Next Article in Journal
Acute Paraoxon-Induced Neurotoxicity in a Mouse Survival Model: Oxidative Stress, Dopaminergic System Alterations and Memory Deficits
Previous Article in Journal
Molecular Analysis of PIK3CA in Metastatic Hormone Receptor-Positive Breast Cancer in Chile: Clinical and Pathological Insights
Previous Article in Special Issue
Recent Progress on Plant Apomixis for Genetic Improvement
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony

1
College of Landscape Architecture, Beijing University of Agriculture, Beijing 102206, China
2
Beijing Laboratory of Urban and Rural Ecological Environment, Beijing 102206, China
3
Ancient Tree Health and Culture Engineering Technology Research Center, National Forestry and Grassland Administration, Beijing 102206, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(22), 12247; https://doi.org/10.3390/ijms252212247
Submission received: 29 September 2024 / Revised: 6 November 2024 / Accepted: 9 November 2024 / Published: 14 November 2024
(This article belongs to the Special Issue The Biochemistry, Molecular and Cell Biology Beyond Flowers)

Abstract

:
Tree peony (Paeonia suffruticosa), as a popular ornamental plant worldwide, has a unique floral fragrance, and it is important in the pollination, ornamental, food, and fragrance product industries. However, the underlying molecular mechanisms for the synthesis of floral fragrance terpenoids in tree peony are not well understood, constraining their exploitation. P. suffruticosa ‘Oukan’ produces strong floral fragrance terpenoids with high ornamental value and excellent stress resistance and is considered a valuable model for studying tree peony floral fragrance formation. Based on transcriptome data analysis, the PsHMGR1 and PsTPS1 genes associated with floral terpene synthesis were cloned. Then, PsHMGR1 and PsTPS1 were functionally characterized by amino acid sequence analysis, multiple sequence alignment, phylogenetic tree construction, qRT-PCR, and transgenic assay. PsHMGR1 contains two transmembrane structures and a conserved HMG-CoA_reductase_class I domain, and PsTPS1 belongs to TPS-a subfamily. The qRT-PCR analysis showed that the expression levels of PsHMGR1 and PsTPS1 increased and then decreased at different flower development stages, and both were significantly higher in flowers than in roots, stems, and leaves. In addition, the linalool content in PsHMGR1 transgenic lines was significantly higher than that of WT. Germacrene D, which was not found in WT, was detected in the flowers of PsTPS1 transgenic lines. These results indicate that PsHMGR1 and PsTPS1 promote terpene synthesis in plants and provide ideas for the molecular mechanism of enhancing terpene synthesis in tree peony floral fragrance.

1. Introduction

Releasing floral fragrance is an important feature of flowering plants. Floral fragrance, a secondary metabolite released from flowers, is a typical component of plant volatile organic compounds (VOCs), which is crucial in physiological and ecological processes [1,2]. For the plants, floral fragrance not only helps them to reproduce and improve resistance but also acts as communication signal [3]. Meanwhile, as an important indicator of flower quality, the improvement of floral fragrance traits is significant for enhancing the flowers ornamental and economic value [4]. Compared to flower color and shape, floral fragrance is more likely to influence consumer choice; however, the development of scent in many flower varieties has often been neglected in traditional breeding programs [5,6,7,8]. In addition, floral volatile compounds have been used in a wide range of applications, such as food, pharmaceuticals, additives, and flavoring products [3,9]. Based on the biosynthetic origin in plants, floral volatile compounds are generally classified into three groups: terpenoids, phenylpropanoids/benzenoids, and fatty acid derivatives [10,11]. Terpenoids, as the largest group of them, are one of the main components that make up the floral fragrance of ornamental plants [12,13]. Studies have confirmed the predominance of terpenoids in the floral fragrance in strongly scented Lilium species [10,14], Chrysanthemum morifolium [15], Aster species [16], Phalaenopsis species [17], Fressia hybrida [18], Rosa damescena [7], and Osmanthus fragrans [19,20].
Terpenoids in plants have been reported to be synthesized through two compartmentally separated metabolic pathways: the mevalonate (MVA) pathway in the cytosol and the methylerythritol phosphate (MEP) pathway in plastids [8,21]. And these two pathways are not completely independent, and there is cross-talk between them [11,22]. 3-hydroxy-3-methyl-glutaryl CoA (HMG-CoA) reductase (HMGR), the first key rate-limiting enzyme in the MVA pathway, plays a very important role in controlling the flow of carbon sources in the metabolic pathway [23]. Moreover, catalyzing the synthesis of HMG-CoA by HMGR is a critical regulatory step in the biosynthesis of terpenoids [24,25,26,27]. In recent years, more and more HMGR genes from different plants have been isolated and cloned, and their expression patterns have been analyzed and found to be highly expressed in metabolite-enriched organs [23,25]. The HbHMGR1 gene is expressed at significantly higher levels in latex than in leaves, phloem, and xylem and may play an important role in natural rubber biosynthesis in Hevea brasiliensis [28]. Both PgHMGR1 and PgHMGR2 genes are expressed at higher levels in 3- and 6-year-old ginseng roots than in other organs, suggesting that PgHMGRs are involved in the biosynthesis of ginsenosides [29]. The functions of HMGRs in terpene biosynthesis have been investigated in model plants and medicinal plants [26,27,30,31,32]. In Artemisia annua, the artemisinin content of hmgr transgenic lines is higher than in non-transgenic lines [33]. Transient expression of the AmHMGR gene from Antirrhinum majus in tomato results in a 5.7-fold and 1.8-fold increase in monoterpene nerolidol and linalool, respectively [34]. However, the characterization of the HMGR gene of ornamental plants needs to be further explored.
Terpene synthase (TPS), a key enzyme downstream of the terpene biosynthesis pathway, is directly involved in the synthesis of terpene products. TPS largely determines the structural and functional diversity of terpenoids and plays a crucial role in the overall terpene synthesis process [4,35,36,37]. Therefore, the functional characterization of TPS in plants has received increasing attention. In recent years, TPS genes have been gradually isolated from Arabidopsis thaliana [37], Solanum lycopersicum [38], Freesia × hybrida [8,18], Lilium ‘Siberia’ [39], Lathyrus odoratus [35], Cymbidium faberi [40], and Chrysanthemum morifolium [41] and demonstrated their roles in terpene volatile biosynthesis. Based on the functions and homology, plant TPSs have been clustered into seven subfamilies (TPS-a to TPS-h) [18]. Among them, members of the TPS-a/b/g subfamilies are responsible for the majority of floral volatile monoterpene and sesquiterpene compounds, whose emissions are found to be significantly correlated with the expression of TPSs [8,18,35,41]. For example, the temporal expression pattern of the FhTPS1 (TPS-b) gene during flower development in Freesia petals is consistent with linalool emission [18]. The LoTPS4 (TPS-a) gene expressed at a high level in petal at the S4 period has been demonstrated to catalyze the production of ocimene, myrcene, and farnesene in L. odoratus [35]. Therefore, it is of great significance to study the expression pattern and synthesis mechanism of TPS genes to reveal the biosynthesis of floral terpene volatiles.
Paeonia suffruticosa, a woody flower with high ornamental and applied value, is one of the traditional Chinese famous flowers and enjoys the reputation of ‘national beauty and heavenly fragrance’ [42,43,44]. Tree peony is famous for its large and colorful flowers, rich flower shapes, and strong fragrance [45,46]. Its floral fragrance, as an important ornamental trait and evaluation index of flower food flavor, greatly influences the consumer market [47]. In addition, floral scent is often neglected in breeding, resulting in a considerable number of tree peony cultivars with an overly strong aroma and a few varieties suitable for flower forcing with an unpleasant scent [43]. However, compared with research on flower shape and color, studies on floral scent, especially the molecular synthesis mechanism, are still lagging behind, which limits the tree peony commercial development [48,49,50]. Therefore, it is important to understand the types of substances and the functions of key synthetic genes for tree peony floral scent and to breed new tree peony varieties with pleasant aromas using modern breeding techniques [45]. Currently, studies related to the tree peony floral fragrance mainly focus on the volatile components [42,51], among which terpenoids account for a relatively high proportion [44,46,48,52], such as ocimene, linalool, citronellol, and germacrene D [44,52,53]. So far, though several terpene synthesis-related enzyme genes have been cloned, including PdDXS in P. delavayi [54], PsDXS [55], PsDXR, and PsMCS in cultivars ‘Oukan’ [56], PsGPPS [46], PsGDS [53], PsTPS14 [57], PsuLIS [45], and five PsTPSs (PsTPS1~PsTPS5) [52] in ‘High Noon’, fewer genes are functionally characterized. Transient overexpression of PsTPS14 in tobacco leaves and the lightly scented tree peony flower ‘Fengdan’ increases enzyme activity and releases amounts of linalool [57]. And PsTPS1 and PsTPS4 are shown to involve in linalool synthesis after in vitro enzyme activity analysis and transient overexpression in tobacco leaves [52]. The isolation and functional characterization of terpene synthesis pathway genes are very important in the study of tree peony floral fragrance biosynthesis mechanism; however, the relevant research foundation is relatively weak. Therefore, it is particularly important to clone these genes and perform functional analyses in tree peony.
The strongly scented tree peony cultivar ‘Oukan’ has outstanding ornamental value and is an excellent material for the study of floral fragrance biosynthesis. However, little is known about the isolation and functional exploration of terpene biosynthetic pathway genes in ‘Oukan’. Our previous study has demonstrated that terpenoids are the main components in the floral fragrance of ‘Oukan’, and PsHMGR1 and PsTPS may play an important role in terpenoid synthesis [42]. Therefore, in this study, we cloned PsHMGR1 and PsTPS1 genes, analyzed temporal expression patterns, and transgenically characterized their functions in tobacco. This result provides important genetic resources and biological insights into the mechanism of volatile terpene biosynthesis in tree peony flowers and floral scent breeding.

