Next Article in Journal
Observational Analyses of Ex Vivo Native American Platelet Responses
Previous Article in Journal
The Predictive Role of Inflammatory Biomarkers and Their Correlation with the Biochemical Profile in Patients with Vasculopathy Undergoing Surgery
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulatory Role of Nfix Gene in Sheep Skeletal Muscle Cell Development and Its Interaction Mechanism with MSTN

1
Institute of Biotechnology, Xinjiang Academy of Animal Science, Xinjiang Key Laboratory of Animal Biotechnology, Urumqi 830026, China
2
College of Animal Science, Xinjiang Agricultural University, Urumqi 830052, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(22), 11988; https://doi.org/10.3390/ijms252211988
Submission received: 5 October 2024 / Revised: 5 November 2024 / Accepted: 7 November 2024 / Published: 8 November 2024
(This article belongs to the Section Molecular Genetics and Genomics)

Abstract

:
Skeletal muscle development is crucial for livestock production, and understanding the molecular mechanisms involved is essential for enhancing muscle growth in sheep. This study aimed to investigate the role of Nfix, a member of the nuclear factor I (NFI) family, in regulating muscle development in sheep, filling a significant gap in the current understanding of Nfix deficiency and its impact on skeletal muscle growth, as no similar studies have been reported in this species. Bioinformatic analysis, including temporal analysis of transcriptome data, identified Nfix as a potential target gene for muscle growth regulation. The effects of Nfix overexpression and knockout on the proliferation and differentiation of sheep skeletal muscle cells were investigated. Changes in the expression of associated marker genes were assessed to explore the regulatory link between Nfix and the myostatin (MSTN) gene. Additionally, target miRNAs for Nfix and MSTN were predicted using online databases such as miRWalk, resulting in the construction of an Nfix–miRNA–MSTN interactive regulatory network. The findings revealed that Nfix promotes the proliferation and differentiation of sheep skeletal muscle cells, with further analysis indicating that Nfix may regulate muscle cell development by modulating MSTN expression. This study provides preliminary insights into the function of Nfix in sheep skeletal muscle development and its regulatory interactions, addressing a critical knowledge gap regarding Nfix deficiency and its implications for muscle growth. These findings contribute to a better understanding of muscle biology in sheep and provide a theoretical foundation for future research into the regulatory mechanisms governing muscle development.

1. Introduction

In vertebrates, muscle progenitor cells originate from the mesoderm, differentiating from myotome and dermatomyotome cells [1,2,3]. The formation of skeletal muscle fibers typically involves the development of primary and secondary fibers, with some species exhibiting a third stage that gives rise to tertiary fibers [4,5,6]. In livestock, muscle mass increases through two primary pathways: the proliferation of muscle fibers and the hypertrophy of existing fibers. Before birth, the number of skeletal muscle fibers increases, accompanied by some degree of hypertrophy. After birth, the fiber count generally remains constant, and muscle growth primarily results from the increase in fiber diameter. Therefore, the embryonic period is critical for skeletal muscle development, as the number of fibers determines the muscle’s growth potential after birth.
Key regulatory factors play essential roles in this developmental process. Among these, the transcription factor Nfix, a member of the nuclear factor I (NFI) family, has emerged as a crucial player in muscle fiber formation. The NFI family is a group of DNA-binding proteins with specific binding sites [7], also known as CTF or CAAT box transcription factor, playing a significant role in viral DNA replication and gene expression regulation. The NFI family consists of four members—NFIA, NFIB, NFIC, and NFIX—characterized by their conserved N-terminal DNA-binding domains. NFI proteins form dimers with double-stranded DNA by binding to the palindrome sequence TTGGC(N5)GCCAA or its variants [8,9]. These interactions regulate gene transcription, as NFI-binding sites are present in the promoters of muscle differentiation-related genes [10,11]. NFI proteins can bind to these promoters to regulate gene expression [12]. Nfix activates fetal muscle-specific genes like MCK by binding to protein kinase Cu (PKCu) and myocyte enhancer factor 2A (Mef2A), while also inhibiting the embryonic gene MyHC-I. Nfix-deficient mice show reduced body size and developmental defects. Additionally, lacking Nfix slows muscle regeneration after injury and increases oxidative slow-twitch fibers, which are more resilient to oxidative stress. During development in mice and zebrafish, Nfix counteracts Sox6, facilitating proper MyHC expression [13,14].
Concurrent with the activity of Nfix, MSTN, a member of the TGF-β superfamily is a major negative regulator of muscle growth. MSTN inhibits myocyte differentiation by downregulating key myogenic regulatory factors, such as MyoD and Myogenin, thus exerting a powerful influence on muscle fiber formation [15]. The addition of TGFβ1 significantly reduces the number of nuclei in newly formed muscle fibers, leading to a decreased cross-sectional area. Exogenous TGFβ can impair muscle function during regeneration, while inhibiting TGFβR2 promotes larger muscle fibers [16]. MSTN negatively regulates muscle size, with loss-of-function mutations increasing muscle mass across species, including humans [17]. MSTN inhibits myocyte differentiation by downregulating MyoD and Myogenin and reducing creatine kinase activity [18]. MyoD is a downstream target of Smad3, which MSTN activates to inhibit MyoD transcription [19,20]. MSTN also upregulates p21 and reduces Cdk2 activity in muscle satellite cells, preventing proliferation and maintaining quiescence [21]. In Texel sheep, a GA mutation in the MSTN 3′UTR increases miR206 and miR1 expression, inhibiting MSTN transcription and resulting in double-muscling traits [22].
Numerous studies have shown that miRNA is essential for the proliferation and differentiation of skeletal muscle cells across species by targeting the 3′UTR of specific genes. In mice, miR-143 negatively regulates IGFBP5 during muscle development [23]. In poultry, miR-21-5p influences KLF3 in chicken satellite cells, while miR-320-3p targets CFL2 for actin remodeling [24,25]. In ruminants, miR-377 inhibits the proliferation of bovine muscle satellite cells by regulating FHL2 [26], whereas miR-27b promotes sheep muscle satellite cell proliferation by targeting MSTN [27].
Despite the substantial body of research on Nfix and MSTN in model organisms, their specific roles and mechanisms in sheep muscle development remain inadequately characterized. This study aimed to bridge this knowledge gap by investigating the regulatory role of Nfix in the proliferation and differentiation of sheep skeletal muscle cells, as well as its interaction with MSTN. We employed gene overexpression and knockout techniques to elucidate the effects of Nfix on MSTN expression and its downstream targets, including MyoD and SMAD4, utilizing quantitative RT-PCR and Western blotting methods. Furthermore, this research predicts the target miRNAs of Nfix and MSTN using online databases like miRWalk, allowing for the construction of an Nfix–miRNA–MSTN interaction regulatory network. This study not only seeks to enhance our understanding of the molecular mechanisms underlying muscle development in sheep but also lays the groundwork for future investigations into muscle growth regulation in livestock, ultimately contributing to improved agricultural practices and animal breeding strategies.

