]. It is known to confer resistance to a variety of antibiotics, including beta-lactams, fluoroquinolones, and aminoglycosides.
Other efflux pump families in Salmonella include major facilitator superfamily (MFS), small multidrug resistance (SMR), and multidrug efflux (MEX) pumps, each with specific substrates [8,9]. Overexpression of efflux pumps can confer resistance to multiple antibiotic classes, making it challenging to treat infections caused by MDR Salmonella strains [10]. Understanding the mechanisms of efflux pump-mediated resistance is crucial for developing new strategies to combat these infections.
Plant extracts and natural compounds have demonstrated potential in modulating bacterial resistance, including reversing their inherent resistance to certain antibiotics [11,12,13,14]. Essential oils, concentrated liquids derived from plants, possess various biological properties, such as antimicrobial activity [14,15]. While research on the specific effects of essential oils on efflux pumps in Salmonella is limited, their potential to influence bacterial resistance mechanisms warrants further investigation.
This study aimed to uncover the potential of essential oil components as novel inhibitors of the Salmonella MDR efflux pumps AcrAB and AcrD. By characterizing Salmonella isolates, screening essential oils, gene expression assays, and employing advanced in silico modeling techniques, we sought to identify and investigate compounds that could effectively target these critical resistance mechanisms.

2. Results

2.1. Salmonella Proportion and Serotype Distribution

The prevalence of Salmonella spp. was significantly higher in minced meat (n = 11/21, 64.27%) compared to other food products (sausage, kofta, and luncheon meat; 11.76%; p = 0.0025; Figure 1A). In human samples, there was no significant difference in Salmonella prevalence between stool (66.67%) and blood cultures (33.33%) from patients with gastrointestinal symptoms (p = 0.2482; Figure 1B). Overall, Salmonella spp. was detected in a higher proportion of food samples (72.41%) compared to human samples (50.20%) (OR = 0.498; p = 0.0914; Figure 1C).
Regarding serotypes, S. Typhimurium was the predominant serotype, with a higher prevalence in food samples (64.29%) compared to human samples (35.71%) (Figure 2). Notably, S. Enteritidis and S. Virchow were not detected in clinical samples, and S. Montevideo and S. Anatum were absent from food products.

2.2. Antibiotic Susceptibility Pattern and Efflux Pumps

Salmonella isolates exhibited a high level of susceptibility to the majority of antibiotics tested (p < 0.0001). However, resistance was observed to ampicillin/sulbactam, ceftazidime, amoxicillin, and chloramphenicol (Figure 3). This trend was corroborated by the multiple antibiotic resistance (MAR) index, with minced meat isolates demonstrating the highest resistance compared to luncheon meat. Alarmingly, 86.2% (25/29) of isolates displayed a multidrug-resistant (MDR) phenotype (Table 1). Ceftriaxone was the most effective antibiotic among those tested and served as a comparator for subsequent experiments.
The high prevalence of efflux pump activity in 93% of isolates (n = 29) highlights a significant challenge in treating Salmonella infections. These efflux pumps likely contribute to the observed antibiotic resistance and MDR phenotype.

2.3. Essential Oil Activity

Cinnamon and cumin oils demonstrated the strongest antimicrobial activity among the tested oils, with inhibition zones ranging from 20 to 36 mm against Salmonella isolates through an agar well diffusion test (Figure S17). Principal component analysis (PCA) is a statistical technique used to reduce the dimensionality of data. In the context of essential oil activity, PCA can help to identify patterns and relationships between different oils based on their antimicrobial properties. By analyzing the inhibition zones of various oils against different microorganisms, PCA can group oils with similar antimicrobial profiles. PCA revealed a strong positive correlation between the inhibition zones of Nigella sativa oil and those of cumin and cinnamon oils (r = 0.744; p < 0.05, Figure 4). Factor analysis identified four factors that described 80.89% of the total data variability in the essential oil activity. The first dominant factor (35.85% of the total variance) described the combined effects of inhibition zones from ginger, cumin, cinnamon, and thymus oil. The second factor (20.93% of the total variance) revealed significant loading on the properties of Nigella sativa oil. The third component (12.64% of the total variance) gave a strong positive load to the activity of sage oil (Table 2 and Figure 5). PCA and factor analysis can help to optimize the formulation of essential oil-based products for various applications, such as food preservation, personal care, and medicine.

Minimum Inhibitory Concentration (MIC) Findings

Both cinnamon and cumin oils exhibited a wide range of antimicrobial activity against the tested Salmonella isolates. The minimum inhibitory concentration (MIC) of cinnamon oil ranged from 0.125 to 8 μg/mL, while the minimum bactericidal concentration (MBC) ranged from 0.5 to 32 μg/mL. Similarly, cumin oil displayed an MIC range of 0.125 to 8 μg/mL and an MBC range of 0.5 to 16 μg/mL. Notably, both oils demonstrated sub-inhibitory concentration (SIC) values ranging from 0.125 to 8 μg/mL and 0.125 to 4 μg/mL, respectively, indicating potential effects at concentrations below the MIC (Table S2). The susceptibility range of different isolates to oils can vary based on their genetic makeup and physiological state.

2.4. Characterization of Compounds Present in the Oily Extracts (Cinnamon and Cumin) Using GC-MS

GC-MS analysis of cinnamon oil revealed cinnamaldehyde (E)- as the primary constituent, comprising 58.23% of the total composition. Benzaldehyde was identified as the second most abundant component, accounting for 41.61%. Minor components included 1,6-Heptadiyne, benzyl alcohol, formic acid, phenylmethyl ester, N-Cbz-6-Bromo-hexylamine, and 3-Methyl-2-propylcyclopent-2-en-1-one (Table S3, Figure S1).
Similarly, GC-MS analysis of cumin oil identified 39 compounds. The predominant components were 1,4-Cyclohexadiene-1-methanol, 4-(1-methylethyl)- (29.76%), and 2-Caren-10-al (27.95%). Limonene and Eucalyptol were detected as minor constituents (Table S4, Figure S2).

2.5. Molecular Docking Study

2.5.1. Molecular Docking of Target Compounds Against Salmonella Typhimurium

Proximal Binding Pocket of MDR Efflux Pump AcrAB. All analyzed compounds demonstrated binding affinities to the Salmonella Typhimurium MDR efflux pump AcrAB, as shown in Table 3. These compounds exhibited a binding pattern similar to the reference drug (PDB ID: A1AN8), as illustrated in Figure 6. Compound 12 interacted with Leu828, Ala618, Phe617, Met575, and Phe646 by nine hydrophobic π-interactions and formed one hydrogen bond with Arg717 (Figure S3). Compound 21 formed five hydrophobic π-interactions and one hydrogen bond with Arg717 with a distance of 2.34 Å (Figure S4). Compound 22 interacted by three hydrophobic π-interactions and two hydrogen bonds with Arg717 and Asn719 with distances of 2.43 and 2.69 Å (Figure 7). Compound 23 interacted by four hydrophobic π-interactions with Ala618, Phe664, Met575, and the interaction was supported by two hydrogen bonds with Ala618, and Phe617 with distances of 2.17 and 2.45 Å (Figure S5).
Compound 24 exhibited the strongest binding affinity (−6.98 kcal/mol), forming eight π-interactions and one hydrogen bond with Arg717 (2.39 Å) (Figure 8). Compound 31 (ΔG = −6.56 kcal/mol) formed four π-interactions and one hydrogen bond with Arg717 (2.55 Å) (Figures S6 and S16). Compound 37 (ΔG = −5.87 kcal/mol) formed seven π-interactions with Leu828, Arg717, Ala618, Leu721, and Met575 (Figure S7).
The reference compound (PDB ID: A1AN8) exhibited a binding affinity of −6.88 kcal/mol. It formed seven hydrophobic π-interactions with Ala618, Phe617, Met575, and Phe666, and two hydrogen bonds with Arg717 (2.17 and 2.29 Å) (Figure 9).