2. Results

2.1. Cloning and Bioinformatics Analysis of PsHMGR1

Based on the obtained P. suffruticosa ‘Oukan’ (Figure 1) transcriptome data, the cloned PsHMGR1 had an open reading frame (ORF) of 1773 bp (Figure 2A), encoding 590 amino acids (Figure S1). The secondary structure results showed that PsHMGR1 mostly included 267 α-helices (45.25%), followed by 215 random coils (36.44%), 76 extended strands (12.88%), and 32 β-turns (5.42%) (Figure 2B). The theoretical isoelectric point (pI) of PsHMGR1 was 6.9, the theoretical relative molecular weight was 63.34 kD, the total number of negatively charged residues (Asp + Glu) was 58, and the total number of positively charged residues (Arg + Lys) was 57. The tertiary structure modeling of PsHMGR1 protein was modeled on the HMGR of Populus trichocarpa with 80.68% similarity and a GMQE value of 0.83 (Figure 2C). The transmembrane structure analysis suggested the PsHMGR1 protein contains two transmembrane structural domains located at amino acids 52–74 and 95–117, respectively (Figure 2D). Moreover, there were no protein signal peptides analyzed in PsHMGR1 (Figure 2E). And PsHMGR1 was found to be an unstable hydrophobic protein with a grand average of hydropathicity (GRAVY) of 0.061, an aliphatic index of 95.53, and an instability index of 49.67 (Figure 2F). The conserved domain analysis of PsHMGR1 indicated that one core specific sequence was HMG-CoA_reductase_class I, which belonged to the HMG-CoA_reductase superfamily and catalyzed the synthesis of coenzyme A and mevalonate in the isoprenoid synthesis multifunctional domain (Figure 2G).

2.2. Phylogenetic Tree and Multiple Sequence Alignment Analysis of PsHMGR1

The phylogenetic tree was constructed using all 38 HMGR protein sequences from 36 species, including animals, fungi, bacteria, and plants, to explore the evolution of PsHMGR1 (Figure 3A). The phylogenetic tree results were in agreement with the traditional taxonomy, in which PsHMGR1 clustered in the eudicots lineage (Figure 3A). And PsHMGR1 had shorter branch length within the eudicots group, suggesting that PsHMGR1 was phylogenetically distinct and later than other species (Figure 3A). Compared to other homologous proteins, PsHMGR1 was more closely related to the evolution of the DtHMGR protein (HMGR of Dillenia turbinata) and also clustered on the same branch as PtHMGR1 (HMGR of P. trichocarpa), PeHMGR1 (HMGR of P. euphratica), and PaHMGR1 (HMGR of P. alba) (Figure 3A).
Multiple sequence alignment of amino acids revealed that PsHMGR1 contained two HMG-CoA binding motifs (motif I, EMPVGYVQIP; motif II, TTEGCLVA) and two NADP(H) binding motifs (motif III, DAMGMNM; motif IV, GTVGGGT) (Figure 3B). And PsHMGR1 shared the most amino acid sequence identity (83.39%) with DtHMGR, and 80.71% and 80.41% with PtHMGR1 and TwHMGR1, respectively (Figure 3B). These results indicated that PsHMGR1 was highly conserved in the evolutionary process.

2.3. Cloning and Bioinformatics Analysis of PsTPS1

The complete ORF of PsTPS1 was 1662 bp (Figure 4A) and encoded 553 amino acids (Figure S2). The theoretical relative molecular weight of the PsTPS1 protein was 63.63 kD, and the theoretical pI was 5.25. The total number of negatively charged residues (Asp + Glu) was 73, and the total number of positively charged residues (Arg + Lys) was 53. The secondary structure predicted that PsTPS1 contained 378 α-helix (68.35%), 126 random coil (22.78%), 31 extended strands (5.61%), and 18 β-turns (3.25%) (Figure 4B). The GMEQ value for tertiary structure modeling was 0.92, and the results suggested that PsTPS1 protein had a high similarity of 72.54% with the TPS01 model of Liquidambar formosana (Figure 4C). TMHMM and signal peptide analyses also showed PsTPS1 had no signal peptide and transmembrane structural (Figure 4D,E). And PsTPS1 protein exhibited a hydrophilic and unstable nature with a GRAVY value of −0.237, aliphatic index of 92.06, and instability index of 46.39 (Figure 4F). The conserved domains analysis revealed that PsTPS1 contained a Terpene_cyclase_plant_C1 (Isopernoid_Biosyn_C1 surperfamily) domain with terpene synthase activity (Figure 4G).

2.4. Phylogenetic Tree and Multiple Sequence Alignment Analysis of PsTPS1

Phylogenetic tree construction by downloading 32 representative TPS protein sequences of 9 other species from the TPS-a, TPS-b, TPS-c, TPS-d, TPS-e/f, and TPS-g subfamilies, respectively, showed that PsTPS1 clustered in the TPS-a subfamily (Figure 5A). And PsTPS1 also had a shorter branch length in the phylogenetic tree (Figure 5A), indicating that it differentiated later than other plants, the result that was the same as phylogenetic tree of PsHMGR1 in Figure 3A. In addition, PsTPS1 showed the closest homology to PdTPS (TPS of P. delavayi), which also belonged to the genus Paeonia, in agreement with the plant taxonomy, as well as clustering on the same branch with PlTPS of P. lactiflora, PdTPS2 of P. delavayi, and LfTPS01 of Liquidambar formosana (Figure 5A).
Based on the results of the tree, three TPSs were selected for multiple sequence alignment analysis. The results of multiple sequence alignment indicated that PsTPS1 had the conserved R(R,P,Q)(X)8W (motif I) at the N-termini that could catalyze the cyclization of substrates, as well as two typical DDXXD (motif II) and NSE/DTE (motif III) motifs at the C-termini that can be involved in the binding of divalent metal cations Mg2+ or Mn2+ (Figure 5B). Compared to the amino acid sequences of other species, the PsTPS1 protein had the highest identity to the TPS protein of P. delavayi (PdTPS) (99.10%), followed by the PlTPS (95.15%) and LfTPS01 (70.18%) (Figure 5B).

2.5. PsHMGR1 and PsTPS1 Genes Show Different Expression Patterns in Flower Development Stages and Different Tissues

The expression patterns of PsHMGR1 and PsTPS1 were analyzed by qRT-PCR in P. suffruticosasion ‘Oukan’. The results indicated that both PsHMGR1 and PsTPS1 were expressed at every flower developmental stage and every organ and tissue (Figure 6). PsHMGR1 expression levels increased from Stage 1 to Stage 3 and then decreased to Stage 4 (Figure 6A). The expression level of PsTPS1 also showed a trend of increasing and then decreasing, with the highest expression level at Stage 2 (Figure 6B). The expression levels of the PsHMGR1 and PsTPS1 at different flower development stages were consistent with the release amount of floral fragrance volatile from ‘Oukan’ [42], demonstrating that they may play an important role in floral volatile biosynthesis.
In various organs and tissues, both PsHMGR1 and PsTPS1 were expressed at much higher levels in flowers than in roots, stems, and leaves, especially in petals and stamens (Figure 6C,D), suggesting that these two genes may play important roles in the formation of floral traits. The expression levels of PsHMGR1 were also higher in carpels and sepals, which were not significantly different from those in stamens, and higher in roots than in stems and leaves (Figure 6C). Whereas PsTPS1 was expressed at a significantly higher level in sepals than in carpels, it was not significantly differentially expressed in roots, stems, and leaves (Figure 6D).

2.6. Overexpression of PsHMGR1 and PsTPS1 in Tobacco Affects the Accumulation of Terpenoids

Due to the lack of a functional validation system for P. suffruticosa ‘Oukan’, transgenic tobacco was selected for functional exploration of the PsHMGR1 and PsTPS1 genes, and the experimental procedure was displayed in Figure S3. Three positive transgenic lines harboring PsHMGR1 (OE-PsHMGR1) (Figure 7A) and three lines harboring PsTPS1 (OE-PsTPS1) (Figure 8A) were selected using PCR, and the wild-type (WT) tobacco lines were treated as controls. The expression levels of these two genes in transgenic lines were further confirmed by qRT-PCR. The results showed that the expression levels of both genes were significantly increased in the transgenic lines compared to the levels in the control (Figure 7B and Figure 8B). Detection of floral volatiles by headspace SPME-GC-MS revealed that overexpression of PsHMGR1 resulted in significant changes in compound content in the transgenic lines. And the peak area of linalool (a monoterpene, which was the main floral volatile in ‘Oukan’) detected in the OE-PsHMGR1 lines was 30.40% higher than that of the WT (Figure 7C,D).
For the transgenic lines of the PsTPS1 gene, the content of volatile compounds changed considerably in the WT and transgenic lines of PsTPS1 (OE-PsTPS1). The OE-PsTPS1 lines showed a significant increase in germacrene D, a sesquiterpene volatile compound, which was not detected in the WT lines (Figure 8D,F). However, there was no significant difference in the linalool content detected (Figure 8C,E). And the complete GC-MS total ion chromatograms and substance identification table were shown in Figure S4 and Table S3.