2. Results

2.1. Temporal Analysis Identifies Nfix as a Potential Target Gene for the Regulation of Skeletal Muscle Development

In preliminary research results, transcriptome sequencing analysis was conducted on embryonic muscle samples taken at 35, 40, and 45 days of pregnancy (unpublished). The 40vs35, 45vs40, and 45vs35 groups identified 206, 3112, and 4016 differential genes, respectively (padj < 0.05 and absolute value of log2 fold change ≥1), showing that the number of differential genes in the 45vs40 group was significantly more than that in the 40vs35 group. This result suggests that 40–45 days may be a critical period for early muscle development in sheep (Figure 1A). To further screen the core target genes affecting early muscle development in sheep, this study re-analyzed the differential genes in the 45vs40 group. The new screening threshold was padj < 0.01 and absolute value of log2 fold change ≥1.5, resulting in 696 differentially expressed protein-coding genes, of which 324 were upregulated and 372 downregulated (Figure 1B, Table S1 (gene list)). These differential genes were mainly distributed on chromosomes 1 and 3 (Figure 1C). At the same time, we carried out temporal analysis on the muscle transcriptome data from the entire 35–40–45 developmental process and obtained 1244 continuously upregulated protein-coding genes (cluster 4) (Figure 1D, Table S2 (cluster 4 gene list)). The intersection of the above 696 differentially expressed genes in the 45vs40 group and the continuously upregulated genes in the temporal analysis results yielded 48 continuously upregulated differential protein-coding genes (Figure 1E). By sorting them according to the FPKM values, we finally obtained the top 10 potential target genes with relatively high expression levels (Table 1).

2.2. Construction and Transfection of Nfix Overexpression/Knockout Vectors in Sheep

Amplification was performed using the cDNA of a Chinese merino sheep’s longissimus dorsi muscle as a template. The target product was connected to the Plex-MCS vector and electrophoresed after enzyme digestion. The results showed bright and clear bands (Figure 2A,B), with the fragment size consistent with expectations. After sequencing the amplified products, two forms of coding sequences for the sheep Nfix gene were obtained, named NfixT1/T3. The knockout sgRNAs were also linked to lentiCRISPRv2-Puro and sequenced. The results indicated that the sequence was consistent with the target sequence and could be used for subsequent experiments (Supplementary Materials S1). The recombinant lentiviral plasmids NfixT1, NfixT3, Nfix-sg1, Nfix-sg2, Nfix-sg3, and Plex-GFP (positive control) were co-transfected into 293T cells with packaging plasmids (psPAX2 and pMD2.G) using liposome transfection. Viruses were collected and used to infect 293T cells and sheep myoblasts. Observations under a fluorescence microscope revealed significant green fluorescence, indicating successful transfection (Figure 2C–F).

2.3. Nfix Promotes Myoblast Proliferation

We conducted overexpression and knockout experiments to assess the impact of Nfix on myoblast proliferation. Vectors for Nfix overexpression and knockout were constructed and transfected separately into sheep myoblasts cultured in growth medium (GM). In subsequent experiments, the knockout efficiency of Nfix-sg2 was found to be higher. CCK-8 assay results showed that overexpression of Nfix significantly increased cell proliferation 48, 96, or 120 h after transfection (Figure 3A). In contrast, Nfix knockout significantly inhibited the proliferation ability of sheep myoblasts compared to the negative control group (Figure 3B).

2.4. Nfix Positively Regulates Myogenic Differentiation

During the differentiation process of sheep myoblasts, we monitored the temporal changes in the expression of myogenesis-related genes and the Nfix gene. Nfix was upregulated during the myogenesis differentiation process of sheep myoblasts, which is consistent with the expression level changes in the myogenesis marker desmin (Figure 4E). Immunofluorescence staining and qRT-PCR confirmed that more myotubes were formed after Nfix overexpression compared to cells transfected with control vector (Figure 4A,C). Conversely, fewer myotubes were formed after Nfix knockout compared to cells transfected with control vector (Figure 4B,D). Overexpression of Nfix significantly increased the levels of myogenic markers in sheep myoblasts.

2.5. Nfix Regulates Myostatin Expression in Differentiating Myoblasts

Studies have found that mouse Nfix can inhibit the expression of MSTN, and when Nfix is deficient, muscle regeneration is significantly delayed. This suggests that Nfix may affect the growth and development of mouse skeletal muscle through the regulation of MSTN [28]. Western blotting and qRT-PCR tests confirmed that sheep myoblasts were transduced with lentiviral vectors carrying Nfix overexpression (Plex-Nfix) or negative control (K). The expression of Nfix significantly increased in sheep myoblasts treated with plex-Nfix T1/T3 (Figure 5A). Importantly, the expression of MSTN was upregulated in myotubes where Nfix was knocked out, while the opposite was true for overexpressed Nfix. This confirmed that Nfix can downregulate the expression of MSTN in differentiating sheep myoblasts (Figure 5B–G).

