Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony
Abstract
1. Introduction
2. Results
2.1. Cloning and Bioinformatics Analysis of PsHMGR1
2.2. Phylogenetic Tree and Multiple Sequence Alignment Analysis of PsHMGR1
2.3. Cloning and Bioinformatics Analysis of PsTPS1
2.4. Phylogenetic Tree and Multiple Sequence Alignment Analysis of PsTPS1
2.5. PsHMGR1 and PsTPS1 Genes Show Different Expression Patterns in Flower Development Stages and Different Tissues
2.6. Overexpression of PsHMGR1 and PsTPS1 in Tobacco Affects the Accumulation of Terpenoids
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. RNA Extraction, cDNA Synthesis, and Expression Analyses (qRT-PCR)
4.3. Gene Cloning and Sequence Analysis
4.4. Phylogenetic Trees Construction and Multiple Sequence Alignment
4.5. Overexpression PsHMGR1 and PsTPS1 in Tobacco and qRT-PCR Detection
4.6. Floral Scent Collection, Determination and Analysis
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ma, B.; Wu, J.; Zou, J.R.; Wang, J.X.; Hu, Z.H.; Jia, L.M.; Leng, P.S. Genome-wide identification and functional characterization of trans-IDS genes give new insights into terpene biosynthesis in Syringa oblata. Ind. Crops Prod. 2024, 213, 118413. [Google Scholar] [CrossRef]
- Pichersky, E. Biochemistry and genetics of floral scent: A historical perspective. Plant J. 2023, 115, 18–36. [Google Scholar] [CrossRef] [PubMed]
- Loreto, F.; D’Auria, S. How do plants sense volatiles sent by other plants? Trends Plant Sci. 2022, 27, 29–38. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Zou, J.; Wang, J.; Ma, B.; Meng, X.; Hu, Z.; Leng, P. Identification of floral components and functional analysis of key TPS genes in Syringa oblata. J. Plant Genet. Resour. 2024, 25, 824–833. [Google Scholar]
- Du, Z.; Jin, Y.; Wang, W.; Xia, K.; Chen, Z. Molecular and metabolic insights into floral scent biosynthesis during flowering in Dendrobium chrysotoxum. Front. Plant Sci. 2022, 13, 1030492. [Google Scholar] [CrossRef]
- Zhou, T.; Han, W.; Ning, K.; Zhou, Y.; Zhang, D.; El-Kassaby, Y.A.; Chong, X.; Zhang, F.; Chen, F.; Chen, H. Spatial and temporal dynamics of carnation-scented flowers in Lagerstroemia ‘Ning Xiang 3’. Ind. Crops Prod. 2024, 208, 117864. [Google Scholar] [CrossRef]
- Shi, S.; Zhang, Z. Genetic and biochemical aspects of floral scents in roses. Int. J. Mol. Sci. 2022, 23, 8014. [Google Scholar] [CrossRef]
- Bao, T.; Kimani, S.; Li, Y.; Li, H.; Yang, S.; Zhang, J.; Wang, Q.; Wang, Z.; Ning, G.; Wang, L.; et al. Allelic variation of terpene synthases drives terpene diversity in the wild species of the Freesia genus. Plant Physiol. 2023, 192, 2419–2435. [Google Scholar] [CrossRef]
- Li, H.; Fan, Y. Research progress on the main components, metabolic pathways and key functional genes of floral terpenes. Mol. Plant Breed. 2024, 1–17. [Google Scholar]
- Yang, Y.Y.; Ma, B.; Li, Y.Y.; Han, M.Z.; Wu, J.; Zhou, X.F.; Tian, J.; Wang, W.H.; Leng, P.S.; Hu, Z.H. Transcriptome analysis identifies key gene LiMYB305 involved in monoterpene biosynthesis in Lilium ‘Siberia’. Front. Plant Sci. 2022, 13, 1021576. [Google Scholar] [CrossRef]
- Dudareva, N.; Klempien, A.; Muhlemann, J.K.; Kaplan, I. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytol. 2013, 198, 16–32. [Google Scholar] [CrossRef] [PubMed]
- Mostafa, S.; Wang, Y.; Zeng, W.; Jin, B. Floral scents and fruit aromas: Functions, compositions, biosynthesis, and regulation. Front. Plant Sci. 2022, 13, 860157. [Google Scholar] [CrossRef] [PubMed]
- Muhlemann, J.K.; Klempien, A.; Dudareva, N. Floral volatiles: From biosynthesis to function. Plant Cell Environ. 2014, 37, 1936–1949. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhang, Y.; Chen, M.; Han, X.; Yang, L. Research progress on the synthesis and regulation mechanism of Lilium fragrance substances. J. Plant Genet. Resour. 2024, 25, 718–726. [Google Scholar]
- Zhang, W.; Ma, X.; Chen, S.; Chen, F.; Jiang, Y. Diversity of floral volatiles in cut chrysanthemum with different flower types and diameters. J. Nanjing Agric. Univ. 2022, 45, 675–683. [Google Scholar]
- Song, S.Y.; Ahn, M.S.; Mekapogu, M.; Jung, J.A.; Song, H.Y.; Lim, S.H.; Jin, J.S.; Kwon, O.K. Analysis of floral scent and volatile profiles of different aster species by e-nose and HS-SPME-GC-MS. Metabolites 2023, 13, 503. [Google Scholar] [CrossRef]
- Chen, J.; Zhu, X.; Zheng, R.; Tong, Y.; Peng, Y.; Xie, K.; Su, Q.; Huang, R.; Zhan, S.; Shen, M.; et al. Orchestrating of native Phalaenopsis flower scents lighted the way through artificial selective breeding partiality in the current resource utilization. Ind. Crops Prod. 2024, 217, 118850. [Google Scholar] [CrossRef]
- Gao, F.; Liu, B.; Li, M.; Gao, X.; Fang, Q.; Liu, C.; Ding, H.; Wang, L.; Gao, X. Identification and characterization of terpene synthase genes accounting for volatile terpene emissions in flowers of Freesia x hybrida. J. Exp. Bot. 2018, 69, 4249–4265. [Google Scholar] [CrossRef]
- Han, Y.; Lu, M.; Yue, S.; Li, K.; Dong, M.; Liu, L.; Wang, H.; Shang, F. Comparative methylomics and chromatin accessibility analysis in Osmanthus fragrans uncovers regulation of genic transcription and mechanisms of key floral scent production. Hortic. Res. 2022, 9, uhac096. [Google Scholar] [CrossRef]
- Han, Y.; Wang, H.; Wang, X.; Li, K.; Dong, M.; Li, Y.; Zhu, Q.; Shang, F. Mechanism of floral scent production in Osmanthus fragrans and the production and regulation of its key floral constituents, beta-ionone and linalool. Hortic. Res. 2019, 6, 106. [Google Scholar] [CrossRef]
- Picazo-Aragones, J.; Terrab, A.; Balao, F. Plant volatile organic compounds evolution: Transcriptional regulation, epigenetics and polyploidy. Int. J. Mol. Sci. 2020, 21, 8956. [Google Scholar] [CrossRef] [PubMed]
- Pazouki, L.; Niinemets, U. Multi-substrate terpene synthases: Their cccurrence and physiological significance. Front. Plant Sci. 2016, 7, 1019. [Google Scholar] [CrossRef] [PubMed]
- Chu, W.; Liu, Y.; Li, Y.; Chu, X. Advances on plant 3-hydroxy-3-methylglutaryl Coenzyme A reductase (HMGR) genes. Curr. Biotechnol. 2018, 8, 93–102. [Google Scholar]
- Wang, X.; Wang, C.; Yang, M.; Jie, W.; Fazal, A.; Fu, J.; Yin, T.; Cai, J.; Liu, B.; Lu, G.; et al. Genome-wide comparison and functional characterization of HMGR gene family associated with shikonin biosynthesis in Lithospermum erythrorhizon. Int. J. Mol. Sci. 2023, 24, 12532. [Google Scholar] [CrossRef] [PubMed]
- Zheng, T.; Wei, L.; Cheng, J.; Xiang, J.; Jiang, W. Research progress of 3-hydroxy-3-methylglutaryl-CoA reductase in plants. Plant Physiol. J. 2022, 58, 1037–1044. [Google Scholar]
- Lin, S.-n.; Xu, Y.-q.; Chen, G.-s. Cloning and heterologous expression analysis of HMGR gene, a key enzyme gene for terpenoid synthesis of Pseudostellaria heterophylla. J. Chin. Med. Mater. 2024, 47, 1612–1618. [Google Scholar]
- Kalita, R.; Patar, L.; Shasany, A.K.; Modi, M.K.; Sen, P. Molecular cloning, characterization and expression analysis of 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Centella asiatica L. Mol. Biol. Rep. 2015, 42, 1431–1439. [Google Scholar] [CrossRef]
- Sando, T.; Takaoka, C.; Mukai, Y.; Yamashita, A.; Hattori, M.; Ogasawara, N.; Fukusaki, E.; Kobayashi, A. Cloning and characterization of mevalonate pathway genes in a natural rubber producing plant, Hevea brasiliensis. Biosci. Biotechnol. Biochem. 2008, 72, 2049–2060. [Google Scholar] [CrossRef]
- Kim, Y.J.; Lee, O.R.; Oh, J.Y.; Jang, M.G.; Yang, D.C. Functional analysis of 3-hydroxy-3-methylglutaryl coenzyme a reductase encoding genes in triterpene saponin-producing ginseng. Plant Physiol. 2014, 165, 373–387. [Google Scholar] [CrossRef]
- Kalita, R.; Modi, M.K.; Sen, P. RNAi mediated silencing of 3-hydroxy-3-methylglutaryl-CoA reductases (HMGR) in Centella asiatica. Gene Rep. 2018, 11, 52–57. [Google Scholar] [CrossRef]
- Zheng, T.; Guan, L.; Yu, K.; Haider, M.S.; Nasim, M.; Liu, Z.; Li, T.; Zhang, K.; Jiu, S.; Jia, H.; et al. Expressional diversity of grapevine 3-Hydroxy-3-methylglutaryl-CoA reductase (VvHMGR) in different grapes genotypes. BMC Plant Biol. 2021, 21, 279. [Google Scholar] [CrossRef] [PubMed]
- Movahedi, A.; Wei, H.; Pucker, B.; Ghaderi-Zefrehei, M.; Rasouli, F.; Kiani-Pouya, A.; Jiang, T.; Zhuge, Q.; Yang, L.; Zhou, X. Isoprenoid biosynthesis regulation in poplars by methylerythritol phosphate and mevalonic acid pathways. Front. Plant Sci. 2022, 13, 968780. [Google Scholar] [CrossRef] [PubMed]
- Alam, P.; Kamaluddin; Khan, M.A.; Mohammad, A.; Khan, R.; Abdin, M.Z. Enhanced artemisinin accumulation and metabolic profiling of transgenic Artemisia annua L. plants over-expressing by rate-limiting enzymes from isoprenoid pathway. J. Plant Interact. 2014, 9, 655–665. [Google Scholar] [CrossRef]
- Gutensohn, M.; Henry, L.K.; Gentry, S.A.; Lynch, J.H.; Nguyen, T.T.H.; Pichersky, E.; Dudareva, N. Overcoming bottlenecks for metabolic engineering of sesquiterpene production in tomato fruits. Front. Plant Sci. 2021, 12, 691754. [Google Scholar] [CrossRef] [PubMed]
- Bao, T.; Shadrack, K.; Yang, S.; Xue, X.; Li, S.; Wang, N.; Wang, Q.; Wang, L.; Gao, X.; Cronk, Q. Functional characterization of terpene aynthases accounting for the volatilized-terpene heterogeneity in Lathyrus odoratus cultivar flowers. Plant Cell Physiol. 2020, 61, 1733–1749. [Google Scholar] [CrossRef]
- Li, Y.; Gao, R.; Zhang, J.; Wang, Y.; Kong, P.; Lu, K.; Adnan; Liu, M.; Ao, F.; Zhao, C.; et al. The biochemical and molecular investigation of flower color and scent sheds lights on further genetic modification of ornamental traits in Clivia miniata. Hortic. Res. 2022, 9, uhac114. [Google Scholar] [CrossRef]
- Tholl, D.; Lee, S. Terpene specialized metabolism in Arabidopsis thaliana. Arab. Book 2011, 9, e0143. [Google Scholar] [CrossRef]
- Zhou, F.; Pichersky, E. The complete functional characterisation of the terpene synthase family in tomato. New Phytol. 2020, 226, 1341–1360. [Google Scholar] [CrossRef]
- Zhang, T.; Guo, Y.; Shi, X.; Yang, Y.; Chen, J.; Zhang, Q.; Sun, M. Overexpression of LiTPS2 from a cultivar of lily (Lilium ‘Siberia’) enhances the monoterpenoids content in tobacco flowers. Plant Physiol. Biochem. 2020, 151, 391–399. [Google Scholar] [CrossRef]
- Wang, Q.-Q.; Zhu, M.-J.; Yu, X.; Bi, Y.-Y.; Zhou, Z.; Chen, M.-K.; Chen, J.; Zhang, D.; Ai, Y.; Liu, Z.-J.; et al. Genome-wide identification and expression analysis of terpene aynthase genes in Cymbidium faberi. Front. Plant Sci. 2021, 12, 751853. [Google Scholar] [CrossRef]
- Zhang, W.; Jiang, Y.; Chen, F.; Guan, Z.; Wei, G.; Chen, X.; Zhang, C.; Kollner, T.G.; Chen, S.; Chen, F.; et al. Dynamic regulation of volatile terpenoid production and emission from Chrysanthemum morifolium capitula. Plant Physiol. Biochem. 2022, 182, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Li, Z.; Leng, P.; Hu, Z.; Wu, J.; Dou, D. Transcriptome sequencing reveals terpene biosynthesis pathway genes accounting for volatile terpene of tree peony. Planta 2021, 254, 67. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, H.; Fu, Z.; Feng, N.; Wang, H.; Li, Y.; Erqiang, W. Research progress on flower fragrance breeding of peony. Mol. Plant Breed. 2023, 21, 3998–4005. [Google Scholar]
- Li, S.; Chen, L.; Xu, Y.; Wang, L.; Wang, L. Identification of floral fragrances in tree peony cultivars by gas chromatography–mass spectrometry. Sci. Hortic. 2012, 142, 158–165. [Google Scholar] [CrossRef]
- Song, C.; Ma, H.; Li, R.; Zhao, G.; Niu, T.; Guo, L.; Hou, X. Analysis of the emitted pattern of floral volatiles and cloning and functional analysis of the PsuLIS gene in tree peony cultivar ‘High Noon’. Sci. Hortic. 2024, 326, 112750. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, X.; Li, K.; Wang, P.; Li, C.; Song, X. Integrative analysis of transcriptomic and volatile compound profiles sheds new insights into the terpenoid biosynthesis in tree peony. Ind. Crops Prod. 2022, 188, 115672. [Google Scholar] [CrossRef]
- Li, D.; Zhang, L.; Zhao, M.; Wang, X. Analysis of aroma components in peony flower by GC × GC-TOFMS. Henan Sci. 2022, 40, 1592–1601. [Google Scholar]
- Xu, H.; Yao, X.; Tong, K.; Xing, Z.; Li, Y. Analysis of volatile components in different parts of flower organs of three species of tree peony. J. Nanjing For. Univ. 2023, 47, 63–69. [Google Scholar]
- Ding, X.-w.; Wang, Z.-z.; Wang, Q.-g.; Hong-ying, J.; Min, C.; Li, S.-f. Analysis of floral volatile components of in Paeonia delavayi with differrent colors. Southern Hortic. 2022, 33, 25–30. [Google Scholar]
- Zhang, Y.; Li, C.; Wang, S.; Yuan, M.; Li, B.; Niu, L.; Shi, Q. Transcriptome and volatile compounds profiling analyses provide insights into the molecular mechanism underlying the floral fragrance of tree peony. Ind. Crops Prod. 2021, 162, 113286. [Google Scholar] [CrossRef]
- Zhao, M.; Zhang, L.; Wang, C.; Guan, B.; Li, B.; Wang, J.; Wang, Y. Analysis of volatile components in three peony petals by HS-SPME-GC/MS. Sci. Technol. Food Ind. 2021, 42, 294–302. [Google Scholar]
- Li, S.; Zhang, L.; Sun, M.; Lv, M.; Yang, Y.; Xu, W.; Wang, L. Biogenesis of flavor-related linalool is diverged and genetically conserved in tree peony (Paeonia x suffruticosa). Hortic. Res. 2023, 10, uhac253. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Song, C.; Niu, T.; Wei, Z.; Guo, L.; Hou, X. The emitted pattern analysis of flower volatiles and cloning of PsGDS gene in tree peony cultivar ‘High Noon’. Acta Hortic. Sinica 2023, 50, 331–344. [Google Scholar]
- Zhao, N.; Yuan, X.; Chen, Z.; Yang, Y.; Wang, J.; Wang, Y. Cloning and functional analysis of 1-deoxy-D-xylulose-5-phosphate synthase gene in Paeonia delavayi. Genomics Appl. Biol. 2017, 36, 2919–2925. [Google Scholar]
- Li, R.; Li, Z.; Bai, R.; Jing, W.; Dou, D. Cloning and expression analysis of gene PsDXS in tree peony (Paeonia suffruticosa Andr.). Mol. Plant Breed. 2021, 19, 2177–2184. [Google Scholar]
- Li, Z.-Y.; Liu, B.; Hu, Z.-H.; Wu, J.; Leng, P.-S. Cloning, expression analysis and subcellular localization of PsDXR and PsMCS genes in tree peony (Paeonia suffruticosa). J. Agric. Biotechnol. 2023, 31, 730–740. [Google Scholar]
- Wang, P.; Li, Z.; Bai, Y.; Yang, P.; Yin, C.; Li, C.; Zhang, X.; Song, X. Cloning and functional verification of linalool synthase gene PsTPS14 in tree peony ‘High Noon’. Acta Hortic. Sinica 2024, 51, 1273–1283. [Google Scholar]
- Yu, Y.; Lyu, S.; Chen, D.; Lin, Y.; Chen, J.; Chen, G.; Ye, N. Volatiles emitted at different flowering stages of Jasminum sambac and expression of genes related to alpha-farnesene biosynthesis. Molecules 2017, 22, 546. [Google Scholar] [CrossRef]
- Ram, M.; Khan, M.A.; Jha, P.; Khan, S.; Kiran, U.; Ahmad, M.M.; Javed, S.; Abdin, M.Z. HMG-CoA reductase limits artemisinin biosynthesis and accumulation in Artemisia annua L. plants. Acta Physiol. Plant. 2010, 32, 859–866. [Google Scholar] [CrossRef]
- Nafis, T.; Akmal, M.; Ram, M.; Alam, P.; Ahlawat, S.; Mohd, A.; Abdin, M.Z. Enhancement of artemisinin content by constitutive expression of the HMG-CoA reductase gene in high-yielding strain of Artemisia annua L. Plant Biotechnol. Rep. 2010, 5, 53–60. [Google Scholar] [CrossRef]
- Li, H.; Li, Y.; Yan, H.; Bao, T.; Shan, X.; Caissard, J.C.; Zhang, L.; Fang, H.; Bai, X.; Zhang, J.; et al. The complexity of volatile terpene biosynthesis in roses: Particular insights into beta-citronellol production. Plant Physiol. 2024, 196, 1908–1922. [Google Scholar] [CrossRef] [PubMed]
- Qiao, D.; Tang, M.; Jin, L.; Mi, X.; Chen, H.; Zhu, J.; Liu, S.; Wei, C. A monoterpene synthase gene cluster of tea plant (Camellia sinensis) potentially involved in constitutive and herbivore-induced terpene formation. Plant Physiol. Biochem. 2022, 184, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “One for All, All for One” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
- Chandra, M.; Kushwaha, S.; Mishra, B.; Sangwan, N. Molecular and structural insights for the regulation of terpenoids in Ocimum basilicum and Ocimum tenuiflorum. Plant Growth Regul. 2022, 97, 61–75. [Google Scholar] [CrossRef]








| Primer Name | Primer Sequence (5′-3′) | Utilization |
|---|---|---|
| PsHMGR-F | ATGGACGTTCGCCGACGACCA | Gene cloning |
| PsHMGR-R | TTAAGAAGCAACTTTGGATACG | |
| PsTPS1-F | ATGTCTACTGAAGCTTCC | |
| PsTPS1-R | TCATATTGCAATATGATCAAC | |
| qPsHMGR-F | CGTCAAAGTGAAGCGAGTAATG | qRT-PCR |
| qPsHMGR-R | AAATGCAGGCAGGTTCGTTC | |
| qPsTPS1-F | TGGGCTCTCGGTTTTCTTCA | |
| qPsTPS-1R | TTCGCTTTAGGACTTCGGGT | |
| 18S-F | CGCTCTGGATACATTAGCATGG | |
| 18S-R | CGTTGGATGAAGAACCCCCA | |
| Actin-F | CGGTGTCTGGATTGGAGGGTCA | |
| Actin-R | TTCGCTTTAGGACTTCGGGT | |
| pCAMBIA1301-PsHMGR-F | TATGACCATGATTACGAATTCATGGACGTTCGCCGACG | Vector construction |
| pCAMBIA1301-PsHMGR-R | TGCCTGCAGGTCGACTCTAGAAGAAGCAACTTTGGATACGTCTTTG | |
| pCAMBIA1301-PsTPS1-F | GGAATTCCATGTCTACTGAAGCTTCC | |
| pCAMBIA1301-PsTPS1-R | CGGGATCCCGTCATATTGCAATATGATCAAC | |
| hyg(501)-F | GAGCATATACGCCCGGAGTC | Positive PCR testing |
| hyg(501)-R | CAAGACCTGCCTGAAACCGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, B.; Li, Z.-Y.; Li, R.-C.; Xu, M.-C.; Wang, Z.-Q.; Leng, P.-S.; Hu, Z.-H.; Wu, J. Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony. Int. J. Mol. Sci. 2024, 25, 12247. https://doi.org/10.3390/ijms252212247
Ma B, Li Z-Y, Li R-C, Xu M-C, Wang Z-Q, Leng P-S, Hu Z-H, Wu J. Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony. International Journal of Molecular Sciences. 2024; 25(22):12247. https://doi.org/10.3390/ijms252212247
Chicago/Turabian StyleMa, Bo, Zi-Yao Li, Rong-Chen Li, Mei-Chen Xu, Zhen-Quan Wang, Ping-Sheng Leng, Zeng-Hui Hu, and Jing Wu. 2024. "Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony" International Journal of Molecular Sciences 25, no. 22: 12247. https://doi.org/10.3390/ijms252212247
APA StyleMa, B., Li, Z.-Y., Li, R.-C., Xu, M.-C., Wang, Z.-Q., Leng, P.-S., Hu, Z.-H., & Wu, J. (2024). Functional Analysis of PsHMGR1 and PsTPS1 Related to Floral Terpenoids Biosynthesis in Tree Peony. International Journal of Molecular Sciences, 25(22), 12247. https://doi.org/10.3390/ijms252212247

