Enhancing β-Galactosidase Performance for Galactooligosaccharides Preparation via Strategic Glucose Re-Tunneling
Abstract
1. Introduction
2. Results
2.1. Characterization of Putative Glucose Pockets and Channels in β-Galactosidase BglD
2.2. In Silico Analysis of Potential Sites for Redirecting Glucose Transport
2.3. Enhanced Specific Activity and Catalytic Efficiency of BglD via Re-Engineered Glucose Translocation
2.4. Enhanced Efficacy and Quality in GOS Synthesis via Re-Engineered Glucose Relocation Mutants
2.5. Elucidation of Enhanced Catalytic Activity Through Structural Analysis
3. Discussion
4. Materials and Methods
4.1. Strains, Plasmids, and Primers
4.2. Prediction and Structural Analysis of β-Galactosidase Mutation
4.3. Site-Directed Mutagenesis of BglD
4.4. Expression and Purification of Mutants
4.5. Enzyme Activity Assay and Kinetic Parameters
4.6. Production of GOS from Lactose
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ghosh, S.; Somasundar, A.; Sen, A. Enzymes as active matter. Annu. Rev. Condens. Matter Phys. 2021, 12, 177–200. [Google Scholar] [CrossRef]
- Shoda, S.; Uyama, H.; Kadokawa, J.; Kimura, S.; Kobayashi, S. Enzymes as green catalysts for precision macromolecular synthesis. Chem. Rev. 2016, 116, 2307–2413. [Google Scholar] [CrossRef] [PubMed]
- Ismail, A.R.; Kashtoh, H.; Baek, K.H. Temperature-resistant and solvent-tolerant lipases as industrial biocatalysts: Biotechnological approaches and applications. Int. J. Biol. Macromol. 2021, 30, 127–142. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.M.; Han, S.S.; Kim, H.S. Industrial applications of enzyme biocatalysis: Current status and future aspects. Biotechnol. Adv. 2015, 33, 1443–1454. [Google Scholar] [CrossRef] [PubMed]
- Fasim, A.; More, V.S.; More, S.S. Large-scale production of enzymes for biotechnology uses. Curr. Opin. Biotechnol. 2021, 69, 68–76. [Google Scholar] [CrossRef]
- Chen, K.; Arnold, F.H. Engineering new catalytic activities in enzymes. Nat. Catal. 2020, 3, 203–213. [Google Scholar] [CrossRef]
- Goldsmith, M.; Tawfik, D.S. Enzyme engineering: Reaching the maximal catalytic efficiency peak. Curr. Opin. Struct. Biol. 2017, 47, 140–150. [Google Scholar] [CrossRef]
- Cai, X.; Shen, J.; Qiang, Y.; Hua, J.; Ma, Z.; Liu, Z.; Zheng, Y. Efficient activity enhancement of a lipase from Sporisorium reilianum for the synthesis of a moxifloxacin chiral intermediate via rational design. Engineering 2022, 19, 207–216. [Google Scholar] [CrossRef]
- Miao, M.; Li, S.; Yang, S.; Yan, Q.; Xiang, Z.; Jiang, Z. Engineering the β-galactosidase from Aspergillus oryzae for making lactose-free and no-sugar-added yogurt. J. Dairy Sci. 2024, 107, 6602–6613. [Google Scholar] [CrossRef]