2.6. Detection of the Expression of Differentiation-Related Genes After Nfix Overexpression/Knockout

MSTN primarily plays a role in the TGF-β signaling pathway, inhibiting the proliferation and differentiation of muscle cells by transmitting signals through Smad3 and SMAD4. MyoD is a muscle-specific transcription factor. Although it does not directly belong to the TGF-β signaling pathway, it promotes the differentiation of muscle cells by inhibiting this pathway. Nfix is a nuclear transcription factor that regulates the differentiation of muscle cells, especially in the late stages of differentiation. Overexpression or knockout of the Nfix gene significantly affects the differentiation of sheep myoblasts. To reveal its mechanism, the expression of MSTN, MyoD, Nfix, and SMAD4 was detected by qRT-PCR. The results showed that after the differentiation of sheep myoblasts, the relative expression levels of MyoD and Nfix genes in non-transformed sheep myoblasts were significantly higher than those in Nfix-overexpressing myoblasts (p < 0.01), while the relative expression levels of MSTN and SMAD4 genes in Nfix-overexpressing myoblasts were significantly lower than those in non-transformed cells (p < 0.05, p < 0.01). This indicates that Nfix gene expression can significantly upregulate the expression of MyoD genes. However, the knockout of the Nfix gene led to a significant upregulation of MSTN and SMAD4 genes and a significant downregulation of MyoD and Nfix genes (Figure 6A–H). These results suggest that the Nfix gene promotes the differentiation of myoblasts, leading to a significant upregulation of genes such as MyoD and downregulation of the SMAD4 gene. Conversely, knocking out Nfix expression reverses these gene expression patterns.

2.7. Construction of Nfix–miRNA–MSTN Interaction Regulation Network

In order to further enrich the regulatory mechanism of the NfixMSTN interaction in the proliferation and differentiation process of skeletal muscle cells, a miRNA–gene interaction regulation network was constructed using online databases such as miRWalk, miRDB, RNAInter, and TargetScan. The results showed that 221 miRNAs with potential targeting relationships with Nfix (Figure 7A) and 77 miRNAs with potential targeting relationships with MSTN (Figure 7B) were predicted in the interaction network. After taking the intersection of the above miRNAs, it was found that Nfix and MSTN had five common target miRNAs (Figure 7C), among which miR-423-5p had a regulatory effect on myocyte differentiation. Therefore, we hypothesize that Nfix influences the proliferation and differentiation process of skeletal muscle cells by forming an interaction regulation relationship with MSTN through miRNA (Figure 7D). The specific regulatory mechanism will be further explored in subsequent research.

3. Discussion

The proliferation and differentiation of myocytes are crucial for skeletal muscle development, impacting meat quality and quantity in livestock. Understanding the regulatory mechanisms can improve meat quality and provide insights for therapeutic targets. Prior research found that MYH7B is related to the growth and development of sheep [29]. Additionally, it was found that knocking down SOX6 upregulated slow skeletal muscle protein genes and downregulated fast skeletal muscle protein genes, indicating that MYH7B and RUNX2 are possibly direct targets of SOX6 affecting the muscle development of chickens [30]. Expression profiles indicate that MYH7B is involved in the muscle development of New Zealand white and Fujian yellow rabbits [31]. Relevant studies have shown that mice lacking the transcription factor Nfix experience delayed regeneration and convert to oxidative fiber types [32]. So far, Nfix has been mainly studied in mice. The lack of understanding of its specific functions and signaling mechanisms in sheep skeletal muscle cells underscores the need for further research in this area.
Our research, using CCK-8 assays, immunofluorescence staining, Western blotting, and qRT-PCR, demonstrated that Nfix promotes the proliferation and differentiation of skeletal muscle cells and regulates MSTN expression. MyoD plays a dual role in mediating the proliferation and differentiation of myogenic cells: it is induced by Myf5, activating cyclins and CDKs, leading to myogenic cell proliferation, and it activates CKI, inducing cell cycle arrest and promoting myogenic differentiation. Additionally, MyoD is upregulated by RB, which promotes the expression of cyclins/CDKs and CKIs, mediating cell proliferation and differentiation. RB also regulates myoblast renewal or differentiation by upregulating MyoD or downregulating cyclins and CDKs [33]. Using CRISPR/Cas9 gene editing technology, it was found that knocking out Myomaker and Myomerger separately significantly inhibits myocyte fusion [34]. In cases of Myf5 and MyoD double mutations, MRF4 can maintain the identity of skeletal muscle and partially compensate for the functional loss of MyoD. MRF4 promotes the formation and development of muscle fibers by activating downstream myogenesis-related genes [35]. MSTN limits muscle size by inhibiting the proliferation of muscle stem cells (satellite cells) and promoting their apoptosis [36]. MSTN knockout significantly reduces the proliferation rate of equine muscle satellite cells [37]. While Nfib is expressed in both lung interstitium and epithelium, mice lacking Nfib exhibit severe lung maturation defects and die at birth [38], and Nfix-deficient fetuses show disorganized sarcomerogenesis, likely due to delayed sarcomere assembly, though postnatal sarcomeres appear normal [39]. In summary, these results indicate that Nfix positively regulates myogenesis.
Summarily, Nfix positively regulates myogenesis. Our results indicated that Nfix overexpression upregulated MyoD and downregulated MSTN and SMAD4, suggesting its role in promoting differentiation. Conversely, Nfix knockout had opposite effects. Research has shown that in the Wnt/β-catenin signaling pathway, β-catenin can directly act on MyoD, promoting its binding to the E-box element and enhancing MyoD’s transcriptional activity. Since MyoD is crucial for muscle differentiation, this interaction promotes muscle development. Conversely, when β-catenin is absent or its interaction with MyoD is obstructed, the transcriptional activity of MyoD is suppressed [40]. Blocking the BMP signaling pathway in mice leads to a decrease in the number of skeletal muscle satellite cells, hindering muscle growth [41]. The TGF-β signaling pathway mainly inhibits myogenesis differentiation by suppressing the expression of key myogenic transcription factors such as MyoD and myogenin. This pathway also plays a significant role in muscle regeneration, fiber type conversion, and muscle diseases [42]. Specifically, TGF-β inhibits myogenesis differentiation by activating Smad2/3 and other downstream signaling molecules. When ActRIIB binds with MSTN, it recruits and phosphorylates Smad2/3, activating downstream signaling pathways that ultimately inhibit muscle growth [43].
MicroRNAs (miRNAs) play a role in muscle development. Our results show that Nfix and MSTN share five common target miRNAs, with miR-423-5p playing a regulatory role in skeletal muscle cell differentiation. During muscle cell differentiation, the myogenic transcription factor MyoD upregulates miR-206 expression by binding to the miR-206 promoter, thus enhancing muscle cell differentiation [44]. In mouse C2C12 cells, miR-1a-3p, miR-206-3p, miR-24-3p, and miR-486-5p regulate the differentiation of skeletal muscle cells by targeting the 3′UTR region of the transcription factor MRTF-A [45]. miR-100-5p regulates skeletal muscle myogenesis through the Trib2/mTOR/S6K signaling pathway [46], while miRNA-127 enhances skeletal muscle cells proliferation and differentiation by targeting S1PR3 [47]. Strongly expressed in pig skeletal muscle, miR-423-5p overexpression significantly reduces the expression of MyoD and myogenesis differentiation antigens [48]. During mouse embryo development, the high expression of Cyclin E in embryonic stem cells is due to the transcriptional activation of the transcription factor Esrrb, working in synergy with its negative regulator miR-15a [49].
Although our study has preliminarily demonstrated that Nfix influences the proliferation and differentiation of myoblasts, we acknowledge several limitations. One limitation is the relatively small sample, which might constrain the generalizability of the findings. Another limitation is the need for further validation of the interactive regulatory relationship between Nfix, miRNA, and MSTN. Clarifying the primary pathway through which Nfix inhibits MSTN to regulate muscle development is essential. Additionally, exploring other potential roles of Nfix could enrich our understanding. Addressing these limitations will enhance the credibility of our research and offer a more comprehensive perspective.

4. Methods

4.1. Animal Sample

We chose five healthy adult Chinese merino sheep from each period, all exhibiting good physical health. Samples were collected on the 35th (D35), 40th (D40), and 45th (D45) days of pregnancy for transcriptomic analysis. We also collected the longissimus dorsi muscle from a healthy Chinese merino sheep fetus at 135 days of gestation. To isolate mature muscle cells from the sheep, we used a two-step enzyme digestion method with yype I collagenase and trypsin. All samples were provided by the sheep farm of the Biotechnology Research Institute of Xinjiang Academy of Animal Science.
This study was conducted in accordance with the ethical guidelines of the Institutional Animal Care and Use Committee of the Xinjiang Academy of Animal Science, Urumqi, China (approval 2016ZX08010-004-009). The Chinese merino fine-wool sheep used in this research were maintained in optimal conditions at the Research Base of Sheep Breeding of the Xinjiang Academy of Animal Science. Surgical procedures were performed under strict aseptic protocols to minimize animal suffering. All animal handling and experimental procedures were carried out with a focus on ethical standards and the welfare of the animals involved, ensuring their humane treatment throughout the study.

4.2. Cell Culture and Reagents

The sheep myoblast cells (Culture Collection of Institute of Biotechnology, Xinjiang Academy of Animal Science, Xingjiang, China) were digested at 37 °C under constant shaking with a solution containing collagenase I (100 mg/mL, Sigma-Aldrich, St. Louis, MO, USA). The cells were then cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, NY, USA) containing 20% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA) and 1% penicillin–streptomycin. For differentiation, samples were switched to DMEM supplemented with 2% horse serum (Gibco, Grand Island, NY, USA). The medium was changed every alternate day. The incubation environment was set to 37 °C and 5%CO2.

4.3. Vector Construction and Transfection

Sheep Nfix complementary DNA (cDNA) and Exon 2 (GenBank accession number XM_027969535.2) were amplified by polymerase chain reaction (PCR).
An HA sequence was added at the 3′ end for the detection of Nfix expressed protein (HA tag: TACCCATACGACGTCCCAGACTACGCT). These were then cloned into the Plex-mcs and lentiCRISPRv2-Puro vector from our laboratory. To investigate the effects of sheep Nfix on myoblasts, 293T cells were transiently transfected with Nfix overexpression and knockout plasmids. The packaging plasmids (psPAX2 and pMD2.G) were co-transfected into 293T cells for lentivirus packaging using the liposome transfection method. The transfection was performed using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The filtered supernatant was used immediately to infect the target cells. Primer sequences are listed in Table 2.

4.4. Cell Proliferation Assay

The proliferation of the control and overexpression groups or knockout groups were analyzed using a microscope (Leica, Heidelberg, Germany). Cell proliferation was quantified using the Cell Counting Kit 8 (CCK-8) assay, performed as previously described. Briefly, negative control (K) and transfected cells were incubated with 10% CCK-8 solution (Beyotime Biotechnology, Shanghai, China) at 37 °C for 1 h in the dark. The absorbance was then measured at 450 nm to determine the proliferation ability.

4.5. Immunofluorescence Staining

Cells were fixed in 4% paraformaldehyde after washing with PBS. The fixed cells were then permeabilized with 0.5% Triton X-100 and blocked for 20 min. After that, 5% BSA was added and the cells were sealed for 30 min, followed by washing with PBS three times, each for 5 min. The cells were then incubated overnight with mouse desmin antibody (22170110; Sigma, St. Louis, MO, USA, 1:150) at 4 degrees Celsius. Finally, the cells were incubated with FITC-labeled goat anti-mouse secondary antibodies (1:100) (ZF-0313; ZSGB-BIO, Beijing, China, 1:400) for 30 min at room temperature (about 25 degrees Celsius) and with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole) for 5 min. Digital images were captured using a fluorescence microscope (Leica image analysis system, model Q500MC).

4.6. Protein Extraction, Denaturation, and Expression Analysis

Transfected cells were lysed in RIPA buffer with 1% PMSF, and the protein was loaded onto an SDS-PAGE gel and transferred onto a PVDF membrane. Non-specific binding was blocked with 5% non-fat milk in Tris-buffered saline with Tween 20 for 2 h. Then, the proteins were incubated overnight with β-actin (GB1500, 11:1500, Servicebio, Wuhan, Hubei, China) as the internal reference, MSTN (TD13273, 1:1000, Abmart, Shanghai, China) as the target, and monoclonal anti-HA (H3663, 1:1500, Sigma, St. Louis, MO, USA) as a tag at 4 °C. The blots were subsequently incubated with goat anti-mouse (A0216, Beyotime, Haimen, Jiangsu, China) and goat anti-rabbit (A208, Beyotime). ECL substrates were used to visualize the signals (Beyotime, Haimen, Jiangsu, China, P0018A). ImageJ software (version 1.53e) was used to conduct a quantitative analysis of the Western blotting results according to the gray value of the strip.

4.7. RNA Extraction, cDNA Synthesis, and Expression Analysis

Total RNA from cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions and then reverse-transcribed into cDNA using a transcriptase kit (TIANGEN, Beijing, China). For expression analysis, quantitative real-time PCR (qRT-PCR) was carried out on a Bio-Rad PCR system using SYBR Green Master Mix (TIANGEN, Beijing, China) and gene-specific primers. GAPDH was used as an internal control. Fold changes in the indicated genes were analyzed using the 2−∆∆CT method. Primer sequences are listed in Table 3.

4.8. Statistical Analysis

Results are expressed as the means ± standard error of the mean (SEM). Statistical differences between groups were determined using one-way ANOVA and two-way ANOVA [50], and a p-value < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). GraphPad Prism 10.1.2 was used for data processing and graphing. To ensure the validity of the ANOVA results, we verified the assumptions of normality and homogeneity of variances using Shapiro–Wilk and Levene’s tests, respectively. Tukey’s HSD test was used for post hoc comparisons to identify significant differences between specific groups.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms252211988/s1.

Author Contributions

Investigation, N.Z.; data curation, X.Z. and L.L.; writing—original draft, M.Q.; writing—review and editing, M.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Natural Science Foundation of Xinjiang Uygur Autonomous Region (2022D01B176), the second batch of the Tianshan Talent Training Program Youth Support Talent Lifting Project (2023TSYCQNTJ0021), and the Scientific and Technological Innovation Team Project of Xinjiang Uygur Autonomous Region (2023TSYCTD0007).

Institutional Review Board Statement

This study was conducted in accordance with the ethical guidelines of the Institutional Animal Care and Use Committee of the Xinjiang Academy of Animal Science, Urumqi, China.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank Li Liao for the Nfix construct and Mingjun Liu for his priceless support and suggestions, as well as for his critical reading of the manuscript. We also thank Xuemei Zhang, Weiwei Duan, Zhenzhen Gu, Ning Zhang, Wenrong Li, and Chenxi Liu for their invaluable support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Biressi, S.; Molinaro, M.; Cossu, G. Cellular heterogeneity during vertebrate skeletal muscle development. Dev. Biol. 2007, 308, 281–293. [Google Scholar] [CrossRef]
  2. Biressi, S.; Tagliafico, E.; Lamorte, G.; Monteverde, S.; Tenedini, E.; Roncaglia, E.; Ferrari, S.; Ferrari, S.; Angelis, M.G.C.D.; Tajbakhsh, S.; et al. Intrinsic phenotypic diversity of embryonic and fetal myoblasts is revealed by genome-wide gene expression analysis on purified cells. Dev. Biol. 2007, 304, 633–651. [Google Scholar] [CrossRef] [PubMed]
  3. Hutcheson, D.A.; Zhao, J.; Merrell, A.; Haldar, M.; Kardon, G. Embryonic and fetal limb myogenic cells are derived from developmentally distinct progenitors and have different requirements for β-catenin. Genes Dev. 2009, 23, 997–1013. [Google Scholar] [CrossRef] [PubMed]
  4. Ross, J.J.; Duxson, M.J.; Harris, A.J. Formation of primary and secondary myotubes in rat lumbrical muscles. Development 1987, 100, 383–394. [Google Scholar] [CrossRef] [PubMed]
  5. Wilson, S.J.; McEwan, J.C.; Sheard, P.W.; Harris, A.J. Early stages of myogenesis in a large mammal: Formation of successive generations of myotubes in sheep tibialis cranialis muscle. J. Muscle Res. Cell Motil. 1992, 13, 534–550. [Google Scholar] [CrossRef]
  6. Picard, B.; Lefaucheur, L.; Berri, C.; Duclos, M.J. Muscle fibre ontogenesis in farm animal species. Reprod. Nutr. Dev. 2002, 42, 415–431. [Google Scholar] [CrossRef]
  7. Chaudhry, A.Z.; Lyons, G.E.; Gronostajski, R.M. Expression patterns of the four nuclear factor I genes during mouse embryogenesis indicate a potential role in development. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 1997, 208, 313–325. [Google Scholar] [CrossRef]
  8. Kruse, U.; Sippel, A.E. Transcription factor nuclear factor I proteins form stable homo-and heterodimers. FEBS Lett. 1994, 348, 46–50. [Google Scholar] [CrossRef]
  9. Gronostajski, R.M.; Adhya, S.; Nagata, K.; Guggenheimer, R.A.; Hurwitz, J. Site-specific DNA binding of nuclear factor I: Analyses of cellular binding sites. Mol. Cell. Biol. 1985, 5, 964–971. [Google Scholar]
  10. Messina, G.; Biressi, S.; Monteverde, S.; Magli, A.; Cassano, M.; Perani, L.; Roncaglia, E.; Tagliafico, E.; Starnes, L.; Campbell, C.E.; et al. Nfix regulates fetal-specific transcription in developing skeletal muscle. Cell 2010, 140, 554–566. [Google Scholar] [CrossRef]
  11. Darville, M.I.; Antoine, I.V.; Rousseau, G.G. Characterization of an enhancer upstream from the muscle-type promoter of a gene encoding 6–phosphofructo–2–kinase/fructose–2, 6–bisphosphatase. Nucleic Acids Res. 1992, 20, 3575–3583. [Google Scholar] [CrossRef] [PubMed]
  12. Edmondson, D.G.; Cheng, T.C.; Cserjesi, P.; Chakraborty, T.; Olson, E.N. Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Mol. Cell. Biol. 1992, 12, 3665–3677. [Google Scholar] [PubMed]
  13. Campbell, C.E.; Piper, M.; Plachez, C.; Yeh, Y.T.; Baizer, J.S.; Osinski, J.M.; Litwack, E.D.; Richards, L.J.; Gronostajski, R.M. The transcription factor Nfixis essential for normal brain development. BMC Dev. Biol. 2008, 8, 52. [Google Scholar] [CrossRef] [PubMed]
  14. Taglietti, V.; Maroli, G.; Cermenati, S.; Monteverde, S.; Ferrante, A.; Rossi, G.; Cossu, G.; Beltrame, M.; Messina, G. Nfix induces a switch in Sox6 transcriptional activity to regulate MyHC-I expression in fetal muscle. Cell Rep. 2016, 17, 2354–2366. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, D.; Black, B.L.; Derynck, R. TGF-β inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev. 2001, 15, 2950–2966. [Google Scholar] [CrossRef]
  16. Girardi, F.; Taleb, A.; Ebrahimi, M.; Datye, A.; Gamage, D.G.; Peccate, C.; Giordani, L.; Millay, D.P.; Gilbert, P.M.; Cadot, B.; et al. TGFβ signaling curbs cell fusion and muscle regeneration. Nat. Commun. 2021, 12, 750. [Google Scholar] [CrossRef]
  17. Ríos, R.; Carneiro, I.; Arce, V.M.; Devesa, J. Myostatin is an inhibitor of myogenic differentiation. Am. J. Physiol.-Cell Physiol. 2002, 282, C993–C999. [Google Scholar] [CrossRef]
  18. Lee, S.J. Quadrupling muscle mass in mice by targeting TGF-ß signaling pathways. PLoS ONE 2007, 2, e789. [Google Scholar] [CrossRef]
  19. Mullen, A.C.; Orlando, D.A.; Newman, J.J.; Lovén, J.; Kumar, R.M.; Bilodeau, S.; Reddy, J.; Guenther, M.G.; DeKoter, R.P.; Young, R.A. Master transcription factors determine cell-type-specific responses to TGF-β signaling. Cell 2011, 147, 565–576. [Google Scholar] [CrossRef]
  20. McCroskery, S.; Thomas, M.; Maxwell, L.; Sharma, M.; Kambadur, R. Myostatin negatively regulates satellite cell activation and self-renewal. J. Cell Biol. 2003, 162, 1135–1147. [Google Scholar] [CrossRef]
  21. Crispo, M.; Mulet, A.P.; Tesson, L.; Barrera, N.; Cuadro, F.; dos Santos-Neto, P.C.; Nguyen, T.H.; Crénéguy, A.; Brusselle, L.; Anegón, I.; et al. Efficient generation of myostatin knock-out sheep using CRISPR/Cas9 technology and microinjection into zygotes. PLoS ONE 2015, 10, e0136690. [Google Scholar] [CrossRef] [PubMed]
  22. Clop, A.; Marcq, F.; Takeda, H.; Pirottin, D.; Tordoir, X.; Bibé, B.; Bouix, J.; Caiment, F.; Elsen, J.M.; Francis Eychenne, F.; et al. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 2006, 38, 813–818. [Google Scholar] [CrossRef] [PubMed]
  23. Soriano-Arroquia, A.; McCormick, R.; Molloy, A.P.; McArdle, A.; Goljanek-Whysall, K. Age-related changes in miR-143-3p: Igfbp5 interactions affect muscle regeneration. Aging Cell 2016, 15, 361–369. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, D.; Ran, J.; Li, J.; Yu, C.; Cui, Z.; Amevor, F.K.; Wang, Y.; Jiang, X.; Qiu, M.; Du, H.; et al. miR-21-5p regulates the proliferation and differentiation of skeletal muscle satellite cells by targeting KLF3 in chicken. Genes 2021, 12, 814. [Google Scholar] [CrossRef]
  25. Nguyen, M.T.; Lee, W. MiR-320-3p regulates the proliferation and differentiation of myogenic progenitor cells by modulating actin remodeling. Int. J. Mol. Sci. 2022, 23, 801. [Google Scholar] [CrossRef]
  26. Zhu, Y.; Li, P.; Dan, X.; Kang, X.; Y Ma, Y.; Shi, Y. miR-377 Inhibits Proliferation and Differentiation of Bovine Skeletal Muscle Satellite Cells by Targeting FHL2. Genes 2022, 13, 947. [Google Scholar] [CrossRef]
  27. Zhang, W.; Wang, S.Y.; Deng, S.Y.; Gao, L.; Yang, L.W.; Liu, X.N.; Shi, G.Q. MiR-27b promotes sheep skeletal muscle satellite cell proliferation by targeting myostatin gene. J. Genet. 2018, 97, 1107–1117. [Google Scholar] [CrossRef]
  28. Rossi, G.; Antonini, S.; Bonfanti, C.; Monteverde, S.; Vezzali, C.; Tajbakhsh, S.; Cossu, G.; Messina, G. Nfix regulates temporal progression of muscle regeneration through modulation of myostatin expression. Cell Rep. 2016, 14, 2238–2249. [Google Scholar] [CrossRef]
  29. Yang, P.; Shang, M.; Bao, J.; Liu, T.; Xiong, J.; Huang, J.; Sun, J.; Zhang, L. Whole-Genome Resequencing Revealed Selective Signatures for Growth Traits in Hu and Gangba Sheep. Genes 2024, 15, 551. [Google Scholar] [CrossRef]
  30. Liu, Y.F.; Zhang, M.; Shan, Y.J.; Pang, L.C.; Ji, G.G.; Ju, X.J.; Tu, Y.J.; Shi, S.Y.; Bai, H.; Zou, J.M.; et al. Transcriptome sequencing analysis of the role of miR-499-5p and SOX6 in chicken skeletal myofiber specification. Front. Genet. 2022, 13, 1008649. [Google Scholar] [CrossRef]
  31. Wang, W.Z.; Li, T.; Shi, L.J.; Yan, X.R.; Pan, Y.L.; Wu, X.S. Screening of differentially-expressed genes in the muscles of rabbit breeds with expression profile chip. Genet. Mol. Res. 2015, 14, 8038–8045. [Google Scholar] [CrossRef] [PubMed]
  32. Rossi, G.; Bonfanti, C.; Antonini, S.; Bastoni, M.; Monteverde, S.; Innocenzi, A.; Saclier, M.; Taglietti, V.; Messina, G. Silencing Nfix rescues muscular dystrophy by delaying muscle regeneration. Nat. Commun. 2017, 8, 1055. [Google Scholar] [CrossRef] [PubMed]
  33. Kitzmann, M.; Fernandez, A. Crosstalk between cell cycle regulators and the myogenic factor MyoD in skeletal myoblasts. Cell. Mol. Life Sci. CMLS 2001, 58, 571–579. [Google Scholar] [CrossRef]
  34. Quinn, M.E.; Goh, Q.; Kurosaka, M.; Gamage, D.G.; Petrany, M.J.; Prasad, V.; Millay, D.P. Myomerger induces fusion of non-fusogenic cells and is required for skeletal muscle development. Nat. Commun. 2017, 8, 15665. [Google Scholar] [CrossRef]
  35. Kassar-Duchossoy, L.; Gayraud-Morel, B.; Gomès, D.; Rocancourt, D.; Buckingham, M.; Shinin, V.; Tajbakhsh, S. Mrf4 determines skeletal muscle identity in Myf5: Myod double-mutant mice. Nature 2004, 431, 466–471. [Google Scholar] [CrossRef] [PubMed]
  36. McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-p superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef] [PubMed]
  37. Budsuren, U.; Ulaangerel, T.; Shen, Y.; Liu, G.; Davshilt, T.; Yi, M.; Bold, D.; Zhang, X.; Bai, D.; Dorjgotov, D.; et al. MSTN regulatory network in Mongolian horse muscle satellite cells revealed with miRNA interference technologies. Genes 2022, 13, 1836. [Google Scholar] [CrossRef]
  38. Hsu, Y.C.; Osinski, J.; Campbell, C.E.; Litwack, C.D.; Wang, D.; Liu, S.; Bachurski, C.J.; Gronostajski, R.M. Mesenchymal nuclear factor IB regulates cell proliferation and epithelial differentiation during lung maturation. Dev. Biol. 2011, 354, 242–252. [Google Scholar] [CrossRef]
  39. Siedner, S.; Krüger, M.; Schroeter, M.; Metzler, D.; Roell, W.; Fleischmann, B.K.; Juergen Hescheler, J.; Pfitzer, G.; Stehle, R. Developmental changes in contractility and sarcomeric proteins from the early embryonic to the adult stage in the mouse heart. J. Physiol. 2003, 548, 493–505. [Google Scholar] [CrossRef]
  40. Kim, C.H.; Neiswender, H.; Baik, E.J.; Xiong, W.C.; Mei, L. β-Catenin interacts with MyoD and regulates its transcription activity. Mol. Cell. Biol. 2008, 28, 2941–2951. [Google Scholar] [CrossRef]
  41. Stantzou, A.; Schirwis, E.; Swist, S.; Alonso-Martin, S.; Polydorou, I.; Zarrouki, F.; Mouisel, E.; Beley, C.; Julien, A.; Grand, F.J.; et al. BMP signaling regulates satellite cell-dependent postnatal muscle growth. Development 2017, 144, 2737–2747. [Google Scholar] [CrossRef] [PubMed]
  42. Accornero, F.; Kanisicak, O.; Tjondrokoesoemo, A.; Attia, A.C.; McNally, E.M.; Molkentin, J.D. Myofiber-specific inhibition of TGFβ signaling protects skeletal muscle from injury and dystrophic disease in mice. Hum. Mol. Genet. 2014, 23, 6903–6915. [Google Scholar] [CrossRef] [PubMed]
  43. Sartori, R.; Milan, G.; Patron, M.; Mammucari, C.; Blaauw, B.; Abraham, R.; Sandri, M. Smad2 and 3 transcription factors control muscle mass in adulthood. Am. J. Physiol.-Cell Physiol. 2009, 296, C1248–C1257. [Google Scholar] [CrossRef] [PubMed]
  44. Koutalianos, D.; Koutsoulidou, A.; Mastroyiannopoulos, N.P.; Furling, D.; Phylactou, L.A. MyoD transcription factor induces myogenesis by inhibiting Twist-1 through miR-206. J. Cell Sci. 2015, 128, 3631–3645. [Google Scholar]
  45. Holstein, I.; Singh, A.K.; Pohl, F.; Misiak, D.; Braun, J.; Leitner, L.; Hüttelmaier, S.; Posern, G. Post-transcriptional regulation of MRTF-A by miRNAs during myogenic differentiation of myoblasts. Nucleic Acids Res. 2020, 48, 8927–8942. [Google Scholar] [CrossRef]
  46. Wang, K.; Liufu, S.; Yu, Z.; Yu, Z.; Xu, X.; Ai, N.; Li, X.; Liu, X.; Chen, B.; Zhang, Y.; et al. miR-100-5p regulates skeletal muscle myogenesis through the Trib2/mTOR/S6K signaling pathway. Int. J. Mol. Sci. 2023, 24, 8906. [Google Scholar] [CrossRef]
  47. Zhai, L.; Wu, R.; Han, W.; Yong Zhang, Y.; Zhu, D. miR-127 enhances myogenic cell differentiation by targeting S1PR3. Cell Death Dis. 2017, 8, e2707. [Google Scholar] [CrossRef] [PubMed]
  48. Pang, Y.; Liang, J.; Huang, J.; Lan, G.; Chen, F.; Ji, H.; Zhao, Y. miR-423-5p Regulates Skeletal Muscle Growth and Development by Negatively Inhibiting Target Gene SRF. Genes 2024, 15, 606. [Google Scholar] [CrossRef]