2.5.2. Molecular Docking of Target Compounds Against Salmonella Typhimurium Proximal Binding Pocket of MDR Efflux Pump AcrD

The binding mode of Compound 4 exhibited a binding energy of −5.56 kcal/mol. against Salmonella efflux pump target site. two hydrophobic π-interactions were observed with Glu239. Additionally, Compound 4 formed a hydrogen bond with Thr94 with a bond length of 2.18 Å (Figure S8). Moreover, Compound 12 exhibited an affinity score of −5.36 kcal/ mol, against Salmonella efflux pump target site. It interacted with Asn14, and Tyr241 by one hydrogen bond and one hydrophobic π-interaction with a bond length of 2.01 Å (Figure S9). The binding mode of Compound 13 exhibited an affinity score of −6.23 kcal/ mol. against Salmonella efflux pump target site. Compound 13 showed three hydrophobic π-interactions with Thr12, Tyr144, and Tyr241 (Figure S10). The binding mode of Compound 16 exhibited an energy binding of −5.61 kcal/ mol. against Salmonella efflux pump target site. It formed three hydrophobic π-interactions with Tyr241, Gln91, and Leu135, moreover formed two hydrogen bonds with Ser149, and Tyr241 with bond lengths of 2.15, and 1.98 Å (Figure S11).
The binding mode of Compound 18 exhibited a binding energy of −7.29 kcal/ mol. against Salmonella efflux pump target site. Compound 18 formed two ionic interactions and one hydrophobic π-interactions with Glu289, Arg151, and Gly92. Moreover, Compound 18 interacted with Thr94 by one hydrogen bond with bond lengths of 2.22 Å (Figure S12). The binding mode of Compound 22 exhibited an energy binding of −5.41 kcal/ mol. against Salmonella efflux pump target site. Compound 22 formed two hydrophobic π-interactions with Tyr241, and formed two hydrogen bonds with Asn41, and Gln53 with distances of 2.15, and 2.36 Å (Figure 10). The binding mode of Compound 21 exhibited an affinity score of −6.21 kcal/ mol. against Salmonella efflux pump target site. Compound 21 formed a hydrophobic π-interaction with Glu91, additionally, three hydrogen bonds were obtained by interaction with Thr94, Gly92, and Gln91 with a distance of 2.04, 2.05, and 2.13 Å (Figure 11). The binding mode of Compound 23 and Compound 24 exhibited affinity scores of −5.23 and −6.27 kcal/ mol., respectively against Salmonella efflux pump target site. Compound 23 formed two hydrophobic interactions with Tyr241, and one hydrogen bond with Arg151 with a distance of 1.98 Å (Figure S13). while Compound 24 formed two hydrophobic interactions with Tyr144, and Tyr241, and additionally, interacted with Asn197 by one hydrogen bond with a bond length of 2.06 Å (Figure S14). The binding mode of Compound 25 exhibited a high affinity score equal −7.64 kcal/ mol. against Salmonella efflux pump target site. Compound 25 formed two hydrophobic π-interaction with Tyr241. Additionally, interacted with Gly92, Gln91, and Asn14 by three hydrogen bonds with bond lengths of 2.61, 2.11, and 2.54 Å (Figure 12). While Compound 29 exhibited ∆G score equal −5.87 kcal/ mol. against Salmonella efflux pump target site. Compound 29 formed two hydrophobic π-interactions with Tye144, and Tyr241, moreover interacted with Tyr241 by a hydrogen bond with a distance of 2.01 Å (Figures S14–S15).

2.6. Molecular Dynamic (MD) Simulation Study

To investigate the stability and dynamics of the protein–ligand complexes, molecular dynamics (MD) simulations were conducted for 100 ns. The root mean square deviations (RMSDs) for the complexes and ligands were calculated to assess their conformational stability within the active site. Frontier compound interactions were also analyzed in detail. Additionally, the MM-GBSA free binding energy was estimated for each complex during the simulation trajectories and 3D frames of all changes that occurred in the complexes during the simulation period were also presented in Figure 13.

2.6.1. Protein and Ligand RMSD and RMSF Analysis

Compounds 24/AcrAB and 25/AcrD complexes were selected for MD simulation. The conformational stability of the protein structures was monitored through the Cα atoms of the protein concerning their initial position. As shown in Figure 14A, Compound 24/AcrAB complex showed high stability inside the target pocket with an RMSD value within 1.80 Å, which is an acceptable value below 3.00 Å. Compound 24 showed stability between 0–40 ns then a minor fluctuation occurs at 45–55 ns and showed stability until the end of simulation time with minor fluctuation at 75–77 ns. Additionally, the protein structure of AcrAB showed notable stability over the simulation time and fluctuated within 1.50 Å. Minor fluctuations were observed in the amino acid regions 230–250 and 500–550, indicating subtle conformational changes. However, these changes did not significantly impact ligand binding within the active site (Figure 14B). On the other hand, Compound 25/AcrD complex showed some major fluctuations during simulation time at 15–20 ns and the period form 55–65 ns that proves the area of amino acids ligand interaction had many conformational changes, the ligand simulation fluctuated within 2.5 Å and the protein skeleton fluctuated within 1.7 Å that indicate some sort of stability of ligand inside the target pocket sometimes of the simulation run (Figure 14C). The AcrD protein structure showed many fluctuations around the 10–30, 80–90, 180–190, and 225–230 amino acids area, which can affect the binding pattern of Compound 25 with the AcrD binding site (Figure 14D).

2.6.2. Protein–Ligand Interactions Analysis

Histogram of Protein–Ligand Interactions Analysis
The target compounds showed higher stability with AcrAB when compared to the interactions with AcrD (Table 4). Compound 24 formed H-bond interactions with the following residues: Ser134 (~7.5%), Gln176-Lys292-Gly616 (~5%), and Arg717 (~10%), as presented in Figure 15A. Compound 25 interacted with MDR efflux pump AcrD by many hydrogen bonds with residues, Thr12 (~7%), Asn14 (~15%), Gln53 (~2%), Gln91 (~15%), Gly92 (~45%), Thr94 (~20%), Ser149 (~15%), and Asn197 (~15%).
Compound 24 formed water-bridged H-bonds with residues Ser133 (~5%), Ser134 (~10%), Gln176 (~5%), Lys292 (~5%), Gly616 (~5%), Pro669 (~3%), Leu674 (~10%), and Arg717 (~10%) (Figure 14A). Compound 25 formed water-bridged H-bonds with residues Thr12 (~10%), Asn14 (~5%), Gln53 (~30%), Thr94 (~15%), Ser149 (~5%), Asn197 (~5%), Glu239 (~5%), and Tyr241 (5%) (Figure 15B). Additionally, Compound 24 formed hydrophobic interactions with residues Phe136 (~30%), Leu573 (~10%), Met575 (~10%), Phe617 (~15%), Ile626 (~5%), Phe666 (~5%), Leu668 (~5%), and Pro669 (~5%). Compound 25 formed hydrophobic interactions with residues Leu185 (~20%) and Tyr241 (~40%).
To analyze the dynamic nature of the protein–ligand interactions, heat maps were generated to visualize the number of interactions over time (Figure 16 and Figure 17). The heat maps revealed that both Compound 24/AcrAB and Compound 25/AcrD complexes formed up to four hydrogen bonds during the simulations. Key amino acid residues involved in the interactions with Compound 24 included Phe136, Phe617, and Arg717. Compound 25 interacted with Asn14, Gln53, Gly92, Thr94, Ser149, Tyr241, and Leu145.
MM-GBSA Calculations
Molecular mechanics generalized born surface area (MM-GBSA) calculations were performed to estimate the binding free energies of the compounds with the AcrAB and AcrD complexes. The results indicate that Compound 25/AcrD exhibited a stable binding interaction throughout the simulation (Figure 18), while Compound 24/AcrAB showed a notable increase in free energy at the end of the simulation, suggesting a less stable interaction (Figure 19). From the next results, Compound 25/AcrD showed no change in ∆G from the starting period until the end of the simulation time, while Compound 24/AcrAB showed a notable increase in free energy at the end of the simulation time rather than the starting point, which indicates Compound 24/AcrAB has more stability at the end of simulation process (Figure 20).

2.7. Detection of Efflux Pump Genes by Conventional PCR

Efflux pump genes were detected in a high proportion of Salmonella isolates, with robA, AcrB, mdtB, acrF, and acrD being the most prevalent, with detection rates ranging from 72.4% to 93%. The presence of multiple efflux pump genes in many isolates suggests a complex mechanism of antibiotic resistance. Isolates harboring a greater number of efflux pump genes generally exhibited higher levels of multidrug resistance (Table 1).

2.8. Modulatory Effects of Cumin and Cinnamon Oils on Efflux Pump Gene Transcription in Salmonella

Treatment with sub-inhibitory concentrations (SICs) of cumin and cinnamon oils significantly downregulated the expression of efflux pump genes (acrB, mdtB, acrF, and acrD) in Salmonella compared to the untreated control group (p < 0.05; Figure 21). Although there was no significant difference in the expression of the regulatory genes soxS, marA, and robA between the cumin and cinnamon oil groups (p > 0.05), both oils effectively reduced their expression compared to both the control and ceftriaxone (CRO)-treated groups (p < 0.05; Figure 21B,C,G,H). Notably, cinnamon oil exhibited a more pronounced inhibitory effect on mdsB transcription compared to cumin oil (p < 0.05; Figure 21D). These results suggest that both cumin and cinnamon oils can effectively inhibit efflux pump activity in Salmonella by downregulating the expression of key efflux pump genes and their regulatory factors.