- Albuquerque, T.L.; Sousa, M.; Silva, N.C.G.E.; Neto, C.A.C.G.; Gonçalves, L.R.B.; Fernandez-Lafuente, R.; Rocha, M.V.P. β-Galactosidase from Kluyveromyces lactis: Characterization, production, immobilization and applications—A review. Int. J. Biol. Macromol. 2021, 30, 881–898. [Google Scholar] [CrossRef]
- Lu, L.; Guo, L.; Wang, K.; Liu, Y.; Xiao, M. β-Galactosidases: A great tool for synthesizing galactose-containing carbohydrates. Biotechnol. Adv. 2020, 39, 107465. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Imanaka, H.; Imamura, K.; Minoda, M.; Katase, T.; Hoshi, Y.; Yamaguchi, S.; Nakanishi, K. Cloning and expression of a β-galactosidase gene of Bacillus circulans. Biosci. Biotechnol. Biochem. 2011, 75, 1194–1197. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Wang, H.; Chen, Y.; Pei, X.; Sun, W.; Liu, L.; Wang, F.; Yaqoob, M.U.; Tao, W.; Xiao, Z.; et al. Optimization and comparison of the production of galactooligosaccharides using free or immobilized Aspergillus oryzae β-galactosidase, followed by purification using silica gel. Food Chem. 2021, 362, 130195. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.Y.; Hong, H.; Seo, H.; Pan, J.G.; Kim, E.J.; Maeng, P.J.; Yang, T.H.; Kim, K.J. High galacto-oligosaccharide production and a structural model for transgalactosylation of β-galactosidase II from Bacillus circulans. J. Agric. Food Chem. 2020, 68, 13806–13814. [Google Scholar] [CrossRef] [PubMed]
- Qin, Z.; Li, S.; Huang, X.; Kong, W.; Yang, X.; Zhang, S.; Cao, L.; Liu, Y. Improving galactooligosaccharide synthesis efficiency of β-galactosidase Bgal1-3 by reshaping the active site with an intelligent hydrophobic amino acid scanning. J. Agric. Food Chem. 2019, 67, 11158–11166. [Google Scholar] [CrossRef]
- Zhao, J.; Niu, D.; Mchunu, N.P.; Tian, K.; Miao, J.; Wang, Z. Establishment and preliminary application of a rapid screening method for lactase with high galactosyl activity. Food Ferment. Ind. 2020, 46, 17–20. [Google Scholar] [CrossRef]
- Kingsley, L.J.; Lill, M.A. Substrate tunnels in enzymes: Structure-function relationships and computational methodology. Proteins 2015, 83, 599–611. [Google Scholar] [CrossRef]
- Kokkonen, P.; Bednar, D.; Pinto, G.; Prokop, Z.; Damborsky, J. Engineering enzyme access tunnels. Biotechnol. Adv. 2019, 37, 107386–107398. [Google Scholar] [CrossRef]
- Kim, S.M.; Kang, S.H.; Jeon, B.W.; Kim, Y.H. Tunnel engineering of gas-converting enzymes for inhibitor retardation and substrate acceleration. Bioresour. Technol. 2024, 394, 130248. [Google Scholar] [CrossRef]
- Lu, Z.; Li, X.; Zhang, R.; Yi, L.; Ma, Y.; Zhang, G. Tunnel engineering to accelerate product release for better biomass-degrading abilities in lignocellulolytic enzymes. Biotechnol. Biofuels 2019, 12, 275–283. [Google Scholar] [CrossRef]
