Identification of Functional Variants Between Tong Sheep and Hu Sheep by Whole-Genome Sequencing Pools of Individuals
Abstract
1. Introduction
2. Results
2.1. Whole-Genome Re-Sequencing Data
2.2. Variant Annotation
2.3. Enrichment and Functional Regions Evaluation

| Chromosome | Location and Variants Number | Gene Name |
|---|---|---|
| 10 | 70~71 Mb (N = 1549) | LOC101106534; LOC101106781 |
| 10 | 71~72 Mb (N = 1662) | LOC101109370; |
| 20 | 25~26 Mb (N = 1517) | GCM1; FBXO9; CILK1; LOC101107232; LOC101108696; ELOVL5; DQA; LOC101110277; LOC101110006; BTNL2; LOC101109747 |
| 22 | 1~2 Mb (N = 1730) | NA |
| 25 | 6~7 Mb (N = 1504) | KCNK1; MAP3K21; PCNX2 |
| X | 6~7 Mb (N = 2038) | GPR143; TBL1X |

2.4. miRNA and Target Genes Enrichment
2.5. Visualization of Secondary Structure and Expression Verification
3. Discussion
4. Materials and Methods
4.1. Ethics Approval
4.2. Samples Collection
4.3. Genomic DNA Library Construction and Genome Resequencing
4.4. Quality Control, Variants Annotation, and Functional Enrichment
4.5. Prediction of miRNA Target Genes and Enrichment Analysis
4.6. Visualization of Secondary Structure of miRNA and Target Genes
4.7. Transfection of miRNA Mimics
4.8. Primers Design and Real-Time Quantitative PCR (qPCR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviation
| Item | Definition |
| MAS | Molecular-assisted selection |
| GWAS | Genome-wide association study |
| T | Tong sheep |
| H | Hu sheep |
| ELOVL5 | ELOVL fatty acid elongase 5 |
| N | Number |
| chr | Chromosome |
| GO | Gene Ontology |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| WT | Wild type |
| MT | Mutation type |
| UTR | Untranslated regions |
| BP | Biological process |
| MF | Molecular function |
| CC | Cellular component |
References
- Ciani, E.; Mastrangelo, S.; Da Silva, A.; Marroni, F.; Ferenčaković, M.; Ajmone-Marsan, P.; Baird, H.; Barbato, M.; Colli, L.; Delvento, C.; et al. On the Origin of European Sheep as Revealed by the Diversity of the Balkan Breeds and by Optimizing Population-Genetic Analysis Tools. Genet. Sel. Evol. 2020, 52, 25. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Song, X.; Shan, H.; Jiang, J.; Xiong, P.; Wu, J.; Shi, F.; Jiang, Y. Genome-Wide Association Study of Body Weights in Hu Sheep and Population Verification of Related Single-Nucleotide Polymorphisms. Front. Genet. 2020, 11, 588. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Li, F.; Wang, F.; Zhang, G.; Pang, J.; Ren, C.; Zhang, T.; Yang, H.; Wang, Z.; Zhang, Y. Genome-Wide Differential Expression Profiling of Mrnas and Lncrnas Associated with Prolificacy in Hu Sheep. Biosci. Rep. 2018, 38, BSR20171350. [Google Scholar] [CrossRef] [PubMed]
- Van Tassell, C.P.; Smith, T.P.; Matukumalli, L.K.; Taylor, J.F.; Schnabel, R.D.; Lawley, C.T.; Haudenschild, C.D.; Moore, S.S.; Warren, W.C.; Sonstegard, T.S. Snp Discovery and Allele Frequency Estimation by Deep Sequencing of Reduced Representation Libraries. Nat. Methods 2008, 5, 247–252. [Google Scholar] [CrossRef] [PubMed]
- Kofler, R.; Orozco-terWengel, P.; De Maio, N.; Pandey, R.V.; Nolte, V.; Futschik, A.; Kosiol, C.; Schlötterer, C. Popoolation: A Toolbox for Population Genetic Analysis of Next Generation Sequencing Data from Pooled Individuals. PLoS ONE 2011, 6, e15925. [Google Scholar] [CrossRef]