3. Discussion

Floral fragrance is an important trait of tree peony, which not only mediates its pollination and environmental adaptation but also serves as a key ornamental evaluation index, determining its market value and potential for development and application. Compared with flower color and shape, the study of floral fragrance has started later. At present, the reports on tree peony floral scent mainly focus on the detection and analysis of volatile components, and only in the past three years molecular investigations gradually emerge [45,52,53,56,57]. However, the cloning and preliminary functional analyses of terpenoid synthesis genes for floral scent are focused on the variety of tree peony cultivar ‘High Noon’ [45,46,52,53,57]. As a leading cultivar from the Japanese cultivar-group, the tree peony cultivar ‘Oukan’, with its strong floral scent, unique flower shape, golden color, high adaptability, and ease of cultivation and management, is not only highly attractive but also has great potential in breeding, fragrance products, and food industry applications. Tree peony cultivar ‘Oukan’ has been reported to have a strong floral fragrance dominated by terpenoids, reaching more than 80% [42]. While there is a lack of investigation on the molecular synthesis mechanism of terpenoids in its floral fragrance. Therefore, in this study, we used ‘Oukan’ as the material and screened two terpene synthesis pathway genes, PsHMGR1 and PsTPS1, to carry out further work on the molecular level research.
HMGR is widely distributed in various types of organisms. The characterization and amino acid sequence analysis of a large number of HMGR genes reveals that HMGR is divided into two major classes: class I and class II. Class I is found in eukaryotes with highly conserved catalytic domains and a transmembrane region at the N-terminal associated with the degradation of HMGR molecules, while class II is first discovered in prokaryotes and usually have no transmembrane region [25,26]. In this study, analysis of the amino acid sequence encoded by the PsHMGR1 gene of ‘Oukan’ showed that the putative PsHMGR1 protein contained structural features common to most plant HMGRs: it was attributed to the HMG-CoA_reductase superfamily member and contained a typical HMG-CoA_reductase_class I structural domain; highly conserved at the C-terminus with large sequence variation at the N-terminus; two transmembrane structural domains; and four highly conserved motifs, i.e., two HMG-CoA-binding motifs and two NADP(H)-binding motifs [24,25,26]. We found that the amino acids of the second HMG-CoA-binding site and the two NADP(H)-binding sites of PsHMGR1 were identical to those of other plants, whereas the first HMG-CoA-binding site varied somewhat among different plant HMGRs, and the differences in this site might affect the recognition and binding ability to substrates [25]. Phylogenetic tree results showed that PsHMGR1 had high homology with DtHMGR and PtHMGR proteins, and D. turbinata also possessed volatile floral fragrance, as well as producing significantly higher terpene content than the control in the PtHMGR transgenic poplar lines [32]. So it was hypothesized that PsHMGR1 was involved in the biosynthesis of floral fragrance volatiles.
Further examination of the expression level of PsHMGR1 in different organs of ‘Oukan’ revealed that its expression level in flower was significantly higher than that in other organs. The changes in the expression of PsHMGR1 during the four flower developmental stages showed a consistent trend with the changes in floral fragrance release. The study reported that the expression levels of plant HMGR genes in different tissues were closely correlated with the accumulation of metabolites, which further illustrated the potential of PsHMGR1 in floral scent biosynthesis [24]. In Jasminum sambac, the expression level of JsHMGR also shows a trend of increasing and then decreasing along with different flowering stages, which is basically consistent with the trend of changes in the floral fragrance volatiles content [58], which is in agreement with PsHMGR1. Currently, HMGR genes have been isolated and functionally characterized mainly in medicinal plants, such as A. annua [59], Panax ginseng [29], Pseudostellaria heterophylla [26], Catharanthus roseus [60], and Lithospermum erythrorhizon [24]. HMGR enzyme activity as well as total triterpene content is significantly higher in tobacco plants transgenic for PhHMGR than in control plants [26]. LerHMGR1 and LerHMGR2 from L. erythrorhizon have been cloned and demonstrated in vitro to catalyze the conversion of HMG-CoA to MVA, which is thought to play a key rate-determining role in the biosynthesis of shikonin [24]. Transgenesis of the hmgr gene from C. roseus into A. annua produces 38.9% higher artemisinin than the control and increased HMGR enzyme activity [60]. However, little has been reported on the functional resolution of the HMGR gene in ornamental flowers. A mature genetic transformation system has not yet been established in tree peony. In this study, PsHMGR1 was transformed into tobacco, and linalool release amount was detected to be significantly higher than the control. Our work complements the functional characterization of HMGR genes in ornamental plants. The expression levels of JsHMGR in J. sambac at different stages of flower development and at different times after bud excision are basically in agreement with the trend of linalool release [58], which further corroborates our results.
As a key enzyme in the last step of terpene synthesis, TPS has a direct role in determining the type of terpene compounds synthesized. Although its sequence is somewhat conserved, TPS proteins are diverse during evolution and in different plants [4,10,61]. PsTPS1 isolated in this study possessed the typical conserved structural domain Terpene_cyclase_plant_C1, which was usually contained in TPS family members; had the highly conserved DDXXD and NSE/DTE motifs, which were considered to be active sites necessary for binding divalent metal cations to catalyze the biosynthesis of terpenes; and was also found to have a typical R(R,P,Q)(X)8W motif at the N-terminus responsible for catalyzing the monoterpenes cyclization [8,18,61]. Typically, members of the TPS-a subfamily synthesize mainly sesquiterpenes [18,62]. In F. hybrida, TPS-a subfamily members FhTPS6, FhTPS7, and FhTPS8 all synthesize the sesquiterpenes [18], and five TPS-a subfamily members in Rosa hybrida, RhTPS47, RhTPS26, RhTPS30, RhTPS32, and RhTPS32S, are also identified as sesquiterpene synthases [61]. The results of phylogenetic tree analysis in this study showed that PsTPS1 was clustered into the TPS-a clade, so it was hypothesized that PsTPS1 might be involved in sesquiterpene synthesis. PdTPS5, PdTPS2, and RhTPS32, which are more homologous to PsTPS1 in the tree, have been reported to produce sesquiterpene germacrene D in vitro [52,61]. PaTPS, VrTPS, and VvTPS, which were clustered on the same branch as PsTPS1, were all annotated as germacrene D synthases in NCBI, further speculating that PsTPS1 had the potential to synthesize the sesquiterpene germacrene D. Subsequently, qRT-PCR revealed that the expression levels of PsTPS1 in ‘Oukan’ at different flower developmental stages were consistent with the trend of floral scent release, and the highest expression levels were found in the petal. Further, germacrene D, which was not present in the WT lines, was detected in PsTPS1 transgenic tobacco flowers, and this result validated our previous analyses. Thus, PsTPS1 could be considered a terpene synthase gene that catalyzes germacrene D synthesis exclusively, with potential in the future molecular breeding of tree peony floral fragrances.
In this study, PsHMGR1 and PsTPS1 genes potentially affecting the biosynthesis of floral fragrance terpenoids in tree peony cultivar ‘Oukan’, were cloned and bioinformatically analyzed based on the results of transcriptome analysis, and the functions of PsHMGR1 and PsTPS1 were further characterized by gene expression level assays as well as transgenic approaches. Notably, significantly higher linalool release amount was detected in the flowers of the PsHMGR1 transgenic lines than in WT; germacrene D, which was absent in WT, was detected in the flowers of the PsTPS1 transgenic lines, but there was no differential change in linalool release amount. This suggested that these two genes played an important role in the synthesis of floral terpene volatiles, and it was hypothesized that there was a relationship between the MVA and MEP pathways. Our results provide new insight into the study of floral fragrances of tree peony ‘Oukan’ at the molecular level.

4. Materials and Methods

4.1. Plant Materials

P. suffruticosa ‘Oukan’ was grown in Beijing University of Agriculture (Beijing, China. 116°3′14″ E, 40°0′95″ N). It was divided into four different flower developmental stages, namely the bud brusting stage (stage 1), the initial flowering stage (stage 2), the full blooming stage (stage 3), and the flower withering stage (stage 4) (Figure 1A). And the roots, stems, leaves, petals, stamens, carpels, and sepals samples from stage 3 and petals from the four stages were collected. For total RNA extraction, samples were immediately frozen in liquid nitrogen and stored at −80 °C for further experiments. Tobacco plants for transformation were grown in an artificial climate room under standard conditions (16 h of light/8 h of dark, 25 ± 2 °C).