3. Discussion

The emergence of multidrug-resistant (MDR) Salmonella strains poses a significant public health challenge. This study investigated the prevalence of Salmonella in food and human samples, characterized their antibiotic resistance profiles, and explored the potential of plant-derived compounds to mitigate these issues.
Our findings revealed a higher prevalence of Salmonella in food products compared to human samples, which aligns with previous studies [16,17,18]. The lower prevalence of Salmonella spp. in human samples compared to food products suggests that effective food safety measures are being implemented at certain points in the food chain. However, the high prevalence of minced meat highlights a potential source of contamination. The absence of specific serotypes (S. Enteritidis and S. Virchow) in clinical samples or food products could be attributed to several factors, including regional variations in circulating serotypes, differences in surveillance strategies, or the impact of control measures. The dominance of S. Typhimurium in both food and human samples suggests its significant role in Salmonella infections in the region.
The observed antibiotic resistance patterns indicate a concerning trend of multidrug resistance among Salmonella isolates. The high levels of resistance to ampicillin/sulbactam, azithromycin, and chloramphenicol highlight the need for continued surveillance and the development of alternative therapeutic strategies. These findings differ slightly from previous studies [19,20], highlighting the geographical variation in antibiotic resistance patterns and emphasizing the need for continued monitoring of antibiotic resistance patterns in Salmonella.
The high MAR index, particularly in isolates from minced meat (MAR index = 0.8), suggests a worrying trend of multidrug resistance (MDR) in Salmonella. This complicates treatment options, as infections caused by MDR Salmonella become more challenging to eradicate. The observation of 86.2% of isolates displaying an MDR pattern further reinforces this concern and great hazard to public health.
The high prevalence of antibiotic resistance, particularly among isolates from minced meat, is concerning. The emergence of MDR strains, as evidenced by the MAR index and the resistance profiles, underscores the need for alternative treatment strategies.
The fact that ceftriaxone remained the most effective antibiotic highlights its current importance in treating Salmonella infections. However, continued reliance on a single antibiotic can lead to the emergence of resistance in the future.
The concerning finding of 93% of isolates exhibiting efflux pump activity highlights a significant challenge in treating Salmonella infections. Efflux pumps can reduce the effectiveness of antibiotics rendering them less potent.
The combination of MDR and efflux pump activity poses a significant challenge for effectively treating Salmonella infections. This necessitates continued research and development of alternative therapeutic strategies to combat these evolving resistance mechanisms. Additionally, efflux pumps play a crucial role in facilitating antibiotic resistance by actively expelling antibiotics from the bacterial cell. Inhibition of these efflux pumps using EOs can increase the intracellular concentration of antibiotics, enhancing their efficacy against MDR Salmonella strains [21].
Cumin and cinnamon oils demonstrated promising antibacterial activity and the ability to downregulate the expression of key efflux pump genes, including robA, acrB, mdtB, acrF, acrD, soxS, and marA. AcrB, the central component, is responsible for drug recognition and efflux [22]. The mdtB efflux pump, belonging to the major facilitator superfamily, contributes to resistance to a broad spectrum of antibiotics [23]. AcrF, another member of the RND family, plays a role in multidrug resistance in Salmonella [24].
The robA gene encodes a transcriptional regulator that plays a crucial role in the expression of efflux pump genes in Salmonella [25]. robA acts as a transcriptional repressor, downregulating the expression of efflux pump genes under specific conditions. By binding to specific promoter regions of efflux pump genes, robA physically hinders the binding of RNA polymerase, thereby preventing transcription initiation. This regulatory mechanism effectively limits the activity of efflux pumps, reducing the efflux of antibiotics and other toxic substances from the bacterial cell [26,27]. Designing of novel primer targeting this gene was impactful and significant.
The regulatory genes soxS and marA control the expression of efflux pump genes in response to environmental stresses, including antibiotic exposure. SoxS regulates the expression of the AcrAB-TolC system, while marA controls a wider range of efflux pumps and outer membrane proteins [28]. The mdsB gene encodes a component of the minor facilitator superfamily efflux pump, contributing to the overall efflux capacity of the cell.
Downregulation of these efflux pump genes by cumin and cinnamon oils suggests a potential mechanism for their antibacterial activity. By inhibiting the expression of these genes, these natural compounds may increase the intracellular concentration of antibiotics, enhancing their efficacy and overcoming antibiotic resistance.
GC-MS analysis identified cinnamaldehyde and benzaldehyde as the primary constituents of cinnamon oil aligns well with previous studies on the chemical composition of cinnamon essential oil. These compounds have been extensively studied for their antimicrobial properties and are known to contribute significantly to the overall antimicrobial activity of cinnamon oil [29,30]. Similarly, the identification of 1,4-Cyclohexadiene-1-methanol and 2-Caren-10-al as major components of cumin oil is consistent with previous research. These compounds have also been reported to possess antimicrobial activity, supporting the observed inhibitory effects of cumin oil against Salmonella [31,32].
Molecular docking simulations demonstrated that all analyzed compounds exhibited strong binding affinities to the proximal binding pocket of the Salmonella Typhimurium MDR efflux pump AcrAB, suggesting their potential as inhibitors. Compound 24 exhibited higher stability within the AcrAB binding pocket compared to Compound 25 within the AcrD binding pocket.
The conformational changes observed in the acrD protein structure suggest that the binding of Compound 25 may be influenced by the flexibility of the AcrD protein. Further analysis is needed to understand the implications of these conformational changes on the binding affinity and efficacy of Compound 25 as an inhibitor of the AcrD efflux pump.
The results indicate that Compound 24 exhibits a higher affinity for the AcrAB efflux pump compared to AcrD. This suggests that Compound 24 may be more effective in inhibiting the AcrAB pump, which could potentially be beneficial in combating multidrug-resistant Salmonella infections.
The identification of specific amino acid residues involved in the binding interactions between the compounds and AcrAB provides novel and valuable insights into the mechanism of action of these compounds. This information may inform the design of future inhibitors targeting the AcrAB efflux pump.
Both Compound 24 and Compound 25 form a variety of interactions with the MDR efflux pump AcrAB, including water-bridged hydrogen bonds and hydrophobic interactions. These interactions contribute to the binding affinity of the compounds and their potential inhibitory effects on the efflux pump.
The heat maps provide valuable insights into the dynamics of the protein–ligand interactions over time. The identification of the most frequently interacting amino acid residues in each complex can help to elucidate the key determinants of binding affinity and specificity.
The MM-GBSA calculations revealed that Compound 25/AcrD showed no change in ΔG from the starting period until the end of simulation time, indicating a stable binding interaction. In contrast, Compound 24/AcrAB showed a notable increase in free energy at the end of the simulation time, suggesting that the binding stability of Compound 24 with AcrAB may decrease over time.
These findings suggest that Compound 25 may have a more stable interaction with the AcrD efflux pump compared to Compound 24 with the AcrAB efflux pump.

4. Materials and Methods

4.1. Sampling Methodology

A total of 100 samples were randomly collected for the study: 61 food samples and 39 human samples. Food samples included 21 minced meat, 27 sausage, 4 kofta, and 9 luncheon meat, collected from supermarkets and butcher shops in Al Sharkia Governorate, Egypt, between 2022 and 2024. Human samples (21 stool and 18 blood) were obtained from patients with gastroenteritis symptoms in hospitals and clinical laboratories in the same region during the same period. Human patients were selected based on their reported symptoms. Food samples were collected using aseptic techniques.

4.2. Isolation and Identification

Standard cultivation methods, as recommended by ISO 6579-1: 2017 [33], were employed with modifications. Samples were homogenized at 10% in buffered peptone solution using a Stomacher 400R (Seward, London, UK) and incubated overnight at 37 °C. Pre-enrichment was performed in Rappaport Vassiliadis (RV) broth (Lab M, Bury, UK) at 41 °C for 18–24 h. Salmonella was isolated on XLD agar plates (BioLife, Bothell, Washington, DC, USA) at 37 °C for 18–24 h. Atypical colonies were further confirmed on MSRV, HE, and Bismuth Sulfite Agar. Suspect colonies were biochemically characterized using the API 20E® system (BioMerieux, Marcy-l’Étoile, France). Blood samples were enriched using bile salt broth and streptokinase broth according to Nagshetty et al. [34] and subsequently cultured on selective agar.
Serological identification of somatic (O) and flagellar (H) antigens was performed on biochemically confirmed smooth isolates using the Kauffman–White scheme. Rough autoagglutinable isolates were excluded from serotyping.

4.3. Antibiotics Susceptibility Testing

Antimicrobial susceptibility testing was performed using the Kirby–Bauer disk diffusion method [35] on Mueller–Hinton agar according to CLSI guidelines [36]. Bacterial suspensions were prepared to a 0.5 McFarland standard. Antimicrobial disks containing Ampicillin/Sulbactam (A/S/10/10), gentamicin (CN, 10 μg), amikacin (AK, 30 μg), levofloxacin (LE, 5 μg), ofloxacin (OF, 5 μg), ceftazidime (CAZ, 30 μg), amoxicillin (AX, 25 μg), ciprofloxacin (CIP, 5 μg), ceftriaxone (CRO, 30 μg), chloramphenicol (C, 30 μg), and tetracycline (TE, 30 μg) were applied to inoculated plates. Zones of inhibition were measured and interpreted according to CLSI standards. Quality control strains were included in each testing run to ensure accurate results.
The multiple antibiotic resistance (MAR) index was calculated as the ratio of resistant antibiotics to total antibiotics tested [37]. This index is used to assess the overall level of antibiotic resistance in a bacterial population. Isolates resistant to at least three different antibiotic classes were considered multidrug-resistant [38]. The commercial strain ATCCTM 14028 was used as a reference and comparative phenotype.