- Schlötterer, C.; Tobler, R.; Kofler, R.; Nolte, V. Sequencing Pools of Individuals—Mining Genome-Wide Polymorphism Data without Big Funding. Nat. Rev. Genet. 2014, 15, 749–763. [Google Scholar] [CrossRef]
- Gunawan, A.; Jakaria; Listyarini, K.; Furqon, A.; Sumantri, C.; Akter, S.H.; Uddin, M.J. Transcriptome Signature of Liver Tissue with Divergent Mutton Odour and Flavour Using Rna Deep Sequencing. Gene 2018, 676, 86–94. [Google Scholar] [CrossRef]
- Sweet-Jones, J.; Yurchenko, A.A.; Igoshin, A.V.; Yudin, N.S.; Swain, M.T.; Larkin, D.M. Resequencing and Signatures of Selection Scan in Two Siberian Native Sheep Breeds Point to Candidate Genetic Variants for Adaptation and Economically Important Traits. Anim. Genet. 2021, 52, 126–131. [Google Scholar] [CrossRef]
- Li, J.; Shen, C.; Zhang, K.; Niu, Z.; Liu, Z.; Zhang, S.; Wang, Y.; Lan, X. Polymorphic Variants of Bovine Adcy5 Gene Identified in Gwas Analysis Were Significantly Associated with Ovarian Morphological Related Traits. Gene 2021, 766, 145158. [Google Scholar] [CrossRef]
- Zhu, S.; Guo, T.; Zhao, H.; Qiao, G.; Han, M.; Liu, J.; Yuan, C.; Wang, T.; Li, F.; Yue, Y.; et al. Genome-Wide Association Study Using Individual Single-Nucleotide Polymorphisms and Haplotypes for Erythrocyte Traits in Alpine Merino Sheep. Front. Genet. 2020, 11, 848. [Google Scholar] [CrossRef]
- Pasandideh, M.; Gholizadeh, M.; Rahimi-Mianji, G. A Genome-Wide Association Study Revealed Five Snps Affecting 8-Month Weight in Sheep. Anim. Genet. 2020, 51, 973–976. [Google Scholar] [CrossRef] [PubMed]
- Dolebo, A.T.; Khayatzadeh, N.; Melesse, A.; Wragg, D.; Rekik, M.; Haile, A.; Rischkowsky, B.; Rothschild, M.F.; Mwacharo, J.M. Genome-Wide Scans Identify Known and Novel Regions Associated with Prolificacy and Reproduction Traits in a Sub-Saharan African Indigenous Sheep (Ovis aries). Mamm. Genome 2019, 30, 339–352. [Google Scholar] [CrossRef] [PubMed]
- Chen, P.; Zhao, H.; Wu, M.; He, S.; Yuan, T.; Yi, X.; Liu, S.; Pan, Y.; Li, Q.; Wang, S.; et al. A Novel 17 Bp Indel Polymorphism within the Ppargc1a Gene Is Significantly Associated with Growth Traits in Sheep. Anim. Biotechnol. 2022, 33, 312–320. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; He, S.; Zhu, Y.; Cao, X.; Luo, R.; Cai, Y.; Xu, H.; Sun, X. A Novel 29 Bp Insertion/Deletion (Indel) Variant of the Lhx3 Gene and Its Influence on Growth Traits in Four Sheep Breeds of Various Fecundity. Arch. Anim. Breed. 2017, 60, 79–85. [Google Scholar] [CrossRef][Green Version]
- Bakhtiarizadeh, M.R.; Alamouti, A.A. Rna-Seq Based Genetic Variant Discovery Provides New Insights into Controlling Fat Deposition in the Tail of Sheep. Sci. Rep. 2020, 10, 13525. [Google Scholar] [CrossRef]
- Hao, Z.Y.; Wang, J.Q.; Luo, Y.L.; Liu, X.; Li, S.B.; Zhao, M.L.; Jin, X.Y.; Shen, J.Y.; Ke, N.; Song, Y.Z.; et al. Deep Small Rna-Seq Reveals Micrornas Expression Profiles in Lactating Mammary Gland of 2 Sheep Breeds with Different Milk Performance. Domest. Anim. Endocrinol. 2021, 74, 106561. [Google Scholar] [CrossRef]
- Farhadian, M.; Rafat, S.A.; Panahi, B.; Ebrahimie, E. Transcriptome Signature of Two Lactation Stages in Ghezel Sheep Identifies Using Rna-Sequencing. Anim. Biotechnol. 2022, 33, 223–233. [Google Scholar] [CrossRef]