4.2. RNA Extraction, cDNA Synthesis, and Expression Analyses (qRT-PCR)

Total RNA was extracted from petals of different stages, organs, and tissues using an EASY Spin Plant RNA Extraction Kit (Aidlab, Beijing, China). And the integrity and concentration of RNA were detected by 1.2% agarose gel electrophoresis and nucleic acid detectors (Implen Nanophotometer P330, Munich, Germany), respectively. cDNA was synthesized in a final reaction volume of 20 µL, referring to the Evo M-MLV Reverse Transcription (Accurate Biotechnology (Hunan) Co., Ltd., Changsha, AG11605, China).
Specific primers (Table 1) were designed based on transcriptome sequencing data [42]. The expression levels of the genes were detected by qRT-PCR using cDNA as a template and referring to the SYBR Green Premix Pro Taq HS qPCR Tracking Kit (Accurate Biotechnology (Hunan) Co., Ltd., Changsha, AG11735, China). There were three independent biological replicates and three technical replicates of each biological replicate. Actin (Table 1) was used as an internal reference gene. The relative expression levels of the genes were calculated and analyzed using the 2−ΔΔCT method. Data were statistically analyzed using ONE-WAY ANOVA in GraphPad Prism V8.4.2.

4.3. Gene Cloning and Sequence Analysis

Candidate genes were selected from DEGs analysis on the terpene metabolic pathway of P. suffruticosa transcriptome database [42]. The cDNAs were synthesized from the total RNA of the petals in Stage 3 of P. suffruticosa ‘Huangguan’ as the templates, and PCR reactions were referenced to ApexHF HS DNA polymerase FS Master Mix (Accurate Biotechnology, AG12206, China). According to tree poney transcriptome data, PsHMGR1 and PsTPS1 genes were cloned using the RACE-PCR approach. The PCR product was cloned into the pClone007 vector (Beijing Tsingke Biotech Co., Ltd., TSV-007VS, Beijing, China) and transformed into E.coil DH5α for sequencing confirmation. Primers were listed in Table 1.
The physicochemical properties, secondary structure characterization, 3D structure model building, transmembrane domains, hydrophilic or hydrophobicity analysis, protein signal peptide sequences, and protein conserved domains of PsHMGR1 and PsTPS1 proteins were performed using the Expasy ProtParam tool, SOPMA, SWISS-MODEL server, TMHMM2.0, Expasy ProtScale, SignalP 6.0, and NCBI Conserved Domains V3.21 software, respectively.

4.4. Phylogenetic Trees Construction and Multiple Sequence Alignment

For constructing the phylogenetic tree of PsHMGR1, firstly, HMGR proteins with high homology to PsHMGR1 were found by NCBI Blastp from ten species of plants, namely D. turbinata, T. wilfordii, Ricinus communis, P. trichocarpa, Nelumbo nucifera, P. euphratica, Mangifera indica, P. alba, Pistacia vera, and Jatropha curcas. Subsequently, 27 HMGR protein sequences from 25 representative species were downloaded based on reported HMGR studies from 3 animals (Homo sapiens, Rattus norvegicus and Drosophila albomicans), 3 fungi (Saccharomyces cerevisiae, Ganoderma lucidum and Lachnellula hyalina), 3 bacteria (Zobellia galactanivorans, Streptomyces malaysiensis and Brevibacterium linens), 2 lower plants (Chlorokybus atmophyticus and Mesostigma viride from the Chlorophyta), 3 Pteridophyta (Alsophila spinulosa, Ceratopteris richardii and Adiantum capillus), 2 Bryophytes (Physcomitrella patens and Marchantia polymorpha), 2 Gymnosperms (Pinus tabuliformis and Ginkgo biloba), and 7 Angiosperms (1 basal angiosperm Amborella trichopoda, 2 monocots Oryza sativa and Zea mays, and 4 eudicots Olea europaea, Vitis vinifera, P. trichocarpa and Arabidopsis thaliana) [24,26]. Information on these HMGR proteins is shown in Table S1. Finally, the phylogenetic tree was constructed by ‘One Step Build a ML Tree’ in TBtools V2.136 software with a bootstrap value of 5000 [63].
Homologous proteins of PsTPS1 were found and downloaded in NCBI Blastp, including P. delavayi, P. lactiflora, and L. formosana. Also refer to the papers [18,35,61] to download TPS proteins from TPS-a, TPS-b, TPS-c, TPS-d, TPS-e/f, and TPS-g subfamilies, including A. thaliana, Solanum lycopersicum, Medicago truncatula, Abies grandis, Melia azedarach, P. alba, Vitis riparia, V. vinifera, and Rosa hybrida. Information on the TPS proteins is shown in Table S2. Then, the phylogenetic tree was constructed employing the MEGA-X V10.2.6 software with the neighbor-joining (NJ) method, and a bootstrap value of 1000 was used to verify the phylogenetic tree. Finally, the generated tree was visualized by online software iTOL.
Open reading frame (ORF) analysis and multiple sequence alignment of PsHMGR1, PsTPS1, and proteins from other species were carried out with DNAMAN V9.0 software. Motifs were analyzed with reference to the reported paper [8,24,26,64].

4.5. Overexpression PsHMGR1 and PsTPS1 in Tobacco and qRT-PCR Detection

The ORF sequence of PsHMGR1 without terminator and the enzymatic sites BmaHΙ and XbaΙ were used for primer design (Table 1), and the pCAMBIA1301-PsHMGR1 functional vector was constructed by homologous recombination. At the same time, the pCAMBIA1301-PsTPS1 recombinant vector was constructed by designing primers (Table 1) according to the enzymatic sites EcoRΙ and XbaΙ. The two recombinant vectors pCAMBIA1301-PsHMGR1 and pCAMBIA1301-PsTPS1 were transferred into GV3101 competent cells from Agrobacterium tumefaciens (Weidi Biotechnology Co., Shanghai, China), respectively. The colonies were incubated at 28 °C for 2 days and then verified by PCR. The positive clones were amplified with shaking, and the bacteria were collected by centrifugation and resuspended with the infiltration solution to OD600 = 0.2.
Small pieces of sterile tobacco leaves after 3 days of pre-culturing were immersed in the infiltration solution for 10 min, taken out and dried on filter paper, and then inoculated on co-culture medium for dark culture. After 2 days, they were transferred to induction medium to induce healing tissues. Subsequently, the healing tissues that met the requirements were selected for screening, differentiation, rooting, and flowering.
Total genomic DNA was extracted from young leaves of tobacco resistant plants with reference to the Hi-DNAsecure Plant kit (Beijing Tiangen Biochemical Technology Co., Ltd., DP350, Beijing, China). The DNA was used as a template for PCR amplification using hyg(501)-F/R as primers to detect the positive transgenic tobacco lines. For positive lines, at least 0.5 g of petals from the transgenic tobacco flowers were pooled and RNA extracted by referring to the TransZol Up Plus RNA Kit (TransGen Biotech, ER501-01, Beijing, China). And qRT-PCR was performed following the steps described above using 18S as the internal reference gene. The sequences of all the gene-specific primers were listed in Table 1. Statistical analysis was performed using the t-test method.

4.6. Floral Scent Collection, Determination and Analysis

Floral scent compounds were extracted by headspace SPEM using a 50/30 μm divinylbenzene/carboxen/polydimethylsiloxane (DVB/CAR/PDMS) coated fiber attached to a manual SPME holder (Supelco, Bellefonte, PA, USA). The fiber was conditioned in the GC injection port for 30 min at 250 °C before the first volatile collection. For positive lines, 0.5 g of tobacco fresh flower of full blooming were put into a 20 mL clear glass vial enclosed with a cap. The sample was equilibrated for 3 h at 25 °C, and collection was done at 50 °C for 35 min using the extractor inserted into the upper side of the vial.
The collected aromatic compounds were subsequently transferred to an Agilent 5975C GC-MS instrument (Agilent Technologies, Santa Clara, CA, USA) and desorbed for 3 min at a time. The chromatography program started at 40 °C for 2 min, and the temperature was increased to 200 °C at a rate of 5 °C/min and held at this temperature for 6 min; the inlet temperature was set at 200 °C, total flow was 27.5 mL/min, and the split ratio was 20:1.
The composition of the volatile compounds was identified using the NIST14 database through an MSD Productivity ChemStation (Agilent Technologies, Santa Clara, CA, USA). The peak areas of these compounds were counted.

4.7. Statistical Analysis

All experiments were conducted in triplicate. Excel and GraphPad Prism 8.4.2 software were used for data organization, significance analysis, and visualization.

5. Conclusions

In this study, two key genes, PsTPS1 and PsHMGR1, associated with floral fragrance terpene synthesis, were cloned firstly in P. suffruticosa ‘Oukan’. Protein multiple sequence alignment and phylogenetic tree analysis revealed that PsHMGR1 belongs to the HMG-CoA_reductase A superfamily, and PsTPS1 belongs to the TPS-a subfamily. During different flower development stages, The expression levels of PsHMGR1 and PsTPS1 increased and then decreased, with the highest expression of PsHMGR1 in stage 3 and PsTPS1 in stage 2. In different organs and tissues, the expression levels of PsHMGR1 and PsTPS1 were significantly higher in the organ of the flower than in the root, stem, and leaf and were highly expressed in the petal and stamen. Subsequently, the PsHMGR1 and PsTPS1 genes were transgenic into tobacco, respectively. After obtaining resistant plants, three transgenic strains were identified by DNA and RNA analysis. Flower fragrance determination of the transgenic tobacco lines showed significantly higher terpene volatile content compared to the WT lines. The PsHMGR1 transgenic lines produced higher levels of linalool compared to the WT, while the PsTPS1 transgenic lines produced new germacrene D. Our study contributes new novel perspectives on the molecular mechanisms of biosynthesis of floral fragrance terpenoid volatiles in ‘Oukan’. The findings provide genetic support for terpenoid synthesis in tree peony and are expected to be used for molecular design breeding for its floral fragrance trait.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms252212247/s1.

Author Contributions

J.W., Z.-H.H. and P.-S.L. conceptualized and designed the experiment; Z.-Y.L., B.M., Z.-Q.W., R.-C.L. and M.-C.X. performed the laboratory experiments and statical analysis; B.M. wrote the original draft; J.W. and Z.-H.H. revised the manuscript; J.W., Z.-H.H. and P.-S.L. acquired funding and supervised. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 31800602), the National Key R&D Program of China (No. 2018YFD1000406), the Innovative Transdisciplinary Program of Ecological Restoration Engineering, and Interdisciplinary Project of Urban Agriculture and Forestry, the Beijing Municipal Education Commission through the Innovative Transdisciplinary Program “Ecological Restoration on Engineering” (GJJXK210102).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article. Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ma, B.; Wu, J.; Zou, J.R.; Wang, J.X.; Hu, Z.H.; Jia, L.M.; Leng, P.S. Genome-wide identification and functional characterization of trans-IDS genes give new insights into terpene biosynthesis in Syringa oblata. Ind. Crops Prod. 2024, 213, 118413. [Google Scholar] [CrossRef]
  2. Pichersky, E. Biochemistry and genetics of floral scent: A historical perspective. Plant J. 2023, 115, 18–36. [Google Scholar] [CrossRef] [PubMed]
  3. Loreto, F.; D’Auria, S. How do plants sense volatiles sent by other plants? Trends Plant Sci. 2022, 27, 29–38. [Google Scholar] [CrossRef] [PubMed]
  4. Wu, J.; Zou, J.; Wang, J.; Ma, B.; Meng, X.; Hu, Z.; Leng, P. Identification of floral components and functional analysis of key TPS genes in Syringa oblata. J. Plant Genet. Resour. 2024, 25, 824–833. [Google Scholar]
  5. Du, Z.; Jin, Y.; Wang, W.; Xia, K.; Chen, Z. Molecular and metabolic insights into floral scent biosynthesis during flowering in Dendrobium chrysotoxum. Front. Plant Sci. 2022, 13, 1030492. [Google Scholar] [CrossRef]
  6. Zhou, T.; Han, W.; Ning, K.; Zhou, Y.; Zhang, D.; El-Kassaby, Y.A.; Chong, X.; Zhang, F.; Chen, F.; Chen, H. Spatial and temporal dynamics of carnation-scented flowers in LagerstroemiaNing Xiang 3’. Ind. Crops Prod. 2024, 208, 117864. [Google Scholar] [CrossRef]
  7. Shi, S.; Zhang, Z. Genetic and biochemical aspects of floral scents in roses. Int. J. Mol. Sci. 2022, 23, 8014. [Google Scholar] [CrossRef]
  8. Bao, T.; Kimani, S.; Li, Y.; Li, H.; Yang, S.; Zhang, J.; Wang, Q.; Wang, Z.; Ning, G.; Wang, L.; et al. Allelic variation of terpene synthases drives terpene diversity in the wild species of the Freesia genus. Plant Physiol. 2023, 192, 2419–2435. [Google Scholar] [CrossRef]
  9. Li, H.; Fan, Y. Research progress on the main components, metabolic pathways and key functional genes of floral terpenes. Mol. Plant Breed. 2024, 1–17. [Google Scholar]
  10. Yang, Y.Y.; Ma, B.; Li, Y.Y.; Han, M.Z.; Wu, J.; Zhou, X.F.; Tian, J.; Wang, W.H.; Leng, P.S.; Hu, Z.H. Transcriptome analysis identifies key gene LiMYB305 involved in monoterpene biosynthesis in Lilium ‘Siberia’. Front. Plant Sci. 2022, 13, 1021576. [Google Scholar] [CrossRef]
  11. Dudareva, N.; Klempien, A.; Muhlemann, J.K.; Kaplan, I. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytol. 2013, 198, 16–32. [Google Scholar] [CrossRef] [PubMed]
  12. Mostafa, S.; Wang, Y.; Zeng, W.; Jin, B. Floral scents and fruit aromas: Functions, compositions, biosynthesis, and regulation. Front. Plant Sci. 2022, 13, 860157. [Google Scholar] [CrossRef] [PubMed]
  13. Muhlemann, J.K.; Klempien, A.; Dudareva, N. Floral volatiles: From biosynthesis to function. Plant Cell Environ. 2014, 37, 1936–1949. [Google Scholar] [CrossRef] [PubMed]
  14. Yang, Y.; Zhang, Y.; Chen, M.; Han, X.; Yang, L. Research progress on the synthesis and regulation mechanism of Lilium fragrance substances. J. Plant Genet. Resour. 2024, 25, 718–726. [Google Scholar]
  15. Zhang, W.; Ma, X.; Chen, S.; Chen, F.; Jiang, Y. Diversity of floral volatiles in cut chrysanthemum with different flower types and diameters. J. Nanjing Agric. Univ. 2022, 45, 675–683. [Google Scholar]
  16. Song, S.Y.; Ahn, M.S.; Mekapogu, M.; Jung, J.A.; Song, H.Y.; Lim, S.H.; Jin, J.S.; Kwon, O.K. Analysis of floral scent and volatile profiles of different aster species by e-nose and HS-SPME-GC-MS. Metabolites 2023, 13, 503. [Google Scholar] [CrossRef]
  17. Chen, J.; Zhu, X.; Zheng, R.; Tong, Y.; Peng, Y.; Xie, K.; Su, Q.; Huang, R.; Zhan, S.; Shen, M.; et al. Orchestrating of native Phalaenopsis flower scents lighted the way through artificial selective breeding partiality in the current resource utilization. Ind. Crops Prod. 2024, 217, 118850. [Google Scholar] [CrossRef]
  18. Gao, F.; Liu, B.; Li, M.; Gao, X.; Fang, Q.; Liu, C.; Ding, H.; Wang, L.; Gao, X. Identification and characterization of terpene synthase genes accounting for volatile terpene emissions in flowers of Freesia x hybrida. J. Exp. Bot. 2018, 69, 4249–4265. [Google Scholar] [CrossRef]
  19. Han, Y.; Lu, M.; Yue, S.; Li, K.; Dong, M.; Liu, L.; Wang, H.; Shang, F. Comparative methylomics and chromatin accessibility analysis in Osmanthus fragrans uncovers regulation of genic transcription and mechanisms of key floral scent production. Hortic. Res. 2022, 9, uhac096. [Google Scholar] [CrossRef]
  20. Han, Y.; Wang, H.; Wang, X.; Li, K.; Dong, M.; Li, Y.; Zhu, Q.; Shang, F. Mechanism of floral scent production in Osmanthus fragrans and the production and regulation of its key floral constituents, beta-ionone and linalool. Hortic. Res. 2019, 6, 106. [Google Scholar] [CrossRef]
  21. Picazo-Aragones, J.; Terrab, A.; Balao, F. Plant volatile organic compounds evolution: Transcriptional regulation, epigenetics and polyploidy. Int. J. Mol. Sci. 2020, 21, 8956. [Google Scholar] [CrossRef] [PubMed]
  22. Pazouki, L.; Niinemets, U. Multi-substrate terpene synthases: Their cccurrence and physiological significance. Front. Plant Sci. 2016, 7, 1019. [Google Scholar] [CrossRef] [PubMed]
  23. Chu, W.; Liu, Y.; Li, Y.; Chu, X. Advances on plant 3-hydroxy-3-methylglutaryl Coenzyme A reductase (HMGR) genes. Curr. Biotechnol. 2018, 8, 93–102. [Google Scholar]
  24. Wang, X.; Wang, C.; Yang, M.; Jie, W.; Fazal, A.; Fu, J.; Yin, T.; Cai, J.; Liu, B.; Lu, G.; et al. Genome-wide comparison and functional characterization of HMGR gene family associated with shikonin biosynthesis in Lithospermum erythrorhizon. Int. J. Mol. Sci. 2023, 24, 12532. [Google Scholar] [CrossRef] [PubMed]
  25. Zheng, T.; Wei, L.; Cheng, J.; Xiang, J.; Jiang, W. Research progress of 3-hydroxy-3-methylglutaryl-CoA reductase in plants. Plant Physiol. J. 2022, 58, 1037–1044. [Google Scholar]
  26. Lin, S.-n.; Xu, Y.-q.; Chen, G.-s. Cloning and heterologous expression analysis of HMGR gene, a key enzyme gene for terpenoid synthesis of Pseudostellaria heterophylla. J. Chin. Med. Mater. 2024, 47, 1612–1618. [Google Scholar]
  27. Kalita, R.; Patar, L.; Shasany, A.K.; Modi, M.K.; Sen, P. Molecular cloning, characterization and expression analysis of 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Centella asiatica L. Mol. Biol. Rep. 2015, 42, 1431–1439. [Google Scholar] [CrossRef]
  28. Sando, T.; Takaoka, C.; Mukai, Y.; Yamashita, A.; Hattori, M.; Ogasawara, N.; Fukusaki, E.; Kobayashi, A. Cloning and characterization of mevalonate pathway genes in a natural rubber producing plant, Hevea brasiliensis. Biosci. Biotechnol. Biochem. 2008, 72, 2049–2060. [Google Scholar] [CrossRef]
  29. Kim, Y.J.; Lee, O.R.; Oh, J.Y.; Jang, M.G.; Yang, D.C. Functional analysis of 3-hydroxy-3-methylglutaryl coenzyme a reductase encoding genes in triterpene saponin-producing ginseng. Plant Physiol. 2014, 165, 373–387. [Google Scholar] [CrossRef]
  30. Kalita, R.; Modi, M.K.; Sen, P. RNAi mediated silencing of 3-hydroxy-3-methylglutaryl-CoA reductases (HMGR) in Centella asiatica. Gene Rep. 2018, 11, 52–57. [Google Scholar] [CrossRef]
  31. Zheng, T.; Guan, L.; Yu, K.; Haider, M.S.; Nasim, M.; Liu, Z.; Li, T.; Zhang, K.; Jiu, S.; Jia, H.; et al. Expressional diversity of grapevine 3-Hydroxy-3-methylglutaryl-CoA reductase (VvHMGR) in different grapes genotypes. BMC Plant Biol. 2021, 21, 279. [Google Scholar] [CrossRef] [PubMed]
  32. Movahedi, A.; Wei, H.; Pucker, B.; Ghaderi-Zefrehei, M.; Rasouli, F.; Kiani-Pouya, A.; Jiang, T.; Zhuge, Q.; Yang, L.; Zhou, X. Isoprenoid biosynthesis regulation in poplars by methylerythritol phosphate and mevalonic acid pathways. Front. Plant Sci. 2022, 13, 968780. [Google Scholar] [CrossRef] [PubMed]
  33. Alam, P.; Kamaluddin; Khan, M.A.; Mohammad, A.; Khan, R.; Abdin, M.Z. Enhanced artemisinin accumulation and metabolic profiling of transgenic Artemisia annua L. plants over-expressing by rate-limiting enzymes from isoprenoid pathway. J. Plant Interact. 2014, 9, 655–665. [Google Scholar] [CrossRef]
  34. Gutensohn, M.; Henry, L.K.; Gentry, S.A.; Lynch, J.H.; Nguyen, T.T.H.; Pichersky, E.; Dudareva, N. Overcoming bottlenecks for metabolic engineering of sesquiterpene production in tomato fruits. Front. Plant Sci. 2021, 12, 691754. [Google Scholar] [CrossRef] [PubMed]
  35. Bao, T.; Shadrack, K.; Yang, S.; Xue, X.; Li, S.; Wang, N.; Wang, Q.; Wang, L.; Gao, X.; Cronk, Q. Functional characterization of terpene aynthases accounting for the volatilized-terpene heterogeneity in Lathyrus odoratus cultivar flowers. Plant Cell Physiol. 2020, 61, 1733–1749. [Google Scholar] [CrossRef]
  36. Li, Y.; Gao, R.; Zhang, J.; Wang, Y.; Kong, P.; Lu, K.; Adnan; Liu, M.; Ao, F.; Zhao, C.; et al. The biochemical and molecular investigation of flower color and scent sheds lights on further genetic modification of ornamental traits in Clivia miniata. Hortic. Res. 2022, 9, uhac114. [Google Scholar] [CrossRef]