4.4. Essential Oils (EOs)

Seven essential oils (98% purity) were obtained from the Medicinal and Aromatic Oils Unit at the National Research Center, Doki, Egypt. The oils included:
Oil NameBotanical Name
Sage oilSalvia officinalis
Nigella oilNigella sativa
Ginger oilZingiber officinale
Cumin oilCuminum cyminums L.
Cinnamon oilCinnamomum verum
Sesame oilSesamum indicum
Thyme oilThymus vulgaris

4.5. Agar Well Diffusion Assay of Herbal Oils

The antibacterial activity of seven essential oils against Salmonella isolates was investigated using the agar well diffusion method. Bacteria were cultured in nutrient broth at 37 °C for 24 h and adjusted to a concentration of 1.5 × 108 CFU/mL. Mueller–Hinton agar plates were inoculated with bacterial suspensions.
A volume of 200 µL of each essential oil was selected to ensure sufficient oil for diffusion and reliable zone of inhibition measurement. The oils were added to 7 mm wells in the agar after solubilization in 100 µL of 5% DMSO. A well containing 5% DMSO alone served as a control. Plates were incubated at 37 °C for 24 h, and inhibition zones were measured. Each assay was performed in triplicate. Inhibition zones less than 12 mm were considered negative for antibacterial activity [39]. A positive control (the most effective antimicrobial agent) was included to validate the assay

4.6. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) Determination

To determine the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values, a broth microdilution assay was performed in 96-well microtiter plates. Bacterial suspensions containing approximately 1 × 105 colony-forming units (CFU) per milliliter were prepared and added to each well. The test compounds and control antibiotics were serially diluted twofold in Luria–Bertani (LB) broth to establish a concentration range of 0.062 to 1024 µg/mL. Plates were incubated at 37 °C for 24 h.
The MIC, defined as the lowest concentration inhibiting visible growth, was determined according to Clinical and Laboratory Standards Institute (CLSI) guidelines. To assess bactericidal activity, colonies from wells exhibiting no visible growth were subcultured onto agar plates and incubated. The MBC was determined as the lowest concentration preventing colony formation, following the method described by Khosravi and Malekan [40].

4.7. Ethidium Bromide Efflux Assay

The ethidium bromide (EtBr) efflux assay was performed to evaluate the effects of essential oils on efflux pump activity in Salmonella cells. Cells were grown to an OD₆₀₀ of 0.6 in nutrient broth and washed with 20 mM potassium phosphate buffer containing 1 mm MgCl₂. EtBr was added to a final concentration of 5 µM.
Cultures were incubated at 20 °C with shaking for 60 min. After centrifugation, cells were resuspended in buffer containing 5% glucose. Fluorescence was measured over 15 min at excitation and emission wavelengths of 530 and 600 nm using a spectrofluorometer. To evaluate the effects of essential oils, cells were pre-incubated with different concentrations of each oil (0, 250, and 500 µg/mL) for 5 min at 37 °C before the addition of glucose. Higher fluorescence intensity indicates increased EtBr retention within the cells [41].

4.8. GC-MS Analysis

GC-MS analysis was conducted using a Shimadzu GC-MS system (Kyoto, Japan) equipped with a gas chromatograph (GC-2010) and a mass spectrometer (MS-QP2010 Plus) at the Central Laboratories Network, National Research Centre, Cairo, Egypt. One milliliter of the sample was diluted with 19 mL of dichloromethane, filtered through a 0.22 µm filter, and then analyzed.
The GC was fitted with a DB-5MS capillary column (30 m × 0.25 mm ID, 0.25 µm film thickness). Helium was used as the carrier gas at a flow rate of 1 mL/min. A 1 µL injection was performed in splitless mode. The GC oven temperature was programmed to start at 60 °C for 2 min, then increase to 280 °C at a rate of 5 °C/min, and hold at 280 °C for 5 min.
The mass spectrometer operated in electron ionization (EI) mode at 70 eV with a scan range of m/z 40–450. Data acquisition and processing were carried out using Shimadzu GC-MS Solutions software v.4. Compound identification was based on comparing mass spectra with those in the NIST and Wiley spectral libraries.

4.9. Molecular Docking Analysis

Molecular docking simulations were performed to assess the potential affinity of the extracted compounds from effective oils against the proximal binding pockets of Salmonella Typhimurium MDR efflux pumps AcrAB (Uniprot ID: Q8Z0T3) and AcrD (PDB code: 4R86).
At first, the receptor (protein) structures were downloaded from the Protein Data Bank (PDB), and the receptor structures were cleaned (removing water, ions, and other irrelevant molecules) using PyMOL. Then polar hydrogens were added, and the receptor structures were saved in PDBQT. Additionally, the 2D structure of each compound was drawn using Chem-Bio Draw Ultra16.0, saved as an SDF file, and then converted to a 3D structure. Protonation and energy minimization (0.1 RMSD kcal/mol) were carried out using the MMFF94 force field [42]. The prepared ligands were saved in PDBQT format and docked onto the protein receptors using Autodock Vina 1.5.7 software [43].
The receptor was held rigid while the ligands were allowed to be flexible. During the docking refinement, each molecule was allowed to generate twenty different poses. The docking scores (affinity energy) of the best-fitted poses with the active sites were recorded, and 3D figures were generated using the Discovery Studio 2016 visualizer [44].

4.10. Molecular Dynamic (MD) Simulation

Molecular dynamics (MD) simulations were performed using the Desmond simulation package from Schrödinger LLC [45]. The NPT ensemble (heating at 0–300 K. Further, with the time step of 100 ps, the system normalized in an equilibrium state at 1000 steps. The final production run was kept for 100 ns, at the time steps of 100 ps, 300 K temperature and 1.01325 atm pressure, for both complexes applying the Nose-Hoover method with NPT ensemble) was used for all simulations, maintaining a temperature of 300 K and a pressure of 1 bar. The simulations ran for 100 nanoseconds, with a relaxation time of 1 picosecond for the tested ligands. The OPLS_2005 force field parameters were applied throughout the simulations. Long-range electrostatic interactions were calculated using the particle mesh Ewald method, with a cutoff radius of 9.0 Å for Coulomb interactions [46].
Water molecules were explicitly represented using the simple point charge model. Pressure control was maintained using the Martyna–Tuckerman–Klein chain coupling scheme with a coupling constant of 2.0 picoseconds. Temperature control was achieved using the Nosé–Hoover chain coupling scheme. Nonbonded forces were calculated using the r-RESPA integrator. Short-range forces were updated every step, while long-range forces were updated every three steps. Trajectories were saved at 4.8 picosecond intervals for subsequent analysis.
The interactions between ligands and proteins were examined using the simulation interaction diagram tool within the Desmond MD package. The stability of the MD simulations was evaluated by monitoring the root mean square deviation (RMSD) of ligand and protein atom positions over time.
The AMBER 14 package with the AMBER force field ff99 [47] was used for various tasks, including minimization, the addition of counterions, solvation, equilibration, and running periodic box, explicit water (TIP4P) MD simulations for the tested ligands.
The structures of the tested ligands were optimized using the density functional theory B3LYP method with a 6–31G basis set, and parameters were set to the GAFF force field (The B3LYP functional combines Becke’s three-parameter exchange functional with the Lee-Yang-Parr correlation functional. This hybrid function provides a good computational accuracy for molecular systems. Additionally, the optimizations employed the 6–31G(d,p) basis set, which provides a good trade-off between accuracy and computational efficiency for geometry optimization and electronic property evaluation. Moreover, GAFF is designed for small organic molecules and is often used in conjunction with AMBER for hybrid quantum mechanics/molecular mechanics (QM/MM) simulations and molecular dynamics.). The protein–ligand–water system was allowed to be flexible during simulations, which comprised 10 independent runs with different random initial velocities. Each run spanned 10 nanoseconds, utilizing a timestep of 1 femtosecond. Data analysis was conducted using the cpptraj program from the AMBER Tools distribution.

4.11. Efflux Pump Gene Detection and Expression Analysis

To investigate the presence and expression of efflux pump genes, conventional and quantitative PCR were performed.

4.11.1. Detection of Efflux Pump Genes by Conventional PCR Assay

Primer sequences for efflux pump genes were designed using Primer3 v.0.4.0 and FastPCR v.6.1 software. Touchdown PCR was employed to optimize primer specificity and sensitivity, with an annealing temperature range of 50–60 °C that decreased by 1 °C per cycle. PCR amplification was carried out in a 25 µL reaction volume containing 12.5 µL of DreamTaq Green PCR Master Mix (2X, Thermo Fisher Scientific, USA), 1 µL of each primer (20 pmol each), 5.5 µL of deionized water, and 5 µL of DNA template. Amplification products were separated on a 1% agarose gel and visualized using GelRed Nucleic Acid Stain. All utilized primer sequences and cycling conditions are demonstrated in Table S1.

4.11.2. Quantitative Analysis of Gene Expression

Total RNA was extracted from both untreated and treated bacterial cultures with sub-inhibitory concentrations of each treatment (defined as concentrations that do not inhibit bacterial growth but can still induce changes in gene expression) using the QIAamp RNeasy Mini Kit (QIAGEN, Hilden, Germany) and quantified using a NanoDrop Eight Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). RNA quality was evaluated based on A260/A280 and A260/A230 ratios, as well as RNA integrity number (RIN) values. Real-time PCR was performed using SYBR Green chemistry on a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The reaction mixture consisted of 10 µL of 2x HERA SYBR® Green RT-qPCR Master Mix (Hera Biolab, Republic of Korea), 1 µL of each primer (20 pmol), 5 µL of RNA, and 3 µL of water. Cycling conditions included an initial denaturation at 95 °C for 15 min, followed by 40 cycles of 95 °C for 15 s, (annealing temperature, T°C, Table 5) for 30 s, and 72 °C for 30 s. A melting curve analysis was performed to confirm PCR product specificity. PCR efficiency for target genes and the reference gene (16S rRNA) was assessed using standard curve analysis. The relative expression levels of target genes were calculated using the 2−ΔΔCt method [48].