- Li, Z.; Rana, T.M. Molecular Mechanisms of Rna-Triggered Gene Silencing Machineries. Acc. Chem. Res. 2012, 45, 1122–1131. [Google Scholar] [CrossRef]
- Jones, J.G. Hepatic Glucose and Lipid Metabolism. Diabetologia 2016, 59, 1098–1103. [Google Scholar] [CrossRef]
- Schneeberger, K. Using Next-Generation Sequencing to Isolate Mutant Genes from Forward Genetic Screens. Nat. Rev. Genet. 2014, 15, 662–676. [Google Scholar] [CrossRef]
- Kover, P.X.; Valdar, W.; Trakalo, J.; Scarcelli, N.; Ehrenreich, I.M.; Purugganan, M.D.; Durrant, C.; Mott, R. A Multiparent Advanced Generation Inter-Cross to Fine-Map Quantitative Traits in Arabidopsis Thaliana. PLoS Genet. 2009, 5, e1000551. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Jiang, P.; Yu, H.; Yang, Y.; Xia, L.; Yang, R.; Fang, X.; Zhao, Z. Mir-21-3p Targets Elovl5 and Regulates Triglyceride Production in Mammary Epithelial Cells of Cow. DNA Cell Biol. 2019, 38, 352–357. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. Micrornas: Target Recognition and Regulatory Functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [PubMed]
- An, X.; Song, Y.; Bu, S.; Ma, H.; Gao, K.; Hou, J.; Wang, S.; Lei, Z.; Cao, B. Association of Polymorphisms at the Microrna Binding Site of the Caprine Kitlg 3’-Utr with Litter Size. Sci. Rep. 2016, 6, 25691. [Google Scholar] [CrossRef]
- An, X.P.; Hou, J.X.; Li, G.; Song, Y.X.; Wang, J.G.; Chen, Q.J.; Cui, Y.H.; Wang, Y.F.; Cao, B.Y. Polymorphism Identification in the Goat Kitlg Gene and Association Analysis with Litter Size. Anim. Genet. 2012, 43, 104–107. [Google Scholar] [CrossRef]
- Sarybayev, Y.; Ussenbekov, Y.; Turebekov, O.; Turumbetov, B.; Tutkyshbay, I. Genotyping of Cows by Lhcgr, Fshr Loci, and Determination of the Level of Ovulation Depending on the Expression of the Studied Genes. Open Vet. J. 2023, 13, 352–357. [Google Scholar] [CrossRef]
- Niringiyumukiza, J.D.; Cai, H.; Xiang, W. Prostaglandin E2 Involvement in Mammalian Female Fertility: Ovulation, Fertilization, Embryo Development and Early Implantation. Reprod. Biol. Endocrinol. 2018, 16, 43. [Google Scholar] [CrossRef]
- Ferlin, A.; Pengo, M.; Pizzol, D.; Carraro, U.; Frigo, A.C.; Foresta, C. Variants in Kitlg Predispose to Testicular Germ Cell Cancer Independently from Spermatogenic Function. Endocr. Relat. Cancer 2012, 19, 101–108. [Google Scholar] [CrossRef]
- An, X.P.; Hou, J.X.; Gao, T.Y.; Lei, Y.N.; Song, Y.X.; Wang, J.G.; Cao, B.Y. Association Analysis between Variants in Kitlg Gene and Litter Size in Goats. Gene 2015, 558, 126–130. [Google Scholar] [CrossRef]
- Wu, M.; Zhao, H.; Tang, X.; Li, Q.; Yi, X.; Liu, S.; Sun, X. Novel Indels of Ghr, Ghrh, Ghrhr and Their Association with Growth Traits in Seven Chinese Sheep Breeds. Animals 2020, 10, 1883. [Google Scholar] [CrossRef]
- Fracassetti, M.; Griffin, P.C.; Willi, Y. Validation of Pooled Whole-Genome Re-Sequencing in Arabidopsis Lyrata. PLoS ONE 2015, 10, e0140462. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and Accurate Long-Read Alignment with Burrows-Wheeler Transform. Bioinformatics 2010, 26, 589–595. [Google Scholar] [CrossRef] [PubMed]
- Li, H. A Statistical Framework for Snp Calling, Mutation Discovery, Association Mapping and Population Genetical Parameter Estimation from Sequencing Data. Bioinformatics 2011, 27, 2987–2993. [Google Scholar] [CrossRef] [PubMed]
- Abyzov, A.; Urban, A.E.; Snyder, M.; Gerstein, M. Cnvnator: An Approach to Discover, Genotype, and Characterize Typical and Atypical Cnvs from Family and Population Genome Sequencing. Genome Res. 2011, 21, 974–984. [Google Scholar] [CrossRef]
- Rausch, T.; Zichner, T.; Schlattl, A.; Stütz, A.M.; Benes, V.; Korbel, J.O. Delly: Structural Variant Discovery by Integrated Paired-End and Split-Read Analysis. Bioinformatics 2012, 28, i333–i339. [Google Scholar] [CrossRef]





| Sample Name | Tong Sheep | Hu Sheep |
|---|---|---|
| Total reads | 745,878,106 | 739,382,182 |
| Reads filter (%) | 94.66 | 94.52 |
| GC (%) | 44.04 | 43.82 |
| Mapped | 697,320,958 | 702,453,283 |
| Mapped rate (%) | 99.60 | 99.60 |
| Unique mapped | 620,684,511 | 627,947,209 |
| Unique mapped rate (%) | 88.70 | 89.10 |
| Q20 (%) | 97.09 | 97.04 |
| Q30 (%) | 92.63 | 92.51 |
| Raw yield | 130.47 G | 111.88 G |
| Clean yield | 126.87 G | 108.76 G |
| Sequencing depth | 47.14× | 40.42× |
| Consequences | Tong Sheep (N) | Hu Sheep (N) |
|---|---|---|
| Splice acceptor variant | 16 | 19 |
| Splice donor variant | 15 | 16 |
| Stop gained | 47 | 70 |
| Frameshift variant | 3 | 4 |
| Start lost | 7 | 10 |
| Inframe insertion | 8 | 4 |
| Inframe deletion | 1 | 1 |
| Missense variant | 5185 | 7347 |
| Splice region variant | 1011 | 1414 |
| Stop retained variant | 2 | 3 |
| Synonymous variant | 13,804 | 21,540 |
| Coding sequence variant | 5 | 5 |
| Mature miRNA variant | 5 | 3 |
| 5 prime UTR variant | 327 | 391 |
| 3 prime UTR variant | 1512 | 1776 |
| Non-coding transcript exon variant | 808 | 953 |
| Intron variant | 200,429 | 244,295 |
| Non-coding transcript variant | 12,601 | 14,798 |
| Upstream gene variant | 23,849 | 28,537 |
| Downstream gene variant | 21,793 | 25,362 |
| Intergenic variant | 441,521 | 548,152 |
| Primers Name | Sequence |
|---|---|
| miR-487-5p-W | GCTTGTGTCGTCCCTATCGGTG |
| Universal PCR Primer R | |
| miR-487-5p-M | F: GGAGGTCTGTGCTGTGAATGG |
| Universal PCR Primer R | |
| U6 | F: GACCGCGCGTGTCCAGCTTA |
| R: CACGAATTTGCGTGTCATCCTTGC | |
| KITLG | F: ATGACCTTGTGGAGTGCATGGAAG |
| R: GGAGTAAACTGCCTGGGTTCTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, X.; Wang, S.; Yi, X.; Li, Q.; Sun, X. Identification of Functional Variants Between Tong Sheep and Hu Sheep by Whole-Genome Sequencing Pools of Individuals. Int. J. Mol. Sci. 2024, 25, 12919. https://doi.org/10.3390/ijms252312919
Tang X, Wang S, Yi X, Li Q, Sun X. Identification of Functional Variants Between Tong Sheep and Hu Sheep by Whole-Genome Sequencing Pools of Individuals. International Journal of Molecular Sciences. 2024; 25(23):12919. https://doi.org/10.3390/ijms252312919
Chicago/Turabian StyleTang, Xiaoqin, Shuhui Wang, Xiaohua Yi, Qi Li, and Xiuzhu Sun. 2024. "Identification of Functional Variants Between Tong Sheep and Hu Sheep by Whole-Genome Sequencing Pools of Individuals" International Journal of Molecular Sciences 25, no. 23: 12919. https://doi.org/10.3390/ijms252312919
APA StyleTang, X., Wang, S., Yi, X., Li, Q., & Sun, X. (2024). Identification of Functional Variants Between Tong Sheep and Hu Sheep by Whole-Genome Sequencing Pools of Individuals. International Journal of Molecular Sciences, 25(23), 12919. https://doi.org/10.3390/ijms252312919