- Li, L.; Ding, L.; Shao, Y.; Sun, S.; Wang, M.; Xiang, J.; Zhou, J.; Wu, G.; Song, Z.; Xin, Z. Enhancing the hydrolysis and acyl transfer activity of carboxylesterase DLFae4 by a combinational mutagenesis and in-silico method. Foods 2023, 12, 1169. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Guan, W.; Li, X.; Gao, K.; Xu, X.; Liu, B.; Zhang, W.; Zhang, Y. β-Galactosidase GALA from Bacillus circulans with high transgalactosylation. Bioengineered 2021, 12, 8908–8919. [Google Scholar] [CrossRef] [PubMed]
- Biedermannová, L.; Prokop, Z.; Gora, A.; Chovancová, E.; Kovács, M.; Damborsky, J.; Wade, R.C. A single mutation in a tunnel to the active site changes the mechanism and kinetics of product release in haloalkane dehalogenase LinB. J. Biol. Chem. 2021, 287, 29062–29074. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.; Cheng, Z.; Han, L.; Guo, J.; Peplowski, L.; Zhou, Z. Structure-oriented engineering of nitrile hydratase: Reshaping of substrate access tunnel and binding pocket for efficient synthesis of cinnamamide. Int. J. Biol. Macromol. 2024, 254, 127800–127807. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.J.T.; Müller, R.; Toscano, M.D.; Kast, P.; Hellinga, H.W.; Hilvert, D.; Houk, K.N. Structural reorganization and preorganization in enzyme active sites: Comparisons of experimental and theoretically ideal active site geometries in the multistep serine esterase reaction cycle. J. Am. Chem. Soc. 2008, 130, 15361–15373. [Google Scholar] [CrossRef]
- Kong, X.D.; Yuan, S.; Li, L.; Chen, S.; Xu, J.H.; Zhou, J. Engineering of an epoxide hydrolase for efficient bioresolution of bulky pharmaco substrates. Proc. Natl. Acad. Sci. USA 2014, 111, 15717–15722. [Google Scholar] [CrossRef]
- Hager, M.; Pöhler, M.T.; Reinhardt, F.; Wellner, K.; Hübner, J.; Betat, H.; Prohaska, S.; Mörl, M. Substrate affinity versus catalytic efficiency: Ancestral sequence reconstruction of tRNA nucleotidyltransferases solves an enzyme puzzle. Mol. Biol. Evol. 2022, 39, msac250. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, F.; Jiang, L.; Perry, J.J.P.; Zhao, Z.; Liao, J. Product inhibition kinetics determinations-substrate interaction affinity and enzymatic kinetics using one quantitative FRET assay. Int. J. Biol. Macromol. 2021, 193, 1481–1487. [Google Scholar] [CrossRef]
- Kokkonen, P.; Beier, A.; Mazurenko, S.; Damborsky, J.; Bednar, D.; Prokop, Z. Substrate inhibition by the blockage of product release and its control by tunnel engineering. RSC Chem. Biol. 2021, 2, 645–655. [Google Scholar] [CrossRef]
- Xu, J.; Tang, X.; Zhu, Y.; Yu, Z.; Su, K.; Zhang, Y.; Dong, Y.; Zhu, W.; Zhang, C.; Wu, R.; et al. Structural studies reveal flexible roof of active site responsible for ω-transaminase CrmG overcoming by-product inhibition. Commun. Biol. 2020, 3, 455–466. [Google Scholar] [CrossRef]
- Ortmayer, M.; Fisher, K.; Basran, J.; Wolde-Michael, E.M.; Heyes, D.J.; Levy, C.; Lovelock, S.L.; Anderson, J.L.R.; Raven, E.L.; Hay, S.; et al. Rewiring the “push-pull” catalytic machinery of a heme enzyme using an expanded genetic code. ACS Catal. 2020, 10, 2735–2746. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S.S.; Peria, W.J.; Yu, R.C.; Colman-Lerner, A.; Brent, R. Push-pull and feedback mechanisms can align signaling system outputs with inputs. Cell Syst. 2016, 3, 444–455. [Google Scholar] [CrossRef]
- Hossack, E.J.; Hardy, F.J.; Green, A.P. Building enzymes through design and evolution. ACS Catal. 2023, 13, 12436–12444. [Google Scholar] [CrossRef]
- Buller, R.; Lutz, S.; Kazlauskas, R.J.; Snajdrova, R.; Moore, J.C.; Bornscheuer, U.T. From nature to industry: Harnessing enzymes for biocatalysis. Science 2023, 382, eadh8615. [Google Scholar] [CrossRef] [PubMed]
- Tian, K.; Zhao, J.; Niu, D.; Mchunu, N.P.; Wang, C.; Wang, Z. Molecular cloning and biochemical characterization of lactase with high transgalactosylation activity. Food Ferment. Ind. 2020, 46, 8–13. [Google Scholar] [CrossRef]
- Niu, D.; Wang, Z.X. Development of a pair of bifunctional expression vectors for Escherichia coli and Bacillus licheniformis. J. Ind. Microbiol. Biotechnol. 2007, 34, 357–362. [Google Scholar] [CrossRef]
- Niu, D.; Zuo, Z.; Shi, G.Y.; Wang, Z.X. High yield recombinant thermostable α-amylase production using an improved Bacillus licheniformis system. Microb. Cell Fact. 2009, 8, 58–64. [Google Scholar] [CrossRef]
- Kiefer, F.; Arnold, K.; Künzli, M.; Bordoli, L.; Schwede, T. The SWISS-MODEL repository and associated resources. Nucleic Acids Res. 2009, 37, D387–D392. [Google Scholar] [CrossRef]
- Biasini, M.; Bienert, S.; Waterhouse, A.; Arnold, K.; Studer, G.; Schmidt, T.; Kiefer, F.; Cassarino, T.G.; Bertoni, M.; Bordoli, L.; et al. SWISS-MODEL: Modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Res. 2014, 42, W252–W258. [Google Scholar] [CrossRef]
- Ishikawa, K.; Kataoka, M.; Yanamoto, T.; Nakabayashi, M.; Watanabe, M.; Ishihara, S.; Yamaguchi, S. Crystal structure of β-galactosidase from Bacillus circulans ATCC 31382 (BgaD) and the construction of the thermophilic mutants. FEBS J. 2015, 282, 2540–2552. [Google Scholar] [CrossRef]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Chan, H.S.; Filipek, S.; Vogel, H. PyMOL and Inkscape bridge the data and the data visualization. Structure 2016, 24, 2041–2042. [Google Scholar] [CrossRef] [PubMed]
- Stourac, J.; Vavra, O.; Kokkonen, P.; Filipovic, J.; Pinto, G.; Brezovsky, J.; Damborsky, J.; Bednar, D. Caver Web 1.0: Identification of tunnels and channels in proteins and analysis of ligand transport. Nucleic Acids Res. 2019, 47, W414–W422. [Google Scholar] [CrossRef] [PubMed]
- Heckman, K.L.; Pease, L.R. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat. Protoc. 2007, 2, 924–932. [Google Scholar] [CrossRef]
- Maniatis, T.; Fritsch, F.E.; Sambrook, J. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press: New York, NY, USA, 1989. [Google Scholar]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef]
- Zhu, G.J.; Wang, Z.X. A Lab Manual for Industrial Microbiology; China Light Industry Press: Beijing, China, 1994. [Google Scholar]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Yin, H.; Bultema, J.B.; Dijkhuizen, L.; van Leeuwen, S.S. Reaction kinetics and galactooligosaccharide product profiles of the β-galactosidases from Bacillus circulans, Kluyveromyces lactis and Aspergillus oryzae. Food Chem. 2017, 225, 230–238. [Google Scholar] [CrossRef]
- Kakkar, T.; Boxenbaum, H.; Mayersohn, M. Estimation of Ki in a competitive enzyme-inhibition model: Comparisons among three methods of data analysis. Drug Metab. Dispos. 1999, 27, 756–762. [Google Scholar]
Enzyme | Binding Energy a (kcal·mol−1) | Binding Site b | Distinction from Lactose-Binding Site c |
---|---|---|---|
BglD | −3.68 | ||
T215C | −2.62 | ||
T215H | −2.39 | ||
T215N | −2.42 | ||
T473Y | −2.33 | ||
T215Y | −2.91 | ||
T473L | −2.26 | ||
T473S | −1.86 | ||
T473V | −1.95 |
Enzyme | Specific Activity (U·mg−1) | Folds of Specific Activities Comparison to BglD |
---|---|---|
BglD | 109.6 ± 2.6 | 1.00 |
T215C | 169.2 ± 5.1 | 1.54 |
T215H | 214.8 ± 5.8 | 1.96 |
T215N | 145.2 ± 3.6 | 1.33 |
T215Y | 162.3 ± 4.2 | 1.48 |
T473L | 195.8 ± 5.1 | 1.79 |
T473S | 200.7 ± 5.8 | 1.83 |
T473V | 187.5 ± 5.2 | 1.71 |
T473Y | 203.2 ± 4.3 | 1.85 |
Enzyme | Km (mM) | kcat (s−1) | kcat/Km (s−1·mM−1) | Ki (mM) |
---|---|---|---|---|
BglD | 118.1 ± 6.3 | 23.9 ± 1.3 | 0.20 | 84.8 ± 5.4 |
T215C | 111.3 ± 5.0 | 55.5 ± 2.8 | 0.50 | 126.5 ± 6.8 |
T215H | 114.5 ± 5.8 | 34.9 ± 1.9 | 0.30 | 137.8 ± 7.1 |
T215N | 107.9 ± 4.0 | 38.0 ± 2.4 | 0.35 | 102.4 ± 5.2 |
T215Y | 89.4 ± 6.4 | 50.9 ± 2.5 | 0.57 | 96.2 ± 4.6 |
T473L | 52.7 ± 3.6 | 33.7 ± 2.1 | 0.64 | 112.5 ± 5.2 |
T473S | 110.6 ± 6.5 | 50.0 ± 2.4 | 0.45 | 133.6 ± 7.0 |
T473V | 84.6 ± 4.9 | 45.5 ± 1.4 | 0.54 | 131.6 ± 6.8 |
T473Y | 114.2 ± 4.9 | 33.1 ± 1.1 | 0.29 | 117.4 ± 4.9 |
Enzyme | Sugar Profile and Content in the Final Reaction Mixture b (g·L−1) | Lactose Consumed c (g·L−1) | GOS Yield (%) d | Lactose-to-GOS Yield (%) e | GOS Productivity g (mg·g−1·h−1) | Lactose Consumption Rate h (mg·g−1·h−1) | T/(T + H) (%) f | ||
---|---|---|---|---|---|---|---|---|---|
Lactose | Glucose | Galactose | |||||||
BglD | 100.8 ± 2.8 | 82.6 ± 1.6 | 8.0 ± 0.3 | 299.2 ± 7.8 | 52.1 ± 1.0 | 69.7 ± 2.1 | 21.7 ± 1.3 | 31.2 ± 1.1 | 96.3 ± 0.2 |
T215C | 83.9 ± 1.7 | 81.0 ± 1.5 | 7.8 ± 0.2 | 316.1 ± 8.0 | 56.8 ± 1.3 | 71.9 ± 2.6 | 23.7 ± 1.4 | 32.9 ± 1.3 | 96.7 ± 0.1 |
T215N | 85.6 ± 1.8 | 80.6 ± 1.7 | 8.4 ± 0.3 | 314.4 ± 8.2 | 56.4 ± 1.7 | 71.7 ± 2.5 | 23.5 ± 0.9 | 32.8 ± 0.9 | 96.4 ± 0.1 |
T215H | 82.3 ± 2.0 | 81.6 ± 1.8 | 9.3 ± 0.3 | 317.7 ± 8.5 | 56.7 ± 2.0 | 71.4 ± 2.0 | 23.6 ± 1.0 | 33.1 ± 1.0 | 96.1 ± 0.1 |
T215Y | 82.2 ± 1.9 | 80.8 ± 1.7 | 8.4 ± 0.2 | 317.8 ± 7.5 | 57.2 ± 2.3 | 72.0 ± 1.9 | 23.8 ± 0.8 | 33.1 ± 1.3 | 96.5 ± 0.2 |
T473L | 81.6 ± 2.3 | 81.7 ± 1.9 | 9.5 ± 0.3 | 318.4 ± 7.1 | 56.8 ± 1.8 | 71.4 ± 3.2 | 23.7 ± 1.1 | 33.2 ± 1.8 | 96.0 ± 0.1 |
T473S | 81.1 ± 2.5 | 81.2 ± 1.8 | 8.8 ± 0.2 | 318.9 ± 5.9 | 57.2 ± 2.1 | 71.8 ± 2.1 | 23.8 ± 1.4 | 33.2 ± 1.1 | 96.3 ± 0.2 |
T473V | 80.4 ± 2.5 | 81.3 ± 1.7 | 8.1 ± 0.1 | 319.6 ± 6.9 | 57.6 ± 2.5 | 72.0 ± 2.5 | 24.0 ± 1.2 | 33.3 ± 1.5 | 96.6 ± 0.2 |
T473Y | 85.5 ± 1.8 | 80.8 ± 1.8 | 8.4 ± 0.1 | 314.5 ± 8.1 | 56.3 ± 1.9 | 71.6 ± 2.4 | 23.5 ± 1.4 | 32.8 ± 1.4 | 96.4 ± 0.1 |
Primer | Nucleotide Sequence (5′ → 3′) * |
---|---|
BglD-F | GCTGGATCCAGCAAGACTACCTCCGCTGCTG |
BglD-R | AGGAGTGACGGTGAAAACAGAAG |
T215C-F | TTTCGTTACCTGCCCAAACTTGG |
T215C-R | CCAAGTTTGGGCAGGTAACGAAA |
T215H-F | TTTCGTTACCCATCCAAACTTGG |
T215H-R | CCAAGTTTGGATGGGTAACGAAA |
T215N-F | TTTCGTTACCAACCCAAACTTGG |
T215N-R | CCAAGTTTGGGTTGGTAACGAAA |
T215Y-F | TTTCGTTACCTATCCAAACTTGG |
T215Y-R | CCAAGTTTGGATAGGTAACGAAA |
T473L-F | GATTGACACCCTGAGACCTACCA |
T473L-R | TGGTAGGTCTCAGGGTGTCAATC |
T473S-F | GATTGACACCAGCAGACCTACCA |
T473S-R | TGGTAGGTCTGCTGGTGTCAATC |
T473V-F | GATTGACACCGTCAGACCTACCA |
T473V-R | TGGTAGGTCTGACGGTGTCAATC |
T473Y-F | GATTGACACCTATAGACCTACCA |
T473Y-R | TGGTAGGTCTATAGGTGTCAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, J.; Niu, D.; Liu, J.; Jin, Z.; Mchunu, N.P.; Singh, S.; Wang, Z. Enhancing β-Galactosidase Performance for Galactooligosaccharides Preparation via Strategic Glucose Re-Tunneling. Int. J. Mol. Sci. 2024, 25, 12316. https://doi.org/10.3390/ijms252212316
Zhao J, Niu D, Liu J, Jin Z, Mchunu NP, Singh S, Wang Z. Enhancing β-Galactosidase Performance for Galactooligosaccharides Preparation via Strategic Glucose Re-Tunneling. International Journal of Molecular Sciences. 2024; 25(22):12316. https://doi.org/10.3390/ijms252212316
Chicago/Turabian StyleZhao, Jihua, Dandan Niu, Jiaqi Liu, Zhuolin Jin, Nokuthula Peace Mchunu, Suren Singh, and Zhengxiang Wang. 2024. "Enhancing β-Galactosidase Performance for Galactooligosaccharides Preparation via Strategic Glucose Re-Tunneling" International Journal of Molecular Sciences 25, no. 22: 12316. https://doi.org/10.3390/ijms252212316
APA StyleZhao, J., Niu, D., Liu, J., Jin, Z., Mchunu, N. P., Singh, S., & Wang, Z. (2024). Enhancing β-Galactosidase Performance for Galactooligosaccharides Preparation via Strategic Glucose Re-Tunneling. International Journal of Molecular Sciences, 25(22), 12316. https://doi.org/10.3390/ijms252212316