4.12. Statistical Analysis

Data were analyzed using MS Excel and GraphPad Prism software (version 9.5.0). The normality of data distribution was assessed using the Shapiro-Wilk test, and the homogeneity of variance was evaluated using Levene’s test. To compare the effects of treatments on mRNA gene expression, one-way ANOVA was followed by Tukey’s HSD post hoc test. Data are presented as mean ± standard error (SE). Statistical significance was considered at p < 0.05.

5. Conclusions

This study presents a groundbreaking discovery of cinnamon and cumin oils as potent inhibitors of the Salmonella MDR efflux pumps AcrAB and AcrD. These findings offer a promising avenue for combating the global health threat posed by multidrug-resistant Salmonella.
The novelty of this study lies in the comprehensive use of in silico and molecular dynamics simulations to identify and characterize potential inhibitors of these Salmonella MDR efflux pumps. Furthermore, the design and optimization of novel primers for the robA gene played a crucial role in accurately quantifying efflux pump gene expression. These primers enabled precise measurement of gene expression changes, providing valuable insights into the mechanism of action of the identified inhibitors.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms252312949/s1, References [52,53] are cited in supplementary file.

Author Contributions

Conceptualization, A.S.E.-D. and E.Y.T.E.; methodology, A.S.E.-D., S.A.K. and R.A.I.; software, A.M.S.; validation, A.S.E.-D., A.M.S. and H.H.; formal analysis, A.S.E.-D. and A.M.S.; investigation, A.S.E.-D. and A.M.S.; resources, Y.M.; data curation, A.M.S.; writing—original draft preparation, A.S.E.-D. and A.M.S.; writing—review and editing, A.S.E.-D. and A.M.S.; visualization, A.S.E.-D. and A.M.S.; supervision, A.S.E.-D. and E.Y.T.E.; project administration and funding acquisition, H.A., H.H. and Y.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R325), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

Research involving human participants was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Boards (IRBs) of the Faculty of Medicine, Zagazig University (protocol code ZU-IRB/405/2024) and King Abdullah Bin Abdulaziz University Hospital (protocol code 24-0132E). The food study was approved by the Institutional Animal Care and Use Committee (IACUC) of the Faculty of Science, Zagazig University (Approval No. ZU-IACUC/1/F/102/2024).

Informed Consent Statement

Informed consent was obtained from all human participants involved in the study.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its Supplementary Information Files.

Conflicts of Interest

The authors manifested that they have no conflicts of interest.

References

  1. Pal, M.; Merera, O.; Abera, F.; Rahman, M.T.; Hazarika, R.A. Salmonellosis: A Major Foodborne Disease of Global Significance. Beverage Food World 2015, 42, 21–24. [Google Scholar]
  2. Mina, S.A.; Hasan, M.Z.; Hossain, A.K.M.Z.; Barua, A.; Mirjada, M.R.; Chowdhury, A.M.M.A. The Prevalence of Multi-Drug Resistant Salmonella Typhi Isolated from Blood Sample. Microbiol. Insights 2023, 16, 11786361221150760. [Google Scholar] [CrossRef] [PubMed]
  3. Essawi, W.M.; El-Demerdash, A.S.; El-Mesalamy, M.M.; Abonorag, M.A. Validation of Camel’s Fetal Fluids as Antimicrobial Agents. Curr. Microbiol. 2020, 77, 1399–1404. [Google Scholar] [CrossRef] [PubMed]
  4. El-Demerdash, A.S.; Al Atfeehy, N.M.; Hamed, R.I.; Bakry, N.R.; Matter, A.A.; Eid, S. Mobile Colistin Resistance Determinants among Enterobacteriaceae Isolated from Different Poultry Species. J. Adv. Vet. Res. 2023, 13, 1004–1010. [Google Scholar]
  5. Sun, J.; Deng, Z.; Yan, A. Bacterial Multidrug Efflux Pumps: Mechanisms, Physiology and Pharmacological Exploitations. Biochem. Biophys. Res. Commun. 2014, 453, 254–267. [Google Scholar] [CrossRef]
  6. Poole, K. Efflux-Mediated Antimicrobial Resistance Keith Poole. In Antibiotic Discovery and Development; Springer: Berlin/Heidelberg, Germany, 2011; p. 349. [Google Scholar]
  7. Silva, T.O.; Bulla, A.C.S.; Teixeira, B.; Gomes, V.M.S.; Raposo, T.; Barbosa, L.S.; da Silva, M.L.; Moreira, L.O.; Olsen, P.C. Bacterial Efflux Pump OMPs as Vaccine Candidates against Multidrug-Resistant Gram-Negative Bacteria. J. Leukoc. Biol. 2024, 116, 1237–1253. [Google Scholar] [CrossRef]
  8. Nanjan, P.; Bose, V. Efflux-Mediated Multidrug Resistance in Critical Gram-Negative Bacteria and Natural Efflux Pump Inhibitors. Curr. Drug Res. Rev. Former. Curr. Drug Abus. Rev. 2024, 16, 349–368. [Google Scholar] [CrossRef]
  9. Dreier, J. Active Drug Efflux in Bacteria. Enzyme-Mediated Resistance to Antibiotics: Mechanisms, Dissemination, and Prospects for Inhibition; ASM Press: Washington, DC, USA, 2007; pp. 235–264. [Google Scholar]
  10. Alenazy, R. Antibiotic Resistance in Salmonella: Targeting Multidrug Resistance by Understanding Efflux Pumps, Regulators and the Inhibitors. J. King Saud. Univ.-Sci. 2022, 34, 102275. [Google Scholar] [CrossRef]
  11. Álvarez-Martínez, F.J.; Barrajón-Catalán, E.; Micol, V. Tackling Antibiotic Resistance with Compounds of Natural Origin: A Comprehensive Review. Biomedicines 2020, 8, 405. [Google Scholar] [CrossRef]
  12. Khare, T.; Anand, U.; Dey, A.; Assaraf, Y.G.; Chen, Z.-S.; Liu, Z.; Kumar, V. Exploring Phytochemicals for Combating Antibiotic Resistance in Microbial Pathogens. Front. Pharmacol. 2021, 12, 720726. [Google Scholar] [CrossRef] [PubMed]
  13. El-Demerdash, A.S.; Mohamady, S.N.; Megahed, H.M.; Ali, N.M. Evaluation of Gene Expression Related to Immunity, Apoptosis, and Gut Integrity That Underlies Artemisia’s Therapeutic Effects in Necrotic Enteritis-Challenged Broilers. 3Biotech 2023, 13, 181. [Google Scholar] [CrossRef] [PubMed]
  14. El-Demerdash, A.S.; Alfaraj, R.; Fared, F.; Saleh, A.; Dawwam, G.E. Essential Oils as Capsule Disruptors: Enhancing Antibiotic Efficacy against Multidrug-Resistant Klebsiella pneumoniae. Front. Microbiol. 2024, 15, 1467460. [Google Scholar] [CrossRef] [PubMed]
  15. Reyes-Jurado, F.; Franco-Vega, A.; Ramírez-Corona, N.; Palou, E.; López-Malo, A. Essential Oils: Antimicrobial Activities, Extraction Methods, and Their Modeling. Food Eng. Rev. 2015, 7, 275–297. [Google Scholar] [CrossRef]
  16. Post, A.S.; Diallo, S.N.; Guiraud, I.; Lompo, P.; Tahita, M.C.; Maltha, J.; Van Puyvelde, S.; Mattheus, W.; Ley, B.; Thriemer, K.; et al. Supporting Evidence for a Human Reservoir of Invasive Non-Typhoidal Salmonella from Household Samples in Burkina Faso. PLoS Negl. Trop. Dis. 2019, 13, e0007782. [Google Scholar] [CrossRef]
  17. Zakaria, Z.; Hassan, L.; Ahmad, N.; Husin, S.A.; Ali, R.M.; Sharif, Z.; Sohaimi, N.M.; Garba, B. Discerning the Antimicrobial Resistance, Virulence, and Phylogenetic Relatedness of Salmonella Isolates across the Human, Poultry, and Food Materials Sources in Malaysia. Front. Microbiol. 2021, 12, 652642. [Google Scholar] [CrossRef]
  18. de Melo, A.N.F.; Monte, D.F.M.; de Souza Pedrosa, G.T.; Balkey, M.; Jin, Q.; Brown, E.; Allard, M.; de Oliveira, T.C.R.M.; Cao, G.; Magnani, M.; et al. Genomic Investigation of Antimicrobial Resistance Determinants and Virulence Factors in Salmonella enterica Serovars Isolated from Contaminated Food and Human Stool Samples in Brazil. Int. J. Food Microbiol. 2021, 343, 109091. [Google Scholar] [CrossRef]
  19. Wang, Z.; Zhang, J.; Liu, S.; Zhang, Y.; Chen, C.; Xu, M.; Zhu, Y.; Chen, B.; Zhou, W.; Cui, S.; et al. Prevalence, Antimicrobial Resistance, and Genotype Diversity of Salmonella Isolates Recovered from Retail Meat in Hebei Province, China. Int. J. Food Microbiol. 2022, 364, 109515. [Google Scholar] [CrossRef]
  20. Yusof, N.Y.; Norazzman, N.I.I.; Zaidi, N.F.M.; Azlan, M.M.; Ghazali, B.; Najib, M.A.; Malik, A.H.A.; Halim, M.A.H.A.; Sanusi, M.N.S.M.; Zainal, A.A.; et al. Prevalence of Antimicrobial Resistance Genes in Salmonella Typhi: A Systematic Review and Meta-Analysis. Trop. Med. Infect. Dis. 2022, 7, 271. [Google Scholar] [CrossRef]
  21. Huang, L.; Wu, C.; Gao, H.; Xu, C.; Dai, M.; Huang, L.; Hao, H.; Wang, X.; Cheng, G. Bacterial Multidrug Efflux Pumps at the Frontline of Antimicrobial Resistance: An Overview. Antibiotics 2022, 11, 520. [Google Scholar] [CrossRef]
  22. Zgurskaya, H.I.; Nikaido, H. Bypassing the Periplasm: Reconstitution of the AcrAB Multidrug Efflux Pump of Escherichia coli. Proc. Natl. Acad. Sci. USA 1999, 96, 7190–7195. [Google Scholar] [CrossRef] [PubMed]
  23. Kumawat, M.; Nabi, B.; Daswani, M.; Viquar, I.; Pal, N.; Sharma, P.; Tiwari, S.; Sarma, D.K.; Shubham, S.; Kumar, M. Role of Bacterial Efflux Pump Proteins in Antibiotic Resistance across Microbial Species. Microb. Pathog. 2023, 181, 106182. [Google Scholar] [CrossRef] [PubMed]
  24. Yamasaki, S.; Zwama, M.; Yoneda, T.; Hayashi-Nishino, M.; Nishino, K. Drug Resistance and Physiological Roles of RND Multidrug Efflux Pumps in Salmonella enterica, Escherichia coli and Pseudomonas aeruginosa. Microbiology 2023, 169, 1322. [Google Scholar] [CrossRef]
  25. Chu, C.; Su, L.-H.; Chu, C.-H.; Baucheron, S.; Cloeckaert, A.; Chiu, C.-H. Resistance to Fluoroquinolones Linked to GyrA and ParC Mutations and Overexpression of AcrAB Efflux Pump in Salmonella enterica Serotype Choleraesuis. Microb. Drug Resist. 2005, 11, 248–253. [Google Scholar] [CrossRef]
  26. Duval, V.; Lister, I.M. MarA, SoxS and Rob of Escherichia coli—Global Regulators of Multidrug Resistance, Virulence and Stress Response. Int. J. Biotechnol. Wellness Ind. 2013, 2, 101. [Google Scholar] [CrossRef] [PubMed]
  27. Grkovic, S.; Brown, M.H.; Skurray, R.A. Transcriptional Regulation of Multidrug Efflux Pumps in Bacteria. In Seminars in Cell & Developmental Biology; Academic Press: Cambridge, MA, USA, 2001; Volume 12, pp. 225–237. [Google Scholar]
  28. Nikaido, H. Multidrug Efflux Pumps of Gram-Negative Bacteria. J. Bacteriol. 1996, 178, 5853–5859. [Google Scholar] [CrossRef] [PubMed]
  29. Purkait, S.; Bhattacharya, A.; Bag, A.; Chattopadhyay, R.R. TLC Bioautography–Guided Isolation of Essential Oil Components of Cinnamon and Clove and Assessment of Their Antimicrobial and Antioxidant Potential in Combination. Environ. Sci. Pollut. Res. 2021, 28, 1131–1140. [Google Scholar] [CrossRef] [PubMed]
  30. El-baky, H.H.A.; Farag, R.S.; Saleh, M.A. Characterization of Antioxidant and Antimicrobial Compounds of Cinnamon and Ginger Essential Oils. Afr. J. Biochem. Res. 2010, 4, 167–174. [Google Scholar]
  31. Ghasemi, G.; Fattahi, M.; Alirezalu, A.; Ghosta, Y. Antioxidant and Antifungal Activities of a New Chemovar of Cumin (Cuminum cyminum L.). Food Sci. Biotechnol. 2019, 28, 669–677. [Google Scholar] [CrossRef] [PubMed]
  32. Saha, S.; Walia, S.; Kundu, A.; Sharma, K.; Singh, J.; Tripathi, B.; Raina, A. Compositional and Functional Difference in Cumin (Cuminum cyminum) Essential Oil Extracted by Hydrodistillation and SCFE. Cogent Food Agric. 2016, 2, 1143166. [Google Scholar] [CrossRef]
  33. ISO 6579-1:2017; Amd 1: 2020—Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. ISO: Geneva, Switzerland, 2017.
  34. Nagshetty, K.; Channappa, S.T.; Gaddad, S.M. Antimicrobial Susceptibility of Salmonella Typhi in India. J. Infect. Dev. Ctries. 2010, 4, 70–73. [Google Scholar] [CrossRef]
  35. Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am. J. Clin. Pathol. 1966, 45, 493. [Google Scholar] [CrossRef] [PubMed]
  36. CLSI CLSI M100-ED29; 2021 Performance Standards for Antimicrobial Susceptibility Testing, 30th Edition. Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2020.
  37. Tambekar, D.H.; Dhanorkar, D.V.; Gulhane, S.R.; Khandelwal, V.K.; Dudhane, M.N. Antibacterial Susceptibility of Some Urinary Tract Pathogens to Commonly Used Antibiotics. Afr. J. Biotechnol. 2006, 5, 1562–1565. [Google Scholar]
  38. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
  39. Durairaj, S.; Srinivasan, S.; Lakshmanaperumalsamy, P. In Vitro Antibacterial Activity and Stability of Garlic Extract at Different PH and Temperature. Electr. J. Biol. 2009, 5, 5–10. [Google Scholar]
  40. Khosravi, A.; Malekan, M.A. Determination of Alcoholic and Aqueous Extract of Lavender Astvkas on Staphylococcus Aureus and Other Gram-Negative Bacteria. The. J. Qazvin Univ. of Med. Sci. 2004, 29, 3–9. [Google Scholar]
  41. Paixão, L.; Rodrigues, L.; Couto, I.; Martins, M.; Fernandes, P.; de Carvalho, C.C.C.R.; Monteiro, G.A.; Sansonetty, F.; Amaral, L.; Viveiros, M. Fluorometric Determination of Ethidium Bromide Efflux Kinetics in Escherichia coli. J. Biol. Eng. 2009, 3, 18. [Google Scholar] [CrossRef]
  42. Heraiz, A.A.; Abdelwahab, M.F.; Saleh, A.M.; Ragab, E.A.; Eldondaity, S.A. Antidiabetic Activity of Ipomoea cairica (L.) Sweet Leaves: In-Vitro and in-Silico Antidiabetic Potential of Isolated Flavonoid Glycosides and Sulphated Flavonoids. Nat. Prod. Res. 2023, 37, 4251–4255. [Google Scholar] [CrossRef]
  43. Saleh, A.M.; Mahdy, H.A.; El-Zahabi, M.A.; Mehany, A.B.M.; Khalifa, M.M.; Eissa, I.H. Design, Synthesis, in Silico Studies, and Biological Evaluation of Novel Pyrimidine-5-Carbonitrile Derivatives as Potential Anti-Proliferative Agents, VEGFR-2 Inhibitors and Apoptotic Inducers. RSC Adv. 2023, 13, 22122–22147. [Google Scholar] [CrossRef]
  44. El Azab, E.F.; Alakilli, S.Y.M.; Saleh, A.M.; Alhassan, H.H.; Alanazi, H.H.; Ghanem, H.B.; Yousif, S.O.; Alrub, H.A.; Anber, N.; Elfaki, E.M.; et al. Actinidia Deliciosa Extract as a Promising Supplemental Agent for Hepatic and Renal Complication-Associated Type 2 Diabetes (In Vivo and In Silico-Based Studies). Int. J. Mol. Sci. 2023, 24, 13759. [Google Scholar] [CrossRef]
  45. Bowers, K.J.; Chow, E.; Xu, H.; Dror, R.O.; Eastwood, M.P.; Gregersen, B.A.; Klepeis, J.L.; Kolossvary, I.; Moraes, M.A.; Sacerdoti, F.D.; et al. Scalable Algorithms for Molecular Dynamics Simulations on Commodity Clusters. In Proceedings of the 2006 ACM/IEEE Conference on Supercomputing, SC’06, Tampa, FL, USA, 11–17 November 2006. [Google Scholar]
  46. Ivanova, L.; Tammiku-Taul, J.; García-Sosa, A.T.; Sidorova, Y.; Saarma, M.; Karelson, M. Molecular Dynamics Simulations of the Interactions between Glial Cell Line-Derived Neurotrophic Factor Family Receptor GFR$α$1 and Small-Molecule Ligands. ACS Omega 2018, 3, 11407–11414. [Google Scholar] [CrossRef]
  47. Case, D.A.; Darden, T.A.; Cheatham, T.E.; Simmerling, C.L.; Wang, J.; Duke, R.E.; Luo, R.; Crowley, M.; Walker, R.C.; Zhang, W.; et al. Amber 10. 2008. Available online: https://infoscience.epfl.ch/server/api/core/bitstreams/c99c47ba-3a78-409b-b4c3-38fc1e989e7c/content (accessed on 26 November 2024).
  48. Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical Analysis of Real-Time PCR Data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [PubMed]
  49. Eaves, D.J.; Ricci, V.; Piddock, L.J. V Expression of AcrB, AcrF, AcrD, MarA, and SoxS in Salmonella enterica Serovar Typhimurium: Role in Multiple Antibiotic Resistance. Antimicrob. Agents Chemother. 2004, 48, 1145–1150. [Google Scholar] [CrossRef] [PubMed]
  50. Blair, J.M.A.; Smith, H.E.; Ricci, V.; Lawler, A.J.; Thompson, L.J.; Piddock, L.J. V Expression of Homologous RND Efflux Pump Genes Is Dependent upon AcrB Expression: Implications for Efflux and Virulence Inhibitor Design. J. Antimicrob. Chemother. 2015, 70, 424–431. [Google Scholar] [CrossRef]
  51. Ferrari, R.G.; Galiana, A.; Cremades, R.; Rodríiguez, J.C.; Magnani, M.; Tognim, M.C.B.; Oliveira, T.C.R.M.; Royo, G. Expression of the MarA, SoxS, AcrB and RamA Genes Related to the AcrAB/TolC Efflux Pump in Salmonella enterica Strains with and without Quinolone Resistance-Determining Regions GyrA Gene Mutations. Braz. J. Infect. Dis. 2013, 17, 125–130. [Google Scholar] [CrossRef]
  52. Baugh, S. The Role of Multidrug Efflux Pumps in Biofilm Formation of Salmonella enterica Serovar Typhimurium. Doctoral Dissertation, University of Birmingham, Birmingham, UK, 2014. [Google Scholar]
  53. Chen, S.; Cui, S.; McDermott, P.F.; Zhao, S.; White, D.G.; Paulsen, I.; Meng, J. Contribution of Target Gene Mutations and Efflux to Decreased Susceptibility of Salmonella enterica Serovar Typhimurium to Fluoroquinolones and Other Antimicrobials. Antimicrob. Agents Chemother. 2007, 51, 535–542. [Google Scholar] [CrossRef]
Figure 1. Histogram comparison of Salmonella spp. prevalence in food products and human sources.
Figure 1. Histogram comparison of Salmonella spp. prevalence in food products and human sources.
Ijms 25 12949 g001
Figure 2. Distribution of Salmonella spp. by serotype between two sources.
Figure 2. Distribution of Salmonella spp. by serotype between two sources.
Ijms 25 12949 g002
Figure 3. Sensitivity of Salmonella spp. to different antibiotics.
Figure 3. Sensitivity of Salmonella spp. to different antibiotics.
Ijms 25 12949 g003
Figure 4. Pearson’s correlation coefficient between inhibition zones (mm) of essential oils against MDR Salmonella.
Figure 4. Pearson’s correlation coefficient between inhibition zones (mm) of essential oils against MDR Salmonella.
Ijms 25 12949 g004
Figure 5. Principal component analysis (PCA) of inhibition zones (mm) of essential oils against MDR Salmonella spp.
Figure 5. Principal component analysis (PCA) of inhibition zones (mm) of essential oils against MDR Salmonella spp.
Ijms 25 12949 g005
Figure 6. (A) 3D figure of the reference ligand (PDB ID: A1AN8) docked inside the target pocket of Salmonella MDR efflux pump acrAB. (B) 3D figure of the tested compounds occupying the same target site of reference compound inside the target pocket of Salmonella MDR efflux pump acrAB.
Figure 6. (A) 3D figure of the reference ligand (PDB ID: A1AN8) docked inside the target pocket of Salmonella MDR efflux pump acrAB. (B) 3D figure of the tested compounds occupying the same target site of reference compound inside the target pocket of Salmonella MDR efflux pump acrAB.
Ijms 25 12949 g006
Figure 7. Three-dimensional figure of Compound 22 against Salmonella Typhi MDR efflux pump AcrAB.
Figure 7. Three-dimensional figure of Compound 22 against Salmonella Typhi MDR efflux pump AcrAB.
Ijms 25 12949 g007
Figure 8. Three-dimensional figure of Compound 24 against Salmonella Typhi MDR efflux pump AcrAB.
Figure 8. Three-dimensional figure of Compound 24 against Salmonella Typhi MDR efflux pump AcrAB.
Ijms 25 12949 g008
Figure 9. Three-dimensional figure of the reference ligand (PDB ID: A1AN8) against Salmonella MDR efflux pump acrAB.
Figure 9. Three-dimensional figure of the reference ligand (PDB ID: A1AN8) against Salmonella MDR efflux pump acrAB.
Ijms 25 12949 g009
Figure 10. Three-dimensional orientation and of Compound 22 against Salmonella efflux pump AcrD target site.
Figure 10. Three-dimensional orientation and of Compound 22 against Salmonella efflux pump AcrD target site.
Ijms 25 12949 g010
Figure 11. Three-dimensional orientation and of Compound 21 against Salmonella efflux pump AcrD target site.
Figure 11. Three-dimensional orientation and of Compound 21 against Salmonella efflux pump AcrD target site.
Ijms 25 12949 g011
Figure 12. Three-dimensional orientation and of Compound 25 against Salmonella efflux pump AcrD target site.
Figure 12. Three-dimensional orientation and of Compound 25 against Salmonella efflux pump AcrD target site.
Ijms 25 12949 g012
Figure 13. (A) 3D figure of Compound 24 against Salmonella MDR efflux pump AcrAB. (B) 3D figure of Compound 25 against Salmonella MDR efflux pump AcrD at 0 ns blue color, 50 ns yellow color, and 100 ns gray color.
Figure 13. (A) 3D figure of Compound 24 against Salmonella MDR efflux pump AcrAB. (B) 3D figure of Compound 25 against Salmonella MDR efflux pump AcrD at 0 ns blue color, 50 ns yellow color, and 100 ns gray color.
Ijms 25 12949 g013
Figure 14. Root mean square deviation (RMSD) and root mean square fluctuation (RMSF) analysis of Compound 24 with AcrAB and Compound 25 with AcrD in Salmonella Typhimurium; (A,B) RMSD and RMSF plots for Compound 24 bound to AcrAB of Salmonella Typhimurium, simulated for 100 ns. (C,D) RMSD and RMSF plots for Compound 25 bound to AcrD of Salmonella Typhimurium, simulated for 100 ns.
Figure 14. Root mean square deviation (RMSD) and root mean square fluctuation (RMSF) analysis of Compound 24 with AcrAB and Compound 25 with AcrD in Salmonella Typhimurium; (A,B) RMSD and RMSF plots for Compound 24 bound to AcrAB of Salmonella Typhimurium, simulated for 100 ns. (C,D) RMSD and RMSF plots for Compound 25 bound to AcrD of Salmonella Typhimurium, simulated for 100 ns.
Ijms 25 12949 g014
Figure 15. Histogram analysis describing the binding interactions of Compounds 24 (A) and 25 (B) with MDR efflux pump AcrAB and AcrD of Salmonella during the simulation time (100 ns).
Figure 15. Histogram analysis describing the binding interactions of Compounds 24 (A) and 25 (B) with MDR efflux pump AcrAB and AcrD of Salmonella during the simulation time (100 ns).
Ijms 25 12949 g015
Figure 16. Heat map describing the total number of interactions within Compounds 24 with MDR efflux pump AcrAB of Salmonella complex during the 100 ns.
Figure 16. Heat map describing the total number of interactions within Compounds 24 with MDR efflux pump AcrAB of Salmonella complex during the 100 ns.
Ijms 25 12949 g016
Figure 17. Heat map describing the total number of interactions within Compounds 25 with MDR efflux pump AcrD of Salmonella complex during the 100 ns.
Figure 17. Heat map describing the total number of interactions within Compounds 25 with MDR efflux pump AcrD of Salmonella complex during the 100 ns.
Ijms 25 12949 g017
Figure 18. MM-GBSA energies for (Compounds 25 with MDR efflux pump AcrD of Salmonella Typhimurium (kcal/mol).
Figure 18. MM-GBSA energies for (Compounds 25 with MDR efflux pump AcrD of Salmonella Typhimurium (kcal/mol).
Ijms 25 12949 g018
Figure 19. MM-GBSA energies for (Compounds 24 with MDR efflux pump AcrAB of Salmonella Typhimurium (kcal/mol).
Figure 19. MM-GBSA energies for (Compounds 24 with MDR efflux pump AcrAB of Salmonella Typhimurium (kcal/mol).
Ijms 25 12949 g019
Figure 20. Total MM-GBSA energies for (Compounds 24 with MDR efflux pump AcrAB and Compounds 25 with MDR efflux pump AcrD of Salmonella Typhimurium (kcal/mol).
Figure 20. Total MM-GBSA energies for (Compounds 24 with MDR efflux pump AcrAB and Compounds 25 with MDR efflux pump AcrD of Salmonella Typhimurium (kcal/mol).
Ijms 25 12949 g020
Figure 21. Modulatory effect of different treatments on efflux pump-related genes (A) acrB, (B) soxS, (C) marA, (D) mdsB, (E) mdtB, (F) acrF, (G) acrD, and (H) robA. Different letters (a,b,c,d) indicate significant changes.
Figure 21. Modulatory effect of different treatments on efflux pump-related genes (A) acrB, (B) soxS, (C) marA, (D) mdsB, (E) mdtB, (F) acrF, (G) acrD, and (H) robA. Different letters (a,b,c,d) indicate significant changes.
Ijms 25 12949 g021aIjms 25 12949 g021b
Table 1. Serotype distribution, antimicrobial susceptibility, and molecular typing of Salmonella isolates.
Table 1. Serotype distribution, antimicrobial susceptibility, and molecular typing of Salmonella isolates.
Isolate No.Bacterial SerotypeSourceNo. of Resistant AntibioticsNo. of Antimicrobial ClassesResistance ProfileMAR IndexGenotypic Characteristic of Efflux
1S. MontevideoStool22AX, CAZ0.18acrD, robA
2S. MontevideoBlood43AX, A/S, GEN, CAZ0.36acrB, mdtB, acrF, acrD, robA
3S. TyphimuriumBlood43AX, A/S, GEN, CAZ0.36acrB, mdtB, acrF, acrD, robA
4S. TyphimuriumStool22AX, CAZ0.18soxS, robA
5S. TyphimuriumBlood54AX, C, A/S, GEN, CAZ0.45acrB, mdtB, acrF, acrD, robA, soxS, marA, mdsB
6S. AnatumStool54AX, A/S, GEN, OF, CAZ0.45acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
7S. AnatumStool54AX, C, A/S, GEN, CAZ0.45acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
8S. AnatumStool54AX, C, A/S, GEN, CAZ0.45acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
9S. AnatumBlood33A/S, GEN, CAZ0.27acrF, acrD, robA
10S. TyphimuriumStool33A/S, GEN, CAZ0.27marA, mdsB, robA
11S. MontevideoStool44C, A/S, GEN, CAZ0.36robA, acrB, mdtB, acrF, acrD
12S. TyphimuriumStool33A/S, GEN, CAZ0.27mdtB, mdsB, robA
13S. EnteritidisMinced meat22AX, CAZ0.18Undetermined
14S. TyphimuriumSausage43AX, A/S, GEN, CAZ0.36robA, acrB, mdtB, acrF, acrD
15S. EnteritidisLuncheon43AX, A/S, GEN, CAZ0.36acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
16S. TyphimuriumLuncheon11CAZ0.09Undetermined
17S. EnteritidisKofta65AX, C, A/S, GEN, CAZ, AK0.55acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
18S. TyphimuriumKofta64AX, A/S, GEN, CAZ, AK, OF0.55acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
19S. TyphimuriumMinced meat65C, A/S, GEN, CAZ, AK, LE0.55acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
20S. TyphimuriumSausage64AX, C, A/S, GEN, CAZ, AK0.55acrB, mdtB, acrF, acrD, soxS, marA, robA
21S. EnteritidisMinced meat43A/S, GEN, CAZ, AK0.36robA, AcrB, mdtB, acrF, acrD
22S. EnteritidisMinced meat33A/S, GEN, CAZ0.27acrD, soxS, robA
23S. TyphimuriumMinced meat44C, A/S, GEN, CAZ0.36acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
24S. VirchowMinced meat33A/S, GEN, CAZ0.27acrD, soxS, robA
25S. VirchowMinced meat85C, CIP, A/S, GEN, AK, LE, OF, CAZ0.73acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
26S. TyphimuriumMinced meat54C, CIP, AK, LE, CAZ0.45acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
27S. VirchowMinced meat74CIP, A/S, GEN, AK, LE, OF, CAZ0.64acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
28S. TyphimuriumMinced meat65AX, C, A/S, GEN, OF, CAZ0.55acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
29S. TyphimuriumMinced meat65AX, C, A/S, GEN, LE, CAZ0.55acrB, mdtB, acrF, acrD, soxS, marA, mdsB, robA
Table 2. Varimax rotated PCA of essential oil antibacterial activity against MDR Salmonella.
Table 2. Varimax rotated PCA of essential oil antibacterial activity against MDR Salmonella.
Essential OilsPC1PC2PC3PC4
Sage oil0.434−0.2820.7490.281
Nigella oil−0.3750.6290.454−0.210
Ginger oil−0.5920.5620.1570.068
Cumin oil−0.787−0.3840.220−0.279
Cinnamon oil−0.742−0.458−0.031−0.277
Sesame oil0.5130.472−0.069−0.477
Thyme oil−0.6310.304−0.1960.541
Eigenvalue2.5101.4650.8850.803
Proportion of variance35.85%20.93%12.64%11.47%
Cumulative proportion of variance35.85%56.78%69.42%80.89%
Bold loadings are statistically significant.
Table 3. Molecular docking analysis of the tested compounds binding to the Salmonella Typhimurium MDR efflux pump AcrAB.
Table 3. Molecular docking analysis of the tested compounds binding to the Salmonella Typhimurium MDR efflux pump AcrAB.
Tested CompoundsRMSD Value (Å)Docking (Affinity) Score
(kcal/mol)
Compound 121.42−6.90
Compound 211.08−6.69
Compound 221.15−6.73
Compound 230.87−6.60
Compound 240.95−6.98
Compound 311.27−6.56
Compound 371.51−5.87
Reference (A1AN8)0.89−6.88
Table 4. Molecular docking analysis of the tested compounds binding to the Salmonella Typhimurium MDR efflux pump AcrD.
Table 4. Molecular docking analysis of the tested compounds binding to the Salmonella Typhimurium MDR efflux pump AcrD.
Tested CompoundsRMFSD Value (Å)Docking (Affinity) Score
(kcal/mol)
Compound 41.48−5.56
Compound 120.86−5.36
Compound 130.95−6.23
Compound 160.81−5.61
Compound 181.04−7.29
Compound 210.93−6.21
Compound 221.33−5.41
Compound 231.35−5.23
Compound 241.21−6.27
Compound 251.36−7.64
Compound 291.73−5.87
Table 5. The utilized primers, their sequences, and annealing of target genes for Syper green RT-PCR.
Table 5. The utilized primers, their sequences, and annealing of target genes for Syper green RT-PCR.
GenesPrimers (5′-3′)Annealing (T °C)Reference
16S rRNAF: CCTCAGCACATTGACGTTAC
R: CCTCAGCACATTGACGTTAC
60[49]
acrBF: GACGTCCTATTTTCG
R: CGAAGACGCCTCTGT
55[49]
acrDF: CTGCGCTGGATTCTGATT
R: ATAATGGCGAACGAGGAG
55[49]
acrFF: TCGTGTTGCTAGGCACTT
R: GGATCTGCGACATGGATT
55[49]
mdtBF: TATCGGCTATCGCTTCCT
R: TAGAGCGTAACAACCTGAAT
55[50]
mdsBF: CGATATGTTGATGGTGGTT
R: GATGGCGAAGTTAGACAG
55[50]
marAF: GACCCGGACGTTCAAAAACTAT55[51]
R: TCGCCATGCATATTGGTGAT
soxSF: CGGAATACACGCGAGAAGGT55[51]
R: GAGCGCCCGATTTTTGATATC
robAF: CGTTTCGATTCGCAGCAAAC
R: GAACTGAACGCGCATCTGAT
60This study
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

El-Demerdash, A.S.; Kamel, S.A.; Elariny, E.Y.T.; Henidi, H.; Mahran, Y.; Alahdal, H.; Saleh, A.M.; Ibrahim, R.A. Natural Inhibitors of Salmonella MDR Efflux Pumps AcrAB and AcrD: An Integrated In Silico, Molecular, and In Vitro Investigation. Int. J. Mol. Sci. 2024, 25, 12949. https://doi.org/10.3390/ijms252312949

AMA Style

El-Demerdash AS, Kamel SA, Elariny EYT, Henidi H, Mahran Y, Alahdal H, Saleh AM, Ibrahim RA. Natural Inhibitors of Salmonella MDR Efflux Pumps AcrAB and AcrD: An Integrated In Silico, Molecular, and In Vitro Investigation. International Journal of Molecular Sciences. 2024; 25(23):12949. https://doi.org/10.3390/ijms252312949

Chicago/Turabian Style

El-Demerdash, Azza S., Shimaa A. Kamel, Eman Y. T. Elariny, Hanan Henidi, Yasmin Mahran, Hadil Alahdal, Abdulrahman M. Saleh, and Rehab A. Ibrahim. 2024. "Natural Inhibitors of Salmonella MDR Efflux Pumps AcrAB and AcrD: An Integrated In Silico, Molecular, and In Vitro Investigation" International Journal of Molecular Sciences 25, no. 23: 12949. https://doi.org/10.3390/ijms252312949

APA Style

El-Demerdash, A. S., Kamel, S. A., Elariny, E. Y. T., Henidi, H., Mahran, Y., Alahdal, H., Saleh, A. M., & Ibrahim, R. A. (2024). Natural Inhibitors of Salmonella MDR Efflux Pumps AcrAB and AcrD: An Integrated In Silico, Molecular, and In Vitro Investigation. International Journal of Molecular Sciences, 25(23), 12949. https://doi.org/10.3390/ijms252312949

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop