Recent Advances in miRNA-Based Therapy for MASLD/MASH and MASH-Associated HCC
Simple Summary
Abstract
1. Introduction
2. Role of miRNAs in the Pathophysiology of MASLD/MASH and HCC Progression
3. miRNA-Based Therapy in Preclinical and Clinical Development for MASLD/MASH
3.1. microRNA-10b-5p
3.2. microRNA-132-3p
3.3. microRNA-22
3.4. microRNA-103a-3p and microRNA-107
4. Formulation Strategies to Improve miRNA-Based Therapies
5. Challenges and Limitations of miRNA-Based Therapies
6. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Ludwig, J.; Viggiano, T.R.; McGill, D.B.; Oh, B.J. Nonalcoholic Steatohepatitis: Mayo Clinic Experiences with a Hitherto Unnamed Disease. Mayo Clin. Proc. 1980, 55, 434–438. [Google Scholar] [CrossRef] [PubMed]
- Rinella, M.E.; Lazarus, J.V.; Ratziu, V.; Francque, S.M.; Sanyal, A.J.; Kanwal, F.; Romero, D.; Abdelmalek, M.F.; Anstee, Q.M.; Arab, J.P.; et al. A Multi-Society Delphi Consensus Statement on New Fatty Liver Disease Nomenclature. J. Hepatol. 2023, 78, 1966–1986. [Google Scholar] [CrossRef] [PubMed]
- Tincopa, M.A.; Anstee, Q.M.; Loomba, R. New and Emerging Treatments for Metabolic Dysfunction-Associated Steatohepatitis. Cell Metab. 2024, 36, 912–926. [Google Scholar] [CrossRef] [PubMed]
- Francque, S.; Krag, A.; Shawcross, D.L.; Zelber-Sagi, S. A Turning Point in Hepatology? EASL Reflects on the First Approved Drug for MASH. J. Hepatol. 2024, 81, 192–194. [Google Scholar] [CrossRef] [PubMed]
- Gjorgjieva, M.; Sobolewski, C.; Dolicka, D.; Correia de Sousa, M.; Foti, M. miRNAs and NAFLD: From Pathophysiology to Therapy. Gut 2019, 68, 2065–2079. [Google Scholar] [CrossRef]
- Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial Sequencing and Analysis of the Human Genome. Nature 2001, 409, 860–921. [Google Scholar] [CrossRef]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. Elegans Heterochronic Gene Lin-4 Encodes Small RNAs with Antisense Complementarity to Lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef]
- Ghildiyal, M.; Zamore, P.D. Small Silencing RNAs: An Expanding Universe. Nat. Rev. Genet. 2009, 10, 94–108. [Google Scholar] [CrossRef]
- Mattick, J.S.; Makunin, I.V. Non-Coding RNA. Hum. Mol. Genet. 2006, 15, R17–R29. [Google Scholar] [CrossRef]
- Ha, M.; Kim, V.N. Regulation of microRNA Biogenesis. Nat. Rev. Mol. Cell Biol. 2014, 15, 509–524. [Google Scholar] [CrossRef]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA Sequences to Function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef] [PubMed]
- Mohr, R.; Özdirik, B.; Lambrecht, J.; Demir, M.; Eschrich, J.; Geisler, L.; Hellberg, T.; Loosen, S.H.; Luedde, T.; Tacke, F.; et al. From Liver Cirrhosis to Cancer: The Role of Micro-RNAs in Hepatocarcinogenesis. Int. J. Mol. Sci. 2021, 22, 1492. [Google Scholar] [CrossRef] [PubMed]
- Nemeth, K.; Bayraktar, R.; Ferracin, M.; Calin, G.A. Non-Coding RNAs in Disease: From Mechanisms to Therapeutics. Nat. Rev. Genet. 2024, 25, 211–232. [Google Scholar] [CrossRef] [PubMed]
- Beitzinger, M.; Meister, G. MicroRNAs: From Decay to Decoy. Cell 2010, 140, 612–614. [Google Scholar] [CrossRef][Green Version]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef]
- Chrysavgis, L.; Cholongitas, E. From NAFLD to MASLD: What Does It Mean? Exp. Rev. Gastroenterol. Hepatol. 2024, 18, 217–221. [Google Scholar] [CrossRef]
- Cotter, T.G.; Rinella, M. Nonalcoholic Fatty Liver Disease 2020: The State of the Disease. Gastroenterology 2020, 158, 1851–1864. [Google Scholar] [CrossRef]
- Miao, L.; Targher, G.; Byrne, C.D.; Cao, Y.-Y.; Zheng, M.-H. Current Status and Future Trends of the Global Burden of MASLD. Trends Endocrinol. Metab. 2024, 35, 697–707. [Google Scholar] [CrossRef]
- Gabbia, D.; Cannella, L.; De Martin, S. The Role of Oxidative Stress in NAFLD–NASH–HCC Transition—Focus on NADPH Oxidases. Biomedicines 2021, 9, 687. [Google Scholar] [CrossRef]
- Gabbia, D.; De Martin, S. Targeting the Adipose Tissue–Liver–Gut Microbiota Crosstalk to Cure MASLD. Biology 2023, 12, 1471. [Google Scholar] [CrossRef]
- Fraile, J.M.; Palliyil, S.; Barelle, C.; Porter, A.J.; Kovaleva, M. Non-Alcoholic Steatohepatitis (NASH)—A Review of a Crowded Clinical Landscape, Driven by a Complex Disease. Drug Des. Dev. Ther. 2021, 15, 3997–4009. [Google Scholar] [CrossRef] [PubMed]
- Longo, M.; Paolini, E.; Meroni, M.; Dongiovanni, P. Remodeling of Mitochondrial Plasticity: The Key Switch from NAFLD/NASH to HCC. Int. J. Mol. Sci. 2021, 22, 4173. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global Burden of NAFLD and NASH: Trends, Predictions, Risk Factors and Prevention. Nat. Rev. Gastroenterol. Hepatol. 2017, 15, 11. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.; Stepanova, M.; Ong, J.P.; Jacobson, I.M.; Bugianesi, E.; Duseja, A.; Eguchi, Y.; Wong, V.W.; Negro, F.; Yilmaz, Y.; et al. Nonalcoholic Steatohepatitis Is the Fastest Growing Cause of Hepatocellular Carcinoma in Liver Transplant Candidates. Clin. Gastroenterol. Hepatol. 2019, 17, 748–755.e3. [Google Scholar] [CrossRef] [PubMed]
- Ramai, D.; Tai, W.; Rivera, M.; Facciorusso, A.; Tartaglia, N.; Pacilli, M.; Ambrosi, A.; Cotsoglou, C.; Sacco, R. Natural Progression of Non-Alcoholic Steatohepatitis to Hepatocellular Carcinoma. Biomedicines 2021, 9, 184. [Google Scholar] [CrossRef]
- Anstee, Q.M.; Reeves, H.L.; Kotsiliti, E.; Govaere, O.; Heikenwalder, M. From NASH to HCC: Current Concepts and Future Challenges. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 411–428. [Google Scholar] [CrossRef]
- Castellana, M.; Donghia, R.; Lampignano, L.; Castellana, F.; Zupo, R.; Sardone, R.; Pergola, G.D.; Giannelli, G. Prevalence of the Absence of Cirrhosis in Subjects with NAFLD-Associated Hepatocellular Carcinoma. J. Clin. Med. 2021, 10, 4638. [Google Scholar] [CrossRef]
- Baffy, G.; Brunt, E.M.; Caldwell, S.H. Hepatocellular Carcinoma in Non-Alcoholic Fatty Liver Disease: An Emerging Menace. J. Hepatol. 2012, 56, 1384–1391. [Google Scholar] [CrossRef]
- Zhang, C.; Wang, P.; Li, Y.; Huang, C.; Ni, W.; Chen, Y.; Shi, J.; Chen, G.; Hu, X.; Ye, M.; et al. Role of MicroRNAs in the Development of Hepatocellular Carcinoma in Nonalcoholic Fatty Liver Disease. Anat. Rec. 2019, 302, 193–200. [Google Scholar] [CrossRef]