  37. Tholl, D.; Lee, S. Terpene specialized metabolism in Arabidopsis thaliana. Arab. Book 2011, 9, e0143. [Google Scholar] [CrossRef]
  38. Zhou, F.; Pichersky, E. The complete functional characterisation of the terpene synthase family in tomato. New Phytol. 2020, 226, 1341–1360. [Google Scholar] [CrossRef]
  39. Zhang, T.; Guo, Y.; Shi, X.; Yang, Y.; Chen, J.; Zhang, Q.; Sun, M. Overexpression of LiTPS2 from a cultivar of lily (Lilium ‘Siberia’) enhances the monoterpenoids content in tobacco flowers. Plant Physiol. Biochem. 2020, 151, 391–399. [Google Scholar] [CrossRef]
  40. Wang, Q.-Q.; Zhu, M.-J.; Yu, X.; Bi, Y.-Y.; Zhou, Z.; Chen, M.-K.; Chen, J.; Zhang, D.; Ai, Y.; Liu, Z.-J.; et al. Genome-wide identification and expression analysis of terpene aynthase genes in Cymbidium faberi. Front. Plant Sci. 2021, 12, 751853. [Google Scholar] [CrossRef]
  41. Zhang, W.; Jiang, Y.; Chen, F.; Guan, Z.; Wei, G.; Chen, X.; Zhang, C.; Kollner, T.G.; Chen, S.; Chen, F.; et al. Dynamic regulation of volatile terpenoid production and emission from Chrysanthemum morifolium capitula. Plant Physiol. Biochem. 2022, 182, 11–21. [Google Scholar] [CrossRef] [PubMed]
  42. Li, R.; Li, Z.; Leng, P.; Hu, Z.; Wu, J.; Dou, D. Transcriptome sequencing reveals terpene biosynthesis pathway genes accounting for volatile terpene of tree peony. Planta 2021, 254, 67. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, L.; Zhang, H.; Fu, Z.; Feng, N.; Wang, H.; Li, Y.; Erqiang, W. Research progress on flower fragrance breeding of peony. Mol. Plant Breed. 2023, 21, 3998–4005. [Google Scholar]
  44. Li, S.; Chen, L.; Xu, Y.; Wang, L.; Wang, L. Identification of floral fragrances in tree peony cultivars by gas chromatography–mass spectrometry. Sci. Hortic. 2012, 142, 158–165. [Google Scholar] [CrossRef]
  45. Song, C.; Ma, H.; Li, R.; Zhao, G.; Niu, T.; Guo, L.; Hou, X. Analysis of the emitted pattern of floral volatiles and cloning and functional analysis of the PsuLIS gene in tree peony cultivar ‘High Noon’. Sci. Hortic. 2024, 326, 112750. [Google Scholar] [CrossRef]
  46. Li, Z.; Zhang, X.; Li, K.; Wang, P.; Li, C.; Song, X. Integrative analysis of transcriptomic and volatile compound profiles sheds new insights into the terpenoid biosynthesis in tree peony. Ind. Crops Prod. 2022, 188, 115672. [Google Scholar] [CrossRef]
  47. Li, D.; Zhang, L.; Zhao, M.; Wang, X. Analysis of aroma components in peony flower by GC × GC-TOFMS. Henan Sci. 2022, 40, 1592–1601. [Google Scholar]
  48. Xu, H.; Yao, X.; Tong, K.; Xing, Z.; Li, Y. Analysis of volatile components in different parts of flower organs of three species of tree peony. J. Nanjing For. Univ. 2023, 47, 63–69. [Google Scholar]
  49. Ding, X.-w.; Wang, Z.-z.; Wang, Q.-g.; Hong-ying, J.; Min, C.; Li, S.-f. Analysis of floral volatile components of in Paeonia delavayi with differrent colors. Southern Hortic. 2022, 33, 25–30. [Google Scholar]
  50. Zhang, Y.; Li, C.; Wang, S.; Yuan, M.; Li, B.; Niu, L.; Shi, Q. Transcriptome and volatile compounds profiling analyses provide insights into the molecular mechanism underlying the floral fragrance of tree peony. Ind. Crops Prod. 2021, 162, 113286. [Google Scholar] [CrossRef]
  51. Zhao, M.; Zhang, L.; Wang, C.; Guan, B.; Li, B.; Wang, J.; Wang, Y. Analysis of volatile components in three peony petals by HS-SPME-GC/MS. Sci. Technol. Food Ind. 2021, 42, 294–302. [Google Scholar]
  52. Li, S.; Zhang, L.; Sun, M.; Lv, M.; Yang, Y.; Xu, W.; Wang, L. Biogenesis of flavor-related linalool is diverged and genetically conserved in tree peony (Paeonia x suffruticosa). Hortic. Res. 2023, 10, uhac253. [Google Scholar] [CrossRef] [PubMed]
  53. Li, R.; Song, C.; Niu, T.; Wei, Z.; Guo, L.; Hou, X. The emitted pattern analysis of flower volatiles and cloning of PsGDS gene in tree peony cultivar ‘High Noon’. Acta Hortic. Sinica 2023, 50, 331–344. [Google Scholar]
  54. Zhao, N.; Yuan, X.; Chen, Z.; Yang, Y.; Wang, J.; Wang, Y. Cloning and functional analysis of 1-deoxy-D-xylulose-5-phosphate synthase gene in Paeonia delavayi. Genomics Appl. Biol. 2017, 36, 2919–2925. [Google Scholar]
  55. Li, R.; Li, Z.; Bai, R.; Jing, W.; Dou, D. Cloning and expression analysis of gene PsDXS in tree peony (Paeonia suffruticosa Andr.). Mol. Plant Breed. 2021, 19, 2177–2184. [Google Scholar]
  56. Li, Z.-Y.; Liu, B.; Hu, Z.-H.; Wu, J.; Leng, P.-S. Cloning, expression analysis and subcellular localization of PsDXR and PsMCS genes in tree peony (Paeonia suffruticosa). J. Agric. Biotechnol. 2023, 31, 730–740. [Google Scholar]
  57. Wang, P.; Li, Z.; Bai, Y.; Yang, P.; Yin, C.; Li, C.; Zhang, X.; Song, X. Cloning and functional verification of linalool synthase gene PsTPS14 in tree peony ‘High Noon’. Acta Hortic. Sinica 2024, 51, 1273–1283. [Google Scholar]
  58. Yu, Y.; Lyu, S.; Chen, D.; Lin, Y.; Chen, J.; Chen, G.; Ye, N. Volatiles emitted at different flowering stages of Jasminum sambac and expression of genes related to alpha-farnesene biosynthesis. Molecules 2017, 22, 546. [Google Scholar] [CrossRef]
  59. Ram, M.; Khan, M.A.; Jha, P.; Khan, S.; Kiran, U.; Ahmad, M.M.; Javed, S.; Abdin, M.Z. HMG-CoA reductase limits artemisinin biosynthesis and accumulation in Artemisia annua L. plants. Acta Physiol. Plant. 2010, 32, 859–866. [Google Scholar] [CrossRef]
  60. Nafis, T.; Akmal, M.; Ram, M.; Alam, P.; Ahlawat, S.; Mohd, A.; Abdin, M.Z. Enhancement of artemisinin content by constitutive expression of the HMG-CoA reductase gene in high-yielding strain of Artemisia annua L. Plant Biotechnol. Rep. 2010, 5, 53–60. [Google Scholar] [CrossRef]
  61. Li, H.; Li, Y.; Yan, H.; Bao, T.; Shan, X.; Caissard, J.C.; Zhang, L.; Fang, H.; Bai, X.; Zhang, J.; et al. The complexity of volatile terpene biosynthesis in roses: Particular insights into beta-citronellol production. Plant Physiol. 2024, 196, 1908–1922. [Google Scholar] [CrossRef] [PubMed]
  62. Qiao, D.; Tang, M.; Jin, L.; Mi, X.; Chen, H.; Zhu, J.; Liu, S.; Wei, C. A monoterpene synthase gene cluster of tea plant (Camellia sinensis) potentially involved in constitutive and herbivore-induced terpene formation. Plant Physiol. Biochem. 2022, 184, 1–13. [Google Scholar] [CrossRef] [PubMed]
  63. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “One for All, All for One” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
  64. Chandra, M.; Kushwaha, S.; Mishra, B.; Sangwan, N. Molecular and structural insights for the regulation of terpenoids in Ocimum basilicum and Ocimum tenuiflorum. Plant Growth Regul. 2022, 97, 61–75. [Google Scholar] [CrossRef]
Figure 1. Photos of cultivar P. suffruticosa ‘Oukan’. (A) Four different flower developmental stages. Stage 1, bud brusting stage; Stage 2, initial flowering stage; Stage 3, full blooming stage; Stage 4, flower withering stage. (B) Different organs and tissues in Stage 3.
Figure 1. Photos of cultivar P. suffruticosa ‘Oukan’. (A) Four different flower developmental stages. Stage 1, bud brusting stage; Stage 2, initial flowering stage; Stage 3, full blooming stage; Stage 4, flower withering stage. (B) Different organs and tissues in Stage 3.
Ijms 25 12247 g001
Figure 2. The electrophoresis map of the PsHMGR1 gene and PsHMGR1 protein characterization. (A) Electrophoresis map of PsHMGR1 gene. M, marker. (B) Secondary structure prediction, (C) 3D model building, (D) transmembrane helices prediction, (E) hydrophobicity or hydrophilicity analysis, (F) signal peptide analysis, and (G) conserved domains analysis of PsHMGR1 protein.
Figure 2. The electrophoresis map of the PsHMGR1 gene and PsHMGR1 protein characterization. (A) Electrophoresis map of PsHMGR1 gene. M, marker. (B) Secondary structure prediction, (C) 3D model building, (D) transmembrane helices prediction, (E) hydrophobicity or hydrophilicity analysis, (F) signal peptide analysis, and (G) conserved domains analysis of PsHMGR1 protein.
Ijms 25 12247 g002
Figure 3. Phylogenetic tree and multiple sequence alignment of HMGR proteins. (A) Phylogenetic tree of PsHMGR1 and HMGR protein from other 37 plant species, using the IQ-TREE of TBtools V2.136 software. Bootstrap values are shown as a percentage of 5000 replicates. PsHMGR1 is marked with a green dot. Clades of various species are highlighted with different color lines. Dt, Dillenia turbinata; Tw, Tripterygium wilfordii; Rc, Ricinus communis; Pt, Populus trichocarpa; Nn, Nelumbo nucifera; Pe, Populus euphratica; Mi, Mangifera indica; Pa, Populus alba; Pv, Pistacia vera; Jc, Jatropha curcas; Ca, Chlorokybus atmophyticus; Mv, Mesostigma viride; Pp, Physcomitrella patens; Mp, Marchantia polymorpha; As, Alsophila spinulosa; Cr, Ceratopteris richardii; Ac, Adiantum capillus; Pta, Pinus tabuliformis; Gb, Ginkgo biloba; Atr, Amborella trichopoda; Os, Oryza sativa; Zm, Zea mays; Oe, Olea europaea; Vv, Vitis vinifera; At, Arabidopsis thaliana; Hs, Homo sapiens; Rn, Rattus norvegicus; Da, Drosophila albomicans; Sc, Saccharomyces cerevisiae; Gl, Ganoderma lucidum; Lh, Lachnellula hyalina; Zg, Zobellia galactanivorans; Sm, Streptomyces malaysiensis; Bl, Brevibacterium linens. (B) Alignment and analysis of PsHMGR1 with HMGR protein sequences of D. turbinata, P. trichocarpa, and T. wilfordii. Motif I, E(M/L)P(V/I)GY(V/I)Q(I/L)P; motif II, TTEGCLVA; motif III, DAMGMNM; motif IV, GTVGGGT. Accession information of HMGR proteins of other 37 plant species is detailed in Supplemental Table S1.
Figure 3. Phylogenetic tree and multiple sequence alignment of HMGR proteins. (A) Phylogenetic tree of PsHMGR1 and HMGR protein from other 37 plant species, using the IQ-TREE of TBtools V2.136 software. Bootstrap values are shown as a percentage of 5000 replicates. PsHMGR1 is marked with a green dot. Clades of various species are highlighted with different color lines. Dt, Dillenia turbinata; Tw, Tripterygium wilfordii; Rc, Ricinus communis; Pt, Populus trichocarpa; Nn, Nelumbo nucifera; Pe, Populus euphratica; Mi, Mangifera indica; Pa, Populus alba; Pv, Pistacia vera; Jc, Jatropha curcas; Ca, Chlorokybus atmophyticus; Mv, Mesostigma viride; Pp, Physcomitrella patens; Mp, Marchantia polymorpha; As, Alsophila spinulosa; Cr, Ceratopteris richardii; Ac, Adiantum capillus; Pta, Pinus tabuliformis; Gb, Ginkgo biloba; Atr, Amborella trichopoda; Os, Oryza sativa; Zm, Zea mays; Oe, Olea europaea; Vv, Vitis vinifera; At, Arabidopsis thaliana; Hs, Homo sapiens; Rn, Rattus norvegicus; Da, Drosophila albomicans; Sc, Saccharomyces cerevisiae; Gl, Ganoderma lucidum; Lh, Lachnellula hyalina; Zg, Zobellia galactanivorans; Sm, Streptomyces malaysiensis; Bl, Brevibacterium linens. (B) Alignment and analysis of PsHMGR1 with HMGR protein sequences of D. turbinata, P. trichocarpa, and T. wilfordii. Motif I, E(M/L)P(V/I)GY(V/I)Q(I/L)P; motif II, TTEGCLVA; motif III, DAMGMNM; motif IV, GTVGGGT. Accession information of HMGR proteins of other 37 plant species is detailed in Supplemental Table S1.
Ijms 25 12247 g003
Figure 4. The electrophoresis map of the PsTPS1 gene and PsTPS1 protein characterization. (A) Electrophoresis map of PsTPS1 gene. M, marker. (B) Secondary structure prediction, (C) 3D model building, (D) transmembrane helices prediction, (E) hydrophobicity or hydrophilicity analysis, (F) signal peptide analysis, and (G) conserved domains analysis of PsTPS1 protein.
Figure 4. The electrophoresis map of the PsTPS1 gene and PsTPS1 protein characterization. (A) Electrophoresis map of PsTPS1 gene. M, marker. (B) Secondary structure prediction, (C) 3D model building, (D) transmembrane helices prediction, (E) hydrophobicity or hydrophilicity analysis, (F) signal peptide analysis, and (G) conserved domains analysis of PsTPS1 protein.
Ijms 25 12247 g004
Figure 5. Phylogenetic tree and multiple sequence alignment of TPS proteins. (A) Phylogenetic tree of PsTPS1 and TPS proteins from other 12 plant species using the NJ method by MEGA X software V10.2.6. Bootstrap values are shown as a percentage of 1000 replicates. PsTPS1 is marked with a green dot. Clades of TPS-a, TPS-b, TPS-c, TPS-d, TPS-e/f, and TPS-g are highlighted with different color lines. At, Arabidopsis thaliana; Sl, Solanum lycopersicum; Mt, Medicago truncatula; Ag, Abies grandis; Lf, Liquidambar formosana; Ma, Melia azedarach; Pa, Populus alba; Pd, Paeonia delavayi; Pl, Paeonia lactiflora; Vr, Vitis riparia; Vv, Vitis vinifera; Rh, Rosa hybrida. (B) Alignment and analysis of PsTPS1 with TPS protein sequences of P. delavayi, P. lactiflora, and L. formosana. Motif I, R(R,P,Q)(X)8W; motif II, DDXXD; motif III, (N,D)DXX(S,T,G)XXXE (NSE/DTE). Accession information of TPS proteins of other 12 plant species is detailed in Supplemental Table S2.
Figure 5. Phylogenetic tree and multiple sequence alignment of TPS proteins. (A) Phylogenetic tree of PsTPS1 and TPS proteins from other 12 plant species using the NJ method by MEGA X software V10.2.6. Bootstrap values are shown as a percentage of 1000 replicates. PsTPS1 is marked with a green dot. Clades of TPS-a, TPS-b, TPS-c, TPS-d, TPS-e/f, and TPS-g are highlighted with different color lines. At, Arabidopsis thaliana; Sl, Solanum lycopersicum; Mt, Medicago truncatula; Ag, Abies grandis; Lf, Liquidambar formosana; Ma, Melia azedarach; Pa, Populus alba; Pd, Paeonia delavayi; Pl, Paeonia lactiflora; Vr, Vitis riparia; Vv, Vitis vinifera; Rh, Rosa hybrida. (B) Alignment and analysis of PsTPS1 with TPS protein sequences of P. delavayi, P. lactiflora, and L. formosana. Motif I, R(R,P,Q)(X)8W; motif II, DDXXD; motif III, (N,D)DXX(S,T,G)XXXE (NSE/DTE). Accession information of TPS proteins of other 12 plant species is detailed in Supplemental Table S2.
Ijms 25 12247 g005
Figure 6. The expression patterns of PsHMGR1 and PsTPS1 genes. (A) Relative expression levels of PsHMGR1 during four flower development stages. (B) Relative expression levels of PsHMGR1 in different organs and tissues. (C) Relative expression levels of PsTPS1 during four flower development stages. (D) Relative expression levels of PsTPS1 in different organs and tissues. Data are presented as mean ± SE, n = 3. Different lowercase letters indicate significant differences at p < 0.05 level.
Figure 6. The expression patterns of PsHMGR1 and PsTPS1 genes. (A) Relative expression levels of PsHMGR1 during four flower development stages. (B) Relative expression levels of PsHMGR1 in different organs and tissues. (C) Relative expression levels of PsTPS1 during four flower development stages. (D) Relative expression levels of PsTPS1 in different organs and tissues. Data are presented as mean ± SE, n = 3. Different lowercase letters indicate significant differences at p < 0.05 level.
Ijms 25 12247 g006
Figure 7. PsHMGR1 gene relative expression levels and volatile emission amounts in transgenic plants and control. (A) PCR detection of transgenic plants and wild type (WT) tobaccos. M, marker; WT, wild type; OE-PsHMGR1, PsHMGR1 transgenic tobacco lines. (B) The expression levels of PsHMGR1 in transgenic lines and WT determined by qRT-PCR. The 18S gene was used as the endogenous control. (C) The emission amounts of linalool in PsHMGR1 transgenic lines and WT. (D) The GC-MS detection of flower VOCs from PsHMGR1 transgenic plants and wild-type tobacco. * p < 0.05, ** p < 0.01.
Figure 7. PsHMGR1 gene relative expression levels and volatile emission amounts in transgenic plants and control. (A) PCR detection of transgenic plants and wild type (WT) tobaccos. M, marker; WT, wild type; OE-PsHMGR1, PsHMGR1 transgenic tobacco lines. (B) The expression levels of PsHMGR1 in transgenic lines and WT determined by qRT-PCR. The 18S gene was used as the endogenous control. (C) The emission amounts of linalool in PsHMGR1 transgenic lines and WT. (D) The GC-MS detection of flower VOCs from PsHMGR1 transgenic plants and wild-type tobacco. * p < 0.05, ** p < 0.01.
Ijms 25 12247 g007
Figure 8. PsTPS1 gene relative expression levels and volatile emission amounts in transgenic plants and control. (A) PCR detection of transgenic plants and wild-type tobaccos. M, marker; WT, wild type; OE-PsTPS1, PsTPS1 transgenic tobacco lines. (B) The expression levels of PsTPS1 in transgenic lines (OE-PsTPS1) and WT determined by qRT-PCR. (C,D) The emission amounts of linalool and germacrene D in PsTPS1 transgenic lines and WT. (E,F) The GC-MS detection of flower VOCs from PsTPS1 transgenic plants and wild-type tobacco. ** p < 0.01, *** p < 0.001, NS: non-significant.
Figure 8. PsTPS1 gene relative expression levels and volatile emission amounts in transgenic plants and control. (A) PCR detection of transgenic plants and wild-type tobaccos. M, marker; WT, wild type; OE-PsTPS1, PsTPS1 transgenic tobacco lines. (B) The expression levels of PsTPS1 in transgenic lines (OE-PsTPS1) and WT determined by qRT-PCR. (C,D) The emission amounts of linalool and germacrene D in PsTPS1 transgenic lines and WT. (E,F) The GC-MS detection of flower VOCs from PsTPS1 transgenic plants and wild-type tobacco. ** p < 0.01, *** p < 0.001, NS: non-significant.
Ijms 25 12247 g008
Table 1. Primers used in the experiments.
Table 1. Primers used in the experiments.
Primer NamePrimer Sequence (5′-3′)Utilization
PsHMGR-FATGGACGTTCGCCGACGACCAGene cloning
PsHMGR-RTTAAGAAGCAACTTTGGATACG
PsTPS1-FATGTCTACTGAAGCTTCC
PsTPS1-RTCATATTGCAATATGATCAAC
qPsHMGR-FCGTCAAAGTGAAGCGAGTAATGqRT-PCR
qPsHMGR-RAAATGCAGGCAGGTTCGTTC
qPsTPS1-FTGGGCTCTCGGTTTTCTTCA
qPsTPS-1RTTCGCTTTAGGACTTCGGGT
18S-FCGCTCTGGATACATTAGCATGG
18S-RCGTTGGATGAAGAACCCCCA
Actin-FCGGTGTCTGGATTGGAGGGTCA
Actin-RTTCGCTTTAGGACTTCGGGT
pCAMBIA1301-PsHMGR-FTATGACCATGATTACGAATTCATGGACGTTCGCCGACGVector construction
pCAMBIA1301-PsHMGR-RTGCCTGCAGGTCGACTCTAGAAGAAGCAACTTTGGATACGTCTTTG
pCAMBIA1301-PsTPS1-FGGAATTCCATGTCTACTGAAGCTTCC
pCAMBIA1301-PsTPS1-RCGGGATCCCGTCATATTGCAATATGATCAAC
hyg(501)-FGAGCATATACGCCCGGAGTCPositive PCR testing
hyg(501)-RCAAGACCTGCCTGAAACCGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ma, B.; Li, Z.-Y.; Li, R.-C.; Xu, M.-C.; Wang, Z.-Q.; Leng, P.-S.; Hu, Z.-H.; Wu, J. Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony. Int. J. Mol. Sci. 2024, 25, 12247. https://doi.org/10.3390/ijms252212247

AMA Style

Ma B, Li Z-Y, Li R-C, Xu M-C, Wang Z-Q, Leng P-S, Hu Z-H, Wu J. Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony. International Journal of Molecular Sciences. 2024; 25(22):12247. https://doi.org/10.3390/ijms252212247

Chicago/Turabian Style

Ma, Bo, Zi-Yao Li, Rong-Chen Li, Mei-Chen Xu, Zhen-Quan Wang, Ping-Sheng Leng, Zeng-Hui Hu, and Jing Wu. 2024. "Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony" International Journal of Molecular Sciences 25, no. 22: 12247. https://doi.org/10.3390/ijms252212247

APA Style

Ma, B., Li, Z.-Y., Li, R.-C., Xu, M.-C., Wang, Z.-Q., Leng, P.-S., Hu, Z.-H., & Wu, J. (2024). Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony. International Journal of Molecular Sciences, 25(22), 12247. https://doi.org/10.3390/ijms252212247

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop