The Coexistence of Klebsiella pneumoniae and Candida albicans Enhanced Biofilm Thickness but Induced Less Severe Neutrophil Responses and Less Inflammation in Pneumonia Mice Than K. pneumoniae Alone
Abstract
1. Introduction
2. Results
2.1. Candida Elevated Thickness of the Interkingdom Biofilms
2.2. Less Prominent Neutrophil Responses Against K. pneumoniae Plus C. albicans (KP + CA) Biofilms Compared to Those from KP Alone (the In Vitro Test)
2.3. Intratracheal Administration by K. pneumoniae Plus C. albicans (KP + CA) Demonstrated Less Severe Pneumonia Than Kp Alone in Mice
3. Discussion
4. Materials and Methods
4.1. Bacterial and Fungal Isolates and Biofilm Characterization
4.2. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction
4.3. Proteomic Analysis
4.4. In Vitro Experiments on Neutrophils
4.5. Animals and Animal Model
4.6. Histological Analysis and Immunofluorescent Imaging
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cruz, A.; Condinho, M.; Carvalho, B.; Arraiano, C.M.; Pobre, V.; Pinto, S.N. The Two Weapons against Bacterial Biofilms: Detection and Treatment. Antibiotics 2021, 10, 1482. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Ma, J.; Cheng, P.; Li, M.; Yu, Z.; Song, X.; Yu, Z.; Sun, H.; Zhang, W.; Wang, Z. Roles of two-component regulatory systems in Klebsiella pneumoniae: Regulation of virulence, antibiotic resistance, and stress responses. Microbiol. Res. 2023, 272, 127374. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Gao, X.; Li, M.; Liu, Y.; Ma, J.; Wang, X.; Yu, Z.; Cheng, W.; Zhang, W.; Sun, H.; et al. Relationship between biofilm formation and antibiotic resistance of Klebsiella pneumoniae and updates on antibiofilm therapeutic strategies. Front. Cell. Infect. Microbiol. 2024, 14, 1324895. [Google Scholar] [CrossRef]
- Ribeiro, S.M.; Cardoso, M.H.; Cândido, E.d.S.; Franco, O.L. Understanding, preventing and eradicating Klebsiella pneumoniae biofilms. Futur. Microbiol. 2015, 11, 527–538. [Google Scholar] [CrossRef]
- Li, J.; Zhao, X. Effects of quorum sensing on the biofilm formation and viable but non-culturable state. Food Res. Int. 2020, 137, 109742. [Google Scholar] [CrossRef]
- Di Domenico, E.G.; Farulla, I.; Prignano, G.; Gallo, M.T.; Vespaziani, M.; Cavallo, I.; Sperduti, I.; Pontone, M.; Bordignon, V.; Cilli, L.; et al. Biofilm is a Major Virulence Determinant in Bacterial Colonization of Chronic Skin Ulcers Independently from the Multidrug Resistant Phenotype. Int. J. Mol. Sci. 2017, 18, 1077. [Google Scholar] [CrossRef]
- Donlan, R.M. Biofilms and Device-Associated Infections. Emerg. Infect. Dis. 2001, 7, 277–281. [Google Scholar] [CrossRef]
- Elias, S.; Banin, E. Multi-species biofilms: Living with friendly neighbors. FEMS Microbiol. Rev. 2012, 36, 990–1004. [Google Scholar] [CrossRef]
- Ren, Z.; Jeckel, H.; Simon-Soro, A.; Xiang, Z.; Liu, Y.; Cavalcanti, I.M.; Xiao, J.; Tin, N.-N.; Hara, A.; Drescher, K.; et al. Interkingdom assemblages in human saliva display group-level surface mobility and disease-promoting emergent functions. Proc. Natl. Acad. Sci. USA 2022, 119, e2209699119. [Google Scholar] [CrossRef]
- Xu, T.; Xiao, Y.; Wang, H.; Zhu, J.; Lee, Y.; Zhao, J.; Lu, W.; Zhang, H. Characterization of Mixed-Species Biofilms Formed by Four Gut Microbiota. Microorganisms 2022, 10, 2332. [Google Scholar] [CrossRef]
- Ruhal, R.; Kataria, R. Biofilm patterns in gram-positive and gram-negative bacteria. Microbiol. Res. 2021, 251, 126829. [Google Scholar] [CrossRef] [PubMed]
- Tamayo, R. The Characterization of a Cyclic-Di-GMP (c-Di-GMP) Pathway Leads to a New Tool for Studying c-Di-GMP Metabolic Genes. J. Bacteriol. 2013, 195, 4779–4781. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, C.; Kuzyakov, Y. Mechanisms and implications of bacterial–fungal competition for soil resources. ISME J. 2024, 18, wrae073. [Google Scholar] [CrossRef] [PubMed]
- Maione, A.; de Alteriis, E.; Carraturo, F.; Galdiero, S.; Falanga, A.; Guida, M.; Di Cosmo, A.; Maselli, V.; Galdiero, E. The Membranotropic Peptide gH625 to Combat Mixed Candida albicans/Klebsiella pneumoniae Biofilm: Correlation between In Vitro Anti-Biofilm Activity and In Vivo Antimicrobial Protection. J. Fungi 2021, 7, 26. [Google Scholar] [CrossRef]
- Welp, A.L.; Bomberger, J.M. Bacterial Community Interactions During Chronic Respiratory Disease. Front. Cell. Infect. Microbiol. 2020, 10, 213. [Google Scholar] [CrossRef]
- Effah, C.Y.; Sun, T.; Liu, S.; Wu, Y. Klebsiella pneumoniae: An increasing threat to public health. Ann. Clin. Microbiol. Antimicrob. 2020, 19, 1. [Google Scholar] [CrossRef]
- Guerra, M.E.S.; Destro, G.; Vieira, B.; Lima, A.S.; Ferraz, L.F.C.; Hakansson, A.P.; Darrieux, M.; Converso, T.R. Klebsiella pneumoniae Biofilms and Their Role in Disease Pathogenesis. Front. Cell. Infect. Microbiol. 2022, 12, 877995. [Google Scholar] [CrossRef]
- Pan, Y.-J.; Lin, T.-L.; Chen, C.-T.; Chen, Y.-Y.; Hsieh, P.-F.; Hsu, C.-R.; Wu, M.-C.; Wang, J.-T. Genetic analysis of capsular polysaccharide synthesis gene clusters in 79 capsular types of Klebsiella spp. Sci. Rep. 2015, 5, 15573. [Google Scholar] [CrossRef]
- Pereira, R.; Dos Santos Fontenelle, R.O.; de Brito, E.H.S.; de Morais, S.M. Biofilm of Candida albicans: Formation, regulation and resistance. J. Appl. Microbiol. 2021, 131, 11–22. [Google Scholar] [CrossRef]
- Ramage, G.; Saville, S.P.; Wickes, B.L.; López-Ribot, J.L. Inhibition of Candida albicans biofilm formation by farnesol, a quorum-sensing molecule. Appl. Environ. Microbiol. 2002, 68, 5459–5463. [Google Scholar] [CrossRef]
- Rodrigues, C.F.; Černáková, L. Farnesol and Tyrosol: Secondary Metabolites with a Crucial quorum-sensing Role in Candida Biofilm Development. Genes 2020, 11, 444. [Google Scholar] [CrossRef] [PubMed]
- Galdiero, E.; Salvatore, M.M.; Maione, A.; de Alteriis, E.; Andolfi, A.; Salvatore, F.; Guida, M. GC-MS-Based Metabolomics Study of Single- and Dual-Species Biofilms of Candida albicans and Klebsiella pneumoniae. Int. J. Mol. Sci. 2021, 22, 3496. [Google Scholar] [CrossRef] [PubMed]
- Pontis, H.G. Methods for Analysis of Carbohydrate Metabolism in Photosynthetic Organisms: Plants, Green Algae and Cyanobacteria; Academic Press: Cambridge, MA, USA, 2016; pp. 1–230. [Google Scholar]
- Su, C.; Gong, J.-S.; Dong, Q.; Wang, N.-K.; Li, H.; Shi, J.-S.; Xu, Z.-H. Efficient production and characterization of a newly identified trehalase for inhibiting the formation of bacterial biofilms. Int. J. Biol. Macromol. 2024, 262, 129928. [Google Scholar] [CrossRef] [PubMed]
- Phuengmaung, P.; Mekjaroen, J.; Saisorn, W.; Chatsuwan, T.; Somparn, P.; Leelahavanichkul, A. Rapid Synergistic Biofilm Production of Pseudomonas and Candida on the Pulmonary Cell Surface and in Mice, a Possible Cause of Chronic Mixed Organismal Lung Lesions. Int. J. Mol. Sci. 2022, 23, 9202. [Google Scholar] [CrossRef]
- Phuengmaung, P.; Somparn, P.; Panpetch, W.; Singkham-In, U.; Wannigama, D.L.; Chatsuwan, T.; Leelahavanichkul, A. Coexistence of Pseudomonas aeruginosa with Candida albicans Enhances Biofilm Thickness Through Alginate-Related Extracellular Matrix but Is Attenuated by N-acetyl-l-cysteine. Front. Cell. Infect. Microbiol. 2020, 10, 594336. [Google Scholar] [CrossRef]
- Phuengmaung, P.; Panpetch, W.; Singkham-In, U.; Chatsuwan, T.; Chirathaworn, C.; Leelahavanichkul, A. Presence of Candida tropicalis on Staphylococcus epidermidis Biofilms Facilitated Biofilm Production and Candida Dissemination: An Impact of Fungi on Bacterial Biofilms. Front. Cell. Infect. Microbiol. 2021, 11, 763239. [Google Scholar] [CrossRef]
- Estrela, A.B.; Abraham, W.-R. Combining Biofilm-Controlling Compounds and Antibiotics as a Promising New Way to Control Biofilm Infections. Pharmaceuticals 2010, 3, 1374–1393. [Google Scholar] [CrossRef]
- Ebert, C.; Tuchscherr, L.; Unger, N.; Pöllath, C.; Gladigau, F.; Popp, J.; Löffler, B.; Neugebauer, U. Correlation of crystal violet biofilm test results of Staphylococcus aureus clinical isolates with Raman spectroscopic read-out. J. Raman Spectrosc. 2021, 52, 2660–2670. [Google Scholar] [CrossRef]
- Kothiwal, D.; Gopinath, S.; Laloraya, S. Cohesin dysfunction results in cell wall defects in budding yeast. Genetics 2020, 217, iyaa023. [Google Scholar] [CrossRef]
- Li, Y.; Ni, M. Regulation of biofilm formation in Klebsiella pneumoniae. Front. Microbiol. 2023, 14, 1238482. [Google Scholar] [CrossRef]
- Hayer-Hartl, M.; Bracher, A.; Hartl, F.U. The GroEL-GroES Chaperonin Machine: A Nano-Cage for Protein Folding. Trends Biochem. Sci. 2016, 41, 62–76. [Google Scholar] [CrossRef] [PubMed]
- Ladomersky, E.; Petris, M.J. Copper tolerance and virulence in bacteria. Metallomics 2015, 7, 957–964. [Google Scholar] [CrossRef] [PubMed]
- Chandrangsu, P.; Rensing, C.; Helmann, J.D. Metal homeostasis and resistance in bacteria. Nat. Rev. Microbiol. 2017, 15, 338–350. [Google Scholar] [CrossRef] [PubMed]
- Planson, A.-G.; Sauveplane, V.; Dervyn, E.; Jules, M. Bacterial growth physiology and RNA metabolism. Biochim. Biophys. Acta BBA Gene Regul. Mech. 2020, 1863, 194502. [Google Scholar] [CrossRef]
- Belliveau, N.M.; Chure, G.; Hueschen, C.L.; Garcia, H.G.; Kondev, J.; Fisher, D.S.; Theriot, J.A.; Phillips, R. Fundamental limits on the rate of bacterial growth and their influence on proteomic composition. Cell Syst. 2021, 12, 924–944.e2. [Google Scholar] [CrossRef]
- Muzaki, M.Z.B.M.; Subramoni, S.; Summers, S.; Kjelleberg, S.; Rice, S.A. Klebsiella pneumoniae AI-2 transporters mediate interspecies interactions and composition in a three-species biofilm community. npj Biofilms Microbiomes 2024, 10, 91. [Google Scholar] [CrossRef]
- Chen, X.; Abubakar, Y.S.; Yang, C.; Wang, X.; Miao, P.; Lin, M.; Wen, Y.; Wu, Q.; Zhong, H.; Fan, Y.; et al. Trehalose Phosphate Synthase Complex-Mediated Regulation of Trehalose 6-Phosphate Homeostasis Is Critical for Development and Pathogenesis in Magnaporthe oryzae. mSystems 2021, 6, e0046221. [Google Scholar] [CrossRef]
- Sardis, M.F.; Bohrhunter, J.L.; Greene, N.G.; Bernhardt, T.G. The LpoA activator is required to stimulate the peptidoglycan polymerase activity of its cognate cell wall synthase PBP1a. Proc. Natl. Acad. Sci. USA 2021, 118, e2108894118. [Google Scholar] [CrossRef]
- Vidakovic, L.; Mikhaleva, S.; Jeckel, H.; Nisnevich, V.; Strenger, K.; Neuhaus, K.; Raveendran, K.; Ben-Moshe, N.B.; Aznaourova, M.; Nosho, K.; et al. Biofilm formation on human immune cells is a multicellular predation strategy of Vibrio cholerae. Cell 2023, 186, 2690–2704.e20. [Google Scholar] [CrossRef]
- Cangui-Panchi, S.P.; Ñacato-Toapanta, A.L.; Enríquez-Martínez, L.J.; Salinas-Delgado, G.A.; Reyes, J.; Garzon-Chavez, D.; Machado, A. Battle royale: Immune response on biofilms—Host-pathogen interactions. Curr. Res. Immunol. 2023, 4, 100057. [Google Scholar] [CrossRef]
- Zhong, H.; Lu, R.-Y.; Wang, Y. Neutrophil extracellular traps in fungal infections: A seesaw battle in hosts. Front. Immunol. 2022, 13, 977493. [Google Scholar] [CrossRef] [PubMed]
- Scherer, A.K.; Hopke, A.; Sykes, D.B.; Irimia, D.; Mansour, M.K. Host defense against fungal pathogens: Adaptable neutrophil responses and the promise of therapeutic opportunities? PLoS Pathog. 2021, 17, e1009691. [Google Scholar] [CrossRef] [PubMed]
- Shweihat, Y.; Perry, J., 3rd; Shah, D. Isolated Candida infection of the lung. Respir. Med. Case Rep. 2015, 16, 18–19. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dietert, K.; Gutbier, B.; Wienhold, S.M.; Reppe, K.; Jiang, X.; Yao, L.; Chaput, C.; Naujoks, J.; Brack, M.; Kupke, A.; et al. Spectrum of pathogen- and model-specific histopathologies in mouse models of acute pneumonia. PLoS ONE 2017, 12, e0188251. [Google Scholar] [CrossRef]
- Euler, C.W.; Raz, A.; Hernandez, A.; Serrano, A.; Xu, S.; Andersson, M.; Zou, G.; Zhang, Y.; Fischetti, V.A.; Li, J. PlyKp104, a Novel Phage Lysin for the Treatment of Klebsiella pneumoniae, Pseudomonas aeruginosa, and Other Gram-Negative ESKAPE Pathogens. Antimicrob. Agents Chemother. 2023, 67, e0151922. [Google Scholar] [CrossRef]
- Anand, T.; Virmani, N.; Kumar, S.; Mohanty, A.K.; Pavulraj, S.; Bera, B.C.; Vaid, R.K.; Ahlawat, U.; Tripathi, B. Phage therapy for treatment of virulent Klebsiella pneumoniae infection in a mouse model. J. Glob. Antimicrob. Resist. 2019, 21, 34–41. [Google Scholar] [CrossRef]
- Zeng, J.; Wan, X.; Liu, T.; Xiong, Y.; Xiang, G.; Peng, Y.; Zhu, R.; Zhou, Y.; Liu, C. Chlorogenic acid ameliorates Klebsiella pneumoniae-induced pneumonia in immunosuppressed mice via inhibiting the activation of NLRP3 inflammasomes. Food Funct. 2021, 12, 9466–9475. [Google Scholar] [CrossRef]
- Hoover, J.L.; Lewandowski, T.F.; Mininger, C.L.; Singley, C.M.; Sucoloski, S.; Rittenhouse, S. A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii. J. Vis. Exp. 2017, 2, 55068. [Google Scholar] [CrossRef]
- Bhunyakarnjanarat, T.; Makjaroen, J.; Saisorn, W.; Hirunsap, K.; Chiewchengchol, J.; Ritprajak, P.; Leelahavanichkul, A. Lupus exacerbation in ovalbumin-induced asthma in Fc gamma receptor IIb deficient mice, partly due to hyperfunction of dendritic cells. Asian Pac. J. Allergy Immunol. 2024. [Google Scholar] [CrossRef]
- Hiengrach, P.; Panpetch, W.; Chindamporn, A.; Leelahavanichkul, A. Helicobacter pylori, Protected from Antibiotics and Stresses Inside Candida albicans Vacuoles, Cause Gastritis in Mice. Int. J. Mol. Sci. 2022, 23, 8568. [Google Scholar] [CrossRef]
- Davyt, M.; Bharti, N.; Ignatova, Z. Effect of mRNA/tRNA mutations on translation speed: Implications for human diseases. J. Biol. Chem. 2023, 299, 105089. [Google Scholar] [CrossRef] [PubMed]
- Ponde, N.O.; Lortal, L.; Ramage, G.; Naglik, J.R.; Richardson, J.P. Candida albicans biofilms and polymicrobial interactions. Crit. Rev. Microbiol. 2021, 47, 91–111. [Google Scholar] [CrossRef] [PubMed]
- Lohse, M.B.; Gulati, M.; Johnson, A.D.; Nobile, C.J. Development and regulation of single- and multi-species Candida albicans biofilms. Nat. Rev. Microbiol. 2018, 16, 19–31. [Google Scholar] [CrossRef] [PubMed]
- Kahl, L.J.; Stremmel, N.; Esparza-Mora, M.A.; Wheatley, R.M.; MacLean, R.C.; Ralser, M. Interkingdom interactions between Pseudomonas aeruginosa and Candida albicans affect clinical outcomes and antimicrobial responses. Curr. Opin. Microbiol. 2023, 75, 102368. [Google Scholar] [CrossRef] [PubMed]
- Vanaporn, M.; Titball, R.W. Trehalose and bacterial virulence. Virulence 2020, 11, 1192–1202. [Google Scholar] [CrossRef]
- Thammahong, A.; Puttikamonkul, S.; Perfect, J.R.; Brennan, R.G.; Cramer, R.A. Central Role of the Trehalose Biosynthesis Pathway in the Pathogenesis of Human Fungal Infections: Opportunities and Challenges for Therapeutic Development. Microbiol. Mol. Biol. Rev. 2017, 81, e00053-16. [Google Scholar] [CrossRef]
- Sae-Khow, K.; Charoensappakit, A.; Chiewchengchol, D.; Leelahavanichkul, A. High-Dose Intravenous Ascorbate in Sepsis, a Pro-Oxidant Enhanced Microbicidal Activity and the Effect on Neutrophil Functions. Biomedicines 2022, 11, 51. [Google Scholar] [CrossRef]
- Charoensappakit, A.; Sae-Khow, K.; Leelahavanichkul, A. Gut Barrier Damage and Gut Translocation of Pathogen Molecules in Lupus, an Impact of Innate Immunity (Macrophages and Neutrophils) in Autoimmune Disease. Int. J. Mol. Sci. 2022, 23, 8223. [Google Scholar] [CrossRef]
- Thanabalasuriar, A.; Scott, B.N.V.; Peiseler, M.; Willson, M.E.; Zeng, Z.; Warrener, P.; Keller, A.E.; Surewaard, B.G.J.; Dozier, E.A.; Korhonen, J.T.; et al. Neutrophil Extracellular Traps Confine Pseudomonas aeruginosa Ocular Biofilms and Restrict Brain Invasion. Cell Host Microbe 2019, 25, 526–536.e4. [Google Scholar] [CrossRef]
- Papayannopoulos, V. Neutrophils Facing Biofilms: The Battle of the Barriers. Cell Host Microbe 2019, 25, 477–479. [Google Scholar] [CrossRef]
- Johnson, C.J.; Kernien, J.F.; Hoyer, A.R.; Nett, J.E. Mechanisms involved in the triggering of neutrophil extracellular traps (NETs) by Candida glabrata during planktonic and biofilm growth. Sci. Rep. 2017, 7, 13065. [Google Scholar] [CrossRef] [PubMed]
- Brinkmann, V.; Reichard, U.; Goosmann, C.; Fauler, B.; Uhlemann, Y.; Weiss, D.S.; Weinrauch, Y.; Zychlinsky, A. Neutrophil extracellular traps kill bacteria. Science 2004, 303, 1532–1535. [Google Scholar] [CrossRef] [PubMed]
- Baz, A.A.; Hao, H.; Lan, S.; Li, Z.; Liu, S.; Chen, S.; Chu, Y. Neutrophil extracellular traps in bacterial infections and evasion strategies. Front. Immunol. 2024, 15, 1357967. [Google Scholar] [CrossRef] [PubMed]
- Guilhen, C.; Miquel, S.; Charbonnel, N.; Joseph, L.; Carrier, G.; Forestier, C.; Balestrino, D. Colonization and immune modulation properties of Klebsiella pneumoniae biofilm-dispersed cells. npj Biofilms Microbiomes 2019, 5, 25. [Google Scholar] [CrossRef]
- Nguyen, L.D.N.; Viscogliosi, E.; Delhaes, L. The lung mycobiome: An emerging field of the human respiratory microbiome. Front. Microbiol. 2015, 6, 89. [Google Scholar] [CrossRef]
- Cui, L.; Morris, A.; Ghedin, E. The human mycobiome in health and disease. Genome Med. 2013, 5, 63. [Google Scholar] [CrossRef]
- Zhao, Y.; Yi, J.; Xiang, J.; Jia, W.; Chen, A.; Chen, L.; Zheng, L.; Zhou, W.; Wu, M.; Yu, Z.; et al. Exploration of lung mycobiome in the patients with non-small-cell lung cancer. BMC Microbiol. 2023, 23, 81. [Google Scholar] [CrossRef]
- Henriques, B.S.; Garcia, E.S.; Azambuja, P.; Genta, F.A. Determination of Chitin Content in Insects: An Alternate Method Based on Calcofluor Staining. Front. Physiol. 2020, 11, 117. [Google Scholar] [CrossRef]
- Mourad, B.; Ismail, M.; Hawwam, S.; Msseha, M.; Hassan, R. Evaluation of The Efficacy of Fluorescent Staining and Chicago Sky Blue Staining as Methods for Diagnosis of Dermatophytosis in Hair and Nails. Clin. Cosmet. Investig. Dermatol. 2019, 12, 751–758. [Google Scholar] [CrossRef]
- Singkham-In, U.; Phuengmaung, P.; Makjaroen, J.; Saisorn, W.; Bhunyakarnjanarat, T.; Chatsuwan, T.; Chirathaworn, C.; Chancharoenthana, W.; Leelahavanichkul, A. Chlorhexidine Promotes Psl Expression in Pseudomonas aeruginosa That Enhances Cell Aggregation with Preserved Pathogenicity Demonstrates an Adaptation against Antiseptic. Int. J. Mol. Sci. 2022, 23, 8308. [Google Scholar] [CrossRef]
- Panpetch, W.; Visitchanakun, P.; Saisorn, W.; Sawatpanich, A.; Chatthanathon, P.; Somboonna, N.; Tumwasorn, S.; Leelahavanichkul, A. Lactobacillus rhamnosus attenuates Thai chili extracts induced gut inflammation and dysbiosis despite capsaicin bactericidal effect against the probiotics, a possible toxicity of high dose capsaicin. PLoS ONE 2021, 16, e0261189. [Google Scholar] [CrossRef] [PubMed]
- Saisorn, W.; Saithong, S.; Phuengmaung, P.; Udompornpitak, K.; Bhunyakarnjanarat, T.; Visitchanakun, P.; Chareonsappakit, A.; Pisitkun, P.; Chiewchengchol, D.; Leelahavanichkul, A. Acute Kidney Injury Induced Lupus Exacerbation Through the Enhanced Neutrophil Extracellular Traps (and Apoptosis) in Fcgr2b Deficient Lupus Mice with Renal Ischemia Reperfusion Injury. Front. Immunol. 2021, 12, 669162. [Google Scholar] [CrossRef] [PubMed]
- Sae-Khow, K.; Phuengmaung, P.; Issara-Amphorn, J.; Makjaroen, J.; Visitchanakun, P.; Boonmee, A.; Benjaskulluecha, S.; Palaga, T.; Leelahavanichkul, A. Less Severe Polymicrobial Sepsis in Conditional mgmt-Deleted Mice Using LysM-Cre System, Impacts of DNA Methylation and MGMT Inhibitor in Sepsis. Int. J. Mol. Sci. 2023, 24, 10175. [Google Scholar] [CrossRef] [PubMed]
- Saithong, S.; Saisorn, W.; Visitchanakun, P.; Sae-Khow, K.; Chiewchengchol, D.; Leelahavanichkul, A. A Synergy Between Endotoxin and (1→3)-Beta-D-Glucan Enhanced Neutrophil Extracellular Traps in Candida Administered Dextran Sulfate Solution Induced Colitis in FcGRIIB-/- Lupus Mice, an Impact of Intestinal Fungi in Lupus. J. Inflamm. Res. 2021, 14, 2333–2352. [Google Scholar] [CrossRef]
- Saisorn, W.; Santiworakul, C.; Phuengmaung, P.; Siripen, N.; Rianthavorn, P.; Leelahavanichkul, A. Extracellular traps in peripheral blood mononuclear cell fraction in childhood-onset systemic lupus erythematosus. Sci. Rep. 2024, 14, 23177. [Google Scholar] [CrossRef]
- Dinh, T.T.H.; Tummamunkong, P.; Padungros, P.; Ponpakdee, P.; Boonprakong, L.; Saisorn, W.; Leelahavanichkul, A.; Kueanjinda, P.; Ritprajak, P. Interaction Between Dendritic Cells and Candida krusei β-Glucan Partially Depends on Dectin-1 and It Promotes High IL-10 Production by T Cells. Front. Cell. Infect. Microbiol. 2021, 10, 566661. [Google Scholar] [CrossRef]
- Pendleton, K.M.; Huffnagle, G.B.; Dickson, R.P. The significance of Candida in the human respiratory tract: Our evolving understanding. Pathog. Dis. 2017, 75, ftx029. [Google Scholar] [CrossRef]








| Primer | Sequence | |
|---|---|---|
| 16S rRNA | Forward | 5′-TCCAGGTGTAGCGGTGAAAT-3′ |
| Reverse | 5′-TGAGTTTTAACCTTGCGGCC-3′ | |
| mrkA | Forward | 5′-CGATGCGAACGTTTACCTGT-3′ |
| Reverse | 5′-TTCACGCCCAGTTTGCTTAC-3′ | |
| mrkD | Forward | 5′-GCCAACATTAGCACCTCGTT-3′ |
| Reverse | 5′-GTCGTCGGGCCATACTGATA-3′ | |
| wzi | Forward | 5′-CAATGACCGGCTTCCTGATG-3′ |
| Reverse | 5′- GCTGCTAAATGACTCAGGCC -3′ | |
| PAD4 | Forward | 5′-ACAGGTGAAAGCAGCCAGC-3′ |
| Reverse | 5′-AGTGATGTAGATCAGGGCTTGG-3′ | |
| β-actin | Forward | 5′-CGGTTCCGATGCCCTGAGGCTCTT-3′ |
| Reverse | 5′-CGTCACACTTCATGATGGAATTGA-3′ | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Phuengmaung, P.; Chongrak, C.; Saisorn, W.; Makjaroen, J.; Singkham-in, U.; Leelahavanichkul, A. The Coexistence of Klebsiella pneumoniae and Candida albicans Enhanced Biofilm Thickness but Induced Less Severe Neutrophil Responses and Less Inflammation in Pneumonia Mice Than K. pneumoniae Alone. Int. J. Mol. Sci. 2024, 25, 12157. https://doi.org/10.3390/ijms252212157
Phuengmaung P, Chongrak C, Saisorn W, Makjaroen J, Singkham-in U, Leelahavanichkul A. The Coexistence of Klebsiella pneumoniae and Candida albicans Enhanced Biofilm Thickness but Induced Less Severe Neutrophil Responses and Less Inflammation in Pneumonia Mice Than K. pneumoniae Alone. International Journal of Molecular Sciences. 2024; 25(22):12157. https://doi.org/10.3390/ijms252212157
Chicago/Turabian StylePhuengmaung, Pornpimol, Chiratchaya Chongrak, Wilasinee Saisorn, Jiradej Makjaroen, Uthaibhorn Singkham-in, and Asada Leelahavanichkul. 2024. "The Coexistence of Klebsiella pneumoniae and Candida albicans Enhanced Biofilm Thickness but Induced Less Severe Neutrophil Responses and Less Inflammation in Pneumonia Mice Than K. pneumoniae Alone" International Journal of Molecular Sciences 25, no. 22: 12157. https://doi.org/10.3390/ijms252212157
APA StylePhuengmaung, P., Chongrak, C., Saisorn, W., Makjaroen, J., Singkham-in, U., & Leelahavanichkul, A. (2024). The Coexistence of Klebsiella pneumoniae and Candida albicans Enhanced Biofilm Thickness but Induced Less Severe Neutrophil Responses and Less Inflammation in Pneumonia Mice Than K. pneumoniae Alone. International Journal of Molecular Sciences, 25(22), 12157. https://doi.org/10.3390/ijms252212157