- Mallela, V.R.; Rajtmajerová, M.; Trailin, A.; Liška, V.; Hemminki, K.; Ambrozkiewicz, F. miRNA and lncRNA as Potential Tissue Biomarkers in Hepatocellular Carcinoma. Noncoding RNA Res. 2024, 9, 24–32. [Google Scholar] [CrossRef]
- Sayed, G.I.; Solyman, M.; El Gedawy, G.; Moemen, Y.S.; Aboul-Ella, H.; Hassanien, A.E. Circulating miRNA’s Biomarkers for Early Detection of Hepatocellular Carcinoma in Egyptian Patients Based on Machine Learning Algorithms. Sci. Rep. 2024, 14, 4989. [Google Scholar] [CrossRef] [PubMed]
- Malik, J.; Klammer, M.; Rolny, V.; Chan, H.L.-Y.; Piratvisuth, T.; Tanwandee, T.; Thongsawat, S.; Sukeepaisarnjaroen, W.; Esteban, J.I.; Bes, M.; et al. Comprehensive Evaluation of microRNA as a Biomarker for the Diagnosis of Hepatocellular Carcinoma. WJ Gastroenterol. 2022, 28, 3917–3933. [Google Scholar] [CrossRef] [PubMed]
- Roy, B.; Ghose, S.; Biswas, S. Therapeutic Strategies for miRNA Delivery to Reduce Hepatocellular Carcinoma. Semin. Cell Dev. Biol. 2022, 124, 134–144. [Google Scholar] [CrossRef] [PubMed]
- de Conti, A.; Ortega, J.F.; Tryndyak, V.; Dreval, K.; Moreno, F.S.; Rusyn, I.; Beland, F.A.; Pogribny, I.P. MicroRNA Deregulation in Nonalcoholic Steatohepatitis-Associated Liver Carcinogenesis. Oncotarget 2017, 8, 88517–88528. [Google Scholar] [CrossRef]
- Hochreuter, M.Y.; Dall, M.; Treebak, J.T.; Barrès, R. MicroRNAs in Non-Alcoholic Fatty Liver Disease: Progress and Perspectives. Mol. Metabol. 2022, 65, 101581. [Google Scholar] [CrossRef]
- Clarke, J.D.; Sharapova, T.; Lake, A.D.; Blomme, E.; Maher, J.; Cherrington, N.J. Circulating microRNA 122 in the Methionine and Choline-Deficient Mouse Model of Non-Alcoholic Steatohepatitis. J. Appl. Toxicol. 2014, 34, 726–732. [Google Scholar] [CrossRef]
- Esau, C.; Davis, S.; Murray, S.F.; Yu, X.X.; Pandey, S.K.; Pear, M.; Watts, L.; Booten, S.L.; Graham, M.; McKay, R.; et al. miR-122 Regulation of Lipid Metabolism Revealed by in Vivo Antisense Targeting. Cell Metab. 2006, 3, 87–98. [Google Scholar] [CrossRef]
- Chai, C.; Rivkin, M.; Berkovits, L.; Simerzin, A.; Zorde-Khvalevsky, E.; Rosenberg, N.; Klein, S.; Yaish, D.; Durst, R.; Shpitzen, S.; et al. Metabolic Circuit Involving Free Fatty Acids, microRNA 122, and Triglyceride Synthesis in Liver and Muscle Tissues. Gastroenterology 2017, 153, 1404–1415. [Google Scholar] [CrossRef]
- Yamada, H.; Ohashi, K.; Suzuki, K.; Munetsuna, E.; Ando, Y.; Yamazaki, M.; Ishikawa, H.; Ichino, N.; Teradaira, R.; Hashimoto, S. Longitudinal Study of Circulating miR-122 in a Rat Model of Non-Alcoholic Fatty Liver Disease. Clin. Chim. Acta 2015, 446, 267–271. [Google Scholar] [CrossRef]
- Hu, Y.; Du, G.; Li, G.; Peng, X.; Zhang, Z.; Zhai, Y. The miR-122 Inhibition Alleviates Lipid Accumulation and Inflammation in NAFLD Cell Model. Arch. Physiol. Biochem. 2021, 127, 385–389. [Google Scholar] [CrossRef]
- Bandiera, S.; Pfeffer, S.; Baumert, T.F.; Zeisel, M.B. miR-122—A Key Factor and Therapeutic Target in Liver Disease. J. Hepatol. 2015, 62, 448–457. [Google Scholar] [CrossRef] [PubMed]
- Liu, A.M.; Xu, Z.; Shek, F.H.; Wong, K.-F.; Lee, N.P.; Poon, R.T.; Chen, J.; Luk, J.M. miR-122 Targets Pyruvate Kinase M2 and Affects Metabolism of Hepatocellular Carcinoma. PLoS ONE 2014, 9, e86872. [Google Scholar] [CrossRef] [PubMed]
- Tsai, W.-C.; Hsu, S.-D.; Hsu, C.-S.; Lai, T.-C.; Chen, S.-J.; Shen, R.; Huang, Y.; Chen, H.-C.; Lee, C.-H.; Tsai, T.-F.; et al. MicroRNA-122 Plays a Critical Role in Liver Homeostasis and Hepatocarcinogenesis. J. Clin. Investig. 2012, 122, 2884–2897. [Google Scholar] [CrossRef] [PubMed]
- Thibonnier, M.; Esau, C. Metabolic Benefits of MicroRNA-22 Inhibition. Nucleic Acid Ther. 2020, 30, 104–116. [Google Scholar] [CrossRef] [PubMed]
- Thibonnier, M.; Esau, C.; Ghosh, S.; Wargent, E.; Stocker, C. Metabolic and Energetic Benefits of microRNA-22 Inhibition. BMJ Open Diabetes Res. Care 2020, 8, e001478. [Google Scholar] [CrossRef]
- Thibonnier, M.; Ghosh, S. Strategy for Pre-Clinical Development of Active Targeting MicroRNA Oligonucleotide Therapeutics for Unmet Medical Needs. Int. J. Mol. Sci. 2023, 24, 7126. [Google Scholar] [CrossRef]
- Panella, R.; Petri, A.; Desai, B.N.; Fagoonee, S.; Cotton, C.A.; Nguyen, P.K.; Lundin, E.M.; Wagshal, A.; Wang, D.-Z.; Näär, A.M.; et al. MicroRNA-22 Is a Key Regulator of Lipid and Metabolic Homeostasis. Int. J. Mol. Sci. 2023, 24, 12870. [Google Scholar] [CrossRef]
- Gabbia, D.; Sayaf, K.; Zanotto, I.; Colognesi, M.; Frion-Herrera, Y.; Carrara, M.; Russo, F.P.; De Martin, S. Tyrosol Attenuates NASH Features by Reprogramming the Hepatic Immune Milieu. Eur. J. Pharmacol. 2024, 969, 176453. [Google Scholar] [CrossRef]
- Yang, Z.; Qin, W.; Huo, J.; Zhuo, Q.; Wang, J.; Wang, L. MiR-22 Modulates the Expression of Lipogenesis-Related Genes and Promotes Hepatic Steatosis in Vitro. FEBS Open Bio 2021, 11, 322–332. [Google Scholar] [CrossRef]
- Jiang, R.; Deng, L.; Zhao, L.; Li, X.; Zhang, F.; Xia, Y.; Gao, Y.; Wang, X.; Sun, B. miR-22 Promotes HBV-Related Hepatocellular Carcinoma Development in Males. Clin. Cancer Res. 2011, 17, 5593–5603. [Google Scholar] [CrossRef]
- Hanin, G.; Yayon, N.; Tzur, Y.; Haviv, R.; Bennett, E.R.; Udi, S.; Krishnamoorthy, Y.R.; Kotsiliti, E.; Zangen, R.; Efron, B.; et al. miRNA-132 Induces Hepatic Steatosis and Hyperlipidaemia by Synergistic Multitarget Suppression. Gut 2018, 67, 1124–1134. [Google Scholar] [CrossRef] [PubMed]
- Francque, S.; Szabo, G.; Abdelmalek, M.F.; Byrne, C.D.; Cusi, K.; Dufour, J.-F.; Roden, M.; Sacks, F.; Tacke, F. Nonalcoholic Steatohepatitis: The Role of Peroxisome Proliferator-Activated Receptors. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 24–39. [Google Scholar] [CrossRef] [PubMed]
- Francque, S.M.; Bedossa, P.; Ratziu, V.; Anstee, Q.M.; Bugianesi, E.; Sanyal, A.J.; Loomba, R.; Harrison, S.A.; Balabanska, R.; Mateva, L.; et al. A Randomized, Controlled Trial of the Pan-PPAR Agonist Lanifibranor in NASH. N. Eng. J. Med. 2021, 385, 1547–1558. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Nagy, L.E.; Liangpunsakul, S.; Wang, L. Non-Coding RNA Crosstalk with Nuclear Receptors in Liver Disease. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2021, 1867, 166083. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Lv, G.; Sheng, J.; Yang, Y. Effect of miRNA-10b in Regulating Cellular Steatosis Level by Targeting PPAR-α Expression, a Novel Mechanism for the Pathogenesis of NAFLD. J. Gastroenterol. Hepatol. 2010, 25, 156–163. [Google Scholar] [CrossRef]
- Singh, R.; Ha, S.E.; Wei, L.; Jin, B.; Zogg, H.; Poudrier, S.M.; Jorgensen, B.G.; Park, C.; Ronkon, C.F.; Bartlett, A.; et al. miR-10b-5p Rescues Diabetes and Gastrointestinal Dysmotility. Gastroenterology 2021, 160, 1662–1678.e18. [Google Scholar] [CrossRef]
- Liu, W.; Ren, L.; Wang, X.; Wang, T.; Zhang, N.; Gao, Y.; Luo, H.; Navarro-Alvarez, N.; Tang, L. Combination of Exosomes and Circulating microRNAs May Serve as a Promising Tumor Marker Complementary to Alpha-Fetoprotein for Early-Stage Hepatocellular Carcinoma Diagnosis in Rats. J. Cancer Res. Clin. Oncol. 2015, 141, 1767–1778. [Google Scholar] [CrossRef]
- Zhu, Q.; Gong, L.; Wang, J.; Tu, Q.; Yao, L.; Zhang, J.-R.; Han, X.-J.; Zhu, S.-J.; Wang, S.-M.; Li, Y.-H.; et al. miR-10b Exerts Oncogenic Activity in Human Hepatocellular Carcinoma Cells by Targeting Expression of CUB and Sushi Multiple Domains 1 (CSMD1). BMC Cancer 2016, 16, 806. [Google Scholar] [CrossRef]
- Trajkovski, M.; Hausser, J.; Soutschek, J.; Bhat, B.; Akin, A.; Zavolan, M.; Heim, M.H.; Stoffel, M. MicroRNAs 103 and 107 Regulate Insulin Sensitivity. Nature 2011, 474, 649–653. [Google Scholar] [CrossRef]
- Yamauchi, T.; Nio, Y.; Maki, T.; Kobayashi, M.; Takazawa, T.; Iwabu, M.; Okada-Iwabu, M.; Kawamoto, S.; Kubota, N.; Kubota, T.; et al. Targeted Disruption of AdipoR1 and AdipoR2 Causes Abrogation of Adiponectin Binding and Metabolic Actions. Nat. Med. 2007, 13, 332–339. [Google Scholar] [CrossRef]
- Yamauchi, T.; Kamon, J.; Waki, H.; Terauchi, Y.; Kubota, N.; Hara, K.; Mori, Y.; Ide, T.; Murakami, K.; Tsuboyama-Kasaoka, N.; et al. The Fat-Derived Hormone Adiponectin Reverses Insulin Resistance Associated with Both Lipoatrophy and Obesity. Nat. Med. 2001, 7, 941–946. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Li, Y.; Shang, Y.-F.; Wang, H.-L.; Yao, M.-X. miRNA-103: Molecular Link between Insulin Resistance and Nonalcoholic Fatty Liver Disease. World J. Gastroenterol. 2015, 21, 511–516. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Li, F.; Lai, X.; Liu, H.; Wu, S.; Han, Y.; Shen, Y. Exosomes Secreted by Palmitic Acid-Treated Hepatocytes Promote LX-2 Cell Activation by Transferring miRNA-107. Cell Death Discov. 2021, 7, 174. [Google Scholar] [CrossRef]
- Doghish, A.S.; Elballal, M.S.; Elazazy, O.; Elesawy, A.E.; Elrebehy, M.A.; Shahin, R.K.; Midan, H.M.; Sallam, A.-A.M. The Role of miRNAs in Liver Diseases: Potential Therapeutic and Clinical Applications. Pathol.-Res. Pract. 2023, 243, 154375. [Google Scholar] [CrossRef] [PubMed]
- Lima, J.F.; Cerqueira, L.; Figueiredo, C.; Oliveira, C.; Azevedo, N.F. Anti-miRNA Oligonucleotides: A Comprehensive Guide for Design. RNA Biol. 2018, 15, 338–352. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Xiong, F.; Zhang, S.; Liu, J.; Gao, G.; Xie, J.; Wang, Y. Oligonucleotide Therapies for Nonalcoholic Steatohepatitis. Mol. Ther.-Nucleic Acids 2024, 35, 102184. [Google Scholar] [CrossRef]
- Anthiya, S.; Griveau, A.; Loussouarn, C.; Baril, P.; Garnett, M.; Issartel, J.-P.; Garcion, E. MicroRNA-Based Drugs for Brain Tumors. Trends Cancer 2018, 4, 222–238. [Google Scholar] [CrossRef]
- Panella, R.; Zanderigo, F.; Morandini, F.; Federico, D.; Vicentini, E.; Andreetta, F.; Toniolo, A.; Kauppinen, S. Assessment of Immunostimulatory Responses to the antimiR-22 Oligonucleotide Compound RES-010 in Human Peripheral Blood Mononuclear Cells. Front. Pharmacol. 2023, 14, 1125654. [Google Scholar] [CrossRef]
- Papazyan, R.; Kinberger, G.; Wang, D.; Lang, G.; Gogas, K.; Wright, T.; Zhu, S. LBP-40-Development of Oligonucleotide-Based miR-132 Antagonists for the Treatment of NASH. J. Hepatol. 2019, 70, e160–e161. [Google Scholar] [CrossRef]
- Bork-Jensen, J.; Scheele, C.; Christophersen, D.V.; Nilsson, E.; Friedrichsen, M.; Fernandez-Twinn, D.S.; Grunnet, L.G.; Litman, T.; Holmstrøm, K.; Vind, B.; et al. Glucose Tolerance Is Associated with Differential Expression of microRNAs in Skeletal Muscle: Results from Studies of Twins with and without Type 2 Diabetes. Diabetologia 2015, 58, 363–373. [Google Scholar] [CrossRef]
- Zhao, X.; Chen, Z.; Zhou, Z.; Li, Y.; Wang, Y.; Zhou, Z.; Lu, H.; Sun, C.; Chu, X. High-Throughput Sequencing of Small RNAs and Analysis of Differentially Expressed microRNAs Associated with High-Fat Diet-Induced Hepatic Insulin Resistance in Mice. Genes Nutr. 2019, 14, 6. [Google Scholar] [CrossRef] [PubMed]
- Celikbilek, M.; Baskol, M.; Taheri, S.; Deniz, K.; Dogan, S.; Zararsiz, G.; Gursoy, S.; Guven, K.; Ozbakır, O.; Dundar, M.; et al. Circulating microRNAs in Patients with Non-Alcoholic Fatty Liver Disease. World J. Hepatol. 2014, 6, 613–620. [Google Scholar] [CrossRef] [PubMed]
- RosVivo Therapeutics, Inc. Signed a Material Transfer Agreement (MTA) for First-in-Class Diabetes Treatment with Eli Lilly and Company. Available online: https://www.prnewswire.com/news-releases/rosvivo-therapeutics-inc-signed-a-material-transfer-agreement-mta-for-first-in-class-diabetes-treatment-with-eli-lilly-and-company-301487234.html (accessed on 2 October 2024).
- Bala, S.; Szabo, G. MicroRNA Signature in Alcoholic Liver Disease. Int. J. Hepatol. 2012, 2012, 498232. [Google Scholar] [CrossRef] [PubMed]
- López-Riera, M.; Conde, I.; Tolosa, L.; Zaragoza, Á.; Castell, J.V.; Gómez-Lechón, M.J.; Jover, R. New microRNA Biomarkers for Drug-Induced Steatosis and Their Potential to Predict the Contribution of Drugs to Non-Alcoholic Fatty Liver Disease. Front. Pharmacol. 2017, 8, 3. [Google Scholar] [CrossRef]
- Resalis Therapeutics Raises €10 Million Series A to Complete First Clinical Trial for RES-010 in Obesity. Available online: https://www.biospace.com/resalis-therapeutics-raises-10-million-series-a-to-complete-first-clinical-trial-for-res-010-in-obesity (accessed on 2 October 2024).
- Pipeline—Resalis Therapeutics. Available online: https://www.resalistherapeutics.com/science/pipeline/ (accessed on 2 October 2024).
- Li, S.; Chen, X.; Zhang, H.; Liang, X.; Xiang, Y.; Yu, C.; Zen, K.; Li, Y.; Zhang, C.-Y. Differential Expression of microRNAs in Mouse Liver under Aberrant Energy Metabolic Status[S]. J. Lipid Res. 2009, 50, 1756–1765. [Google Scholar] [CrossRef]
- Winkle, M.; El-Daly, S.M.; Fabbri, M.; Calin, G.A. Noncoding RNA Therapeutics—Challenges and Potential Solutions. Nat. Rev. Drug Discov. 2021, 20, 629–651. [Google Scholar] [CrossRef]
- Drenth, J.P.H.; Schattenberg, J.M. The Nonalcoholic Steatohepatitis (NASH) Drug Development Graveyard: Established Hurdles and Planning for Future Success. Exp. Opin. Investig. Drugs 2020, 29, 1365–1375. [Google Scholar] [CrossRef]
- Khvorova, A.; Watts, J.K. The Chemical Evolution of Oligonucleotide Therapies of Clinical Utility. Nat. Biotechnol. 2017, 35, 238–248. [Google Scholar] [CrossRef]
- Yamamoto, T.; Nakatani, M.; Narukawa, K.; Obika, S. Antisense Drug Discovery and Development. Future Med. Chem. 2011, 3, 339–365. [Google Scholar] [CrossRef]
- Meng, L.; Ward, A.J.; Chun, S.; Bennett, C.F.; Beaudet, A.L.; Rigo, F. Towards a Therapy for Angelman Syndrome by Targeting a Long Non-Coding RNA. Nature 2015, 518, 409–412. [Google Scholar] [CrossRef]
- Soobramoney, C.; Parboosing, R. siRNAs and Viruses: The Good, the Bad and the Way Forward. Curr. Mol. Pharmacol. 2021, 15, 143–158. [Google Scholar] [CrossRef] [PubMed]
- He, F.; Wen, N.; Xiao, D.; Yan, J.; Xiong, H.; Cai, S.; Liu, Z.; Liu, Y. Aptamer-Based Targeted Drug Delivery Systems: Current Potential and Challenges. Curr. Med. Chem. 2020, 27, 2189–2219. [Google Scholar] [CrossRef] [PubMed]
- Makowska, M.; Smolarz, B.; Romanowicz, H. microRNAs (miRNAs) in Glioblastoma Multiforme (GBM)—Recent Literature Review. Int. J. Mol. Sci. 2023, 24, 3521. [Google Scholar] [CrossRef] [PubMed]
- Debacker, A.J.; Voutila, J.; Catley, M.; Blakey, D.; Habib, N. Delivery of Oligonucleotides to the Liver with GalNAc: From Research to Registered Therapeutic Drug. Mol. Ther. 2020, 28, 1759–1771. [Google Scholar] [CrossRef] [PubMed]
- Onishi, M.; Ochiya, T.; Tanaka, Y. MicroRNA and Liver Cancer. Cancer Drug Resist. 2020, 3, 385–400. [Google Scholar] [CrossRef]
- Kher, G.; Trehan, S.; Misra, A. 7—Antisense Oligonucleotides and RNA Interference. In Challenges in Delivery of Therapeutic Genomics and Proteomics; Misra, A., Ed.; Elsevier: London, UK, 2011; pp. 325–386. ISBN 978-0-12-384964-9. [Google Scholar]
- Daige, C.L.; Wiggins, J.F.; Priddy, L.; Nelligan-Davis, T.; Zhao, J.; Brown, D. Systemic Delivery of a miR34a Mimic as a Potential Therapeutic for Liver Cancer. Mol. Cancer Ther. 2014, 13, 2352–2360. [Google Scholar] [CrossRef]
- Beg, M.S.; Brenner, A.J.; Sachdev, J.; Borad, M.; Kang, Y.-K.; Stoudemire, J.; Smith, S.; Bader, A.G.; Kim, S.; Hong, D.S. Phase I Study of MRX34, a Liposomal miR-34a Mimic, Administered Twice Weekly in Patients with Advanced Solid Tumors. Investig. New Drugs 2017, 35, 180–188. [Google Scholar] [CrossRef]
- Sato, Y.; Hatakeyama, H.; Sakurai, Y.; Hyodo, M.; Akita, H.; Harashima, H. A pH-Sensitive Cationic Lipid Facilitates the Delivery of Liposomal siRNA and Gene Silencing Activity in Vitro and in Vivo. J. Control. Release 2012, 163, 267–276. [Google Scholar] [CrossRef]
- Mishra, S.; Webster, P.; Davis, M.E. PEGylation Significantly Affects Cellular Uptake and Intracellular Trafficking of Non-Viral Gene Delivery Particles. Eur. J. Cell Biol. 2004, 83, 97–111. [Google Scholar] [CrossRef]
- Baldari, S.; Di Rocco, G.; Magenta, A.; Picozza, M.; Toietta, G. Extracellular Vesicles–Encapsulated MicroRNA-125b Produced in Genetically Modified Mesenchymal Stromal Cells Inhibits Hepatocellular Carcinoma Cell Proliferation. Cells 2019, 8, 1560. [Google Scholar] [CrossRef]
- Ingato, D.; Lee, J.U.; Sim, S.J.; Kwon, Y.J. Good Things Come in Small Packages: Overcoming Challenges to Harness Extracellular Vesicles for Therapeutic Delivery. J. Control. Release 2016, 241, 174–185. [Google Scholar] [CrossRef] [PubMed]
- Pomatto, M.A.C.; Bussolati, B.; D’Antico, S.; Ghiotto, S.; Tetta, C.; Brizzi, M.F.; Camussi, G. Improved Loading of Plasma-Derived Extracellular Vesicles to Encapsulate Antitumor miRNAs. Mol. Ther. Methods Clin. Dev. 2019, 13, 133–144. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Jiang, Y.; Peng, H.; Chen, Y.; Zhu, P.; Huang, Y. Recent Progress in microRNA Delivery for Cancer Therapy by Non-Viral Synthetic Vectors. Adv. Drug Deliv. Rev. 2015, 81, 142–160. [Google Scholar] [CrossRef] [PubMed]
- Baumann, V.; Winkler, J. miRNA-Based Therapies: Strategies and Delivery Platforms for Oligonucleotide and Non-Oligonucleotide Agents. Future Med. Chem. 2014, 6, 1967–1984. [Google Scholar] [CrossRef]
- Jiang, X.; Bugno, J.; Hu, C.; Yang, Y.; Herold, T.; Qi, J.; Chen, P.; Gurbuxani, S.; Arnovitz, S.; Strong, J.; et al. Eradication of Acute Myeloid Leukemia with FLT3 Ligand-Targeted miR-150 Nanoparticles. Cancer Res. 2016, 76, 4470–4480. [Google Scholar] [CrossRef]


| Target miRNA | Strategy | Accession miRbase Number | Sequence | Target Genes | Commercial Name and Company | Delivery System | References |
|---|---|---|---|---|---|---|---|
| miR-103a-3p | Inhibition | MIMAT0000101 | AGCAGCAUGUACAGGGCUAUGA | Caveolin-1 | AZD4076 (RG-125) (Regulus Therapeutics Inc.) | Biomolecule conjugation (GalNAc) | NCT02612662 NCT02826525 |
| miR-107 | Inhibition | MIMAT0000104 | AGCAGCAUUGUCAGGGCUAUCA | ||||
| miR-22-5p | Inhibition | MIMAT0004495 | AGUUCUUCAGUGGCAAGCUUUA | Peroxisome proliferative-activated receptor (Pgc-1α) Peroxisome proliferator-activated receptor α (PPARα) Sirtuin 1 (Sirt1) | RES-010 (Resalis Therapeutics) | Lipid-based nanoparticles | [68] |
| miR-132-3p | Inhibition | MIMAT0000426 | UAACAGUCUACAGCCAUGGUCG | Phosphatase and tensin homolog (Pten) Forkhead box O3 (FOXO3) Sirtuin 1 (Sirt1) | Anti-miR-132-3p (Regulus Therapeutics Inc.) | Biomolecule conjugation (GalNAc) | [69] |
| miR-10b-5p | Mimic | MIMAT0000254 | UACCCUGUAGAACCGAAUUUGUG | Transcription factor Krüppel-like factor 11 (KLF11) | RSVI-301 (RosVivo Therapeutics Inc.; Eli Lilly) | Subcutaneous injection with jetPEI agent transfection | [56] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carpi, S.; Daniele, S.; de Almeida, J.F.M.; Gabbia, D. Recent Advances in miRNA-Based Therapy for MASLD/MASH and MASH-Associated HCC. Int. J. Mol. Sci. 2024, 25, 12229. https://doi.org/10.3390/ijms252212229
Carpi S, Daniele S, de Almeida JFM, Gabbia D. Recent Advances in miRNA-Based Therapy for MASLD/MASH and MASH-Associated HCC. International Journal of Molecular Sciences. 2024; 25(22):12229. https://doi.org/10.3390/ijms252212229
Chicago/Turabian StyleCarpi, Sara, Simona Daniele, Jacqueline Fátima Martins de Almeida, and Daniela Gabbia. 2024. "Recent Advances in miRNA-Based Therapy for MASLD/MASH and MASH-Associated HCC" International Journal of Molecular Sciences 25, no. 22: 12229. https://doi.org/10.3390/ijms252212229
APA StyleCarpi, S., Daniele, S., de Almeida, J. F. M., & Gabbia, D. (2024). Recent Advances in miRNA-Based Therapy for MASLD/MASH and MASH-Associated HCC. International Journal of Molecular Sciences, 25(22), 12229. https://doi.org/10.3390/ijms252212229