  49. Gonnot, F.; Langer, D.; Bourillot, P.Y.; Doerflinger, N.; Savatier, P. Regulation of Cyclin E by transcription factors of the naïve pluripotency network in mouse embryonic stem cells. Cell Cycle 2019, 18, 2697–2712. [Google Scholar] [CrossRef]
  50. Seo, S.; Jeon, S.; Ha, J.K. Guidelines for experimental design and statistical analyses in animal studies submitted for publication in the Asian-Australasian Journal of Animal Sciences. Asian-Australas. J. Anim. Sci. 2018, 31, 1381. [Google Scholar] [CrossRef]
Figure 1. Temporal analysis screens of potential target genes related to skeletal muscle development. (A) Schematic diagram of differential analysis of embryo muscle sample transcriptome data. (B) Volcano plot of re-analyzed differential genes in 45vs40 group. (C) Chromosome distribution of re-analyzed differential genes in 45vs40 group. (D) Temporal analysis to screen continuously upregulated protein-coding genes. (E) Venn diagram to screen 48 continuously upregulated differential protein-coding genes.
Figure 1. Temporal analysis screens of potential target genes related to skeletal muscle development. (A) Schematic diagram of differential analysis of embryo muscle sample transcriptome data. (B) Volcano plot of re-analyzed differential genes in 45vs40 group. (C) Chromosome distribution of re-analyzed differential genes in 45vs40 group. (D) Temporal analysis to screen continuously upregulated protein-coding genes. (E) Venn diagram to screen 48 continuously upregulated differential protein-coding genes.
Ijms 25 11988 g001
Figure 2. Lentivirus infection of 293T and sheep myoblast cells. (A) Plex-NfixT1 plasmid. (B) Plex-NfixT3 plasmid. (C) Plex-GFP virus infection of 293T cells under bright field. (D) Plex-GFP virus infection of 293T cells under FITC condition. (E) Plex-GFP virus infection of sheep myoblast cells under bright field. (F) Plex-GFP virus infection of sheep myoblast cells under FITC condition. The scales are all 100 µm.
Figure 2. Lentivirus infection of 293T and sheep myoblast cells. (A) Plex-NfixT1 plasmid. (B) Plex-NfixT3 plasmid. (C) Plex-GFP virus infection of 293T cells under bright field. (D) Plex-GFP virus infection of 293T cells under FITC condition. (E) Plex-GFP virus infection of sheep myoblast cells under bright field. (F) Plex-GFP virus infection of sheep myoblast cells under FITC condition. The scales are all 100 µm.
Ijms 25 11988 g002
Figure 3. Nfix promotes myoblast proliferation. (A) CCK-8 cell proliferation assay after overexpression of Nfix. (B) CCK-8 cell proliferation assay after knockout of Nfix. Statistical differences between groups were determined using two-way ANOVA, and a p-value < 0.05 was considered statistically significant (** p < 0.01). K indicates a negative control.
Figure 3. Nfix promotes myoblast proliferation. (A) CCK-8 cell proliferation assay after overexpression of Nfix. (B) CCK-8 cell proliferation assay after knockout of Nfix. Statistical differences between groups were determined using two-way ANOVA, and a p-value < 0.05 was considered statistically significant (** p < 0.01). K indicates a negative control.
Ijms 25 11988 g003
Figure 4. Nfix improved cell differentiation. (A,B) Immunofluorescence staining for desmin protein in Nfix-overexpressing or Nfix-knockout-treated myoblasts that were cultured for five days in differentiation medium. Desmin and the nucleus are stained in green and blue (DAPl), respectively. (C) The expression of genes after overexpression of Nfix. (D) Expression of genes after knockout of Nfix. (E) Expression of Nfix at different time points. Statistical differences between groups were determined using one-way ANOVA, and a p-value < 0.05 was considered statistically significant ** p < 0.01). K indicates a negative control. The scales are all 100 µm.
Figure 4. Nfix improved cell differentiation. (A,B) Immunofluorescence staining for desmin protein in Nfix-overexpressing or Nfix-knockout-treated myoblasts that were cultured for five days in differentiation medium. Desmin and the nucleus are stained in green and blue (DAPl), respectively. (C) The expression of genes after overexpression of Nfix. (D) Expression of genes after knockout of Nfix. (E) Expression of Nfix at different time points. Statistical differences between groups were determined using one-way ANOVA, and a p-value < 0.05 was considered statistically significant ** p < 0.01). K indicates a negative control. The scales are all 100 µm.
Ijms 25 11988 g004
Figure 5. Nfix regulates MSTN expression in differentiating myoblasts. (A) Western blotting for HA protein in Nfix overexpression. (B) Western blotting for MSTN protein in Nfix overexpression. (C) Western blotting for MSTN protein in Nfix knockout. (D) The expression of genes after overexpression of Nfix. (E) The expression of genes after knockout of Nfix. (F) The expression of genes after overexpression of MSTN. (G) The expression of genes after knockout of MSTN. Statistical differences between groups were determined using one-way ANOVA, and a p-value < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). K indicates a negative control. β-actin was used to normalize.
Figure 5. Nfix regulates MSTN expression in differentiating myoblasts. (A) Western blotting for HA protein in Nfix overexpression. (B) Western blotting for MSTN protein in Nfix overexpression. (C) Western blotting for MSTN protein in Nfix knockout. (D) The expression of genes after overexpression of Nfix. (E) The expression of genes after knockout of Nfix. (F) The expression of genes after overexpression of MSTN. (G) The expression of genes after knockout of MSTN. Statistical differences between groups were determined using one-way ANOVA, and a p-value < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). K indicates a negative control. β-actin was used to normalize.
Ijms 25 11988 g005
Figure 6. The expression of regulatory genes for the induction and differentiation into myocytes. (A) The expression of genes after overexpression of Nfix. (B) The expression of genes after knockout of Nfix. (C) The expression of genes after overexpression of MSTN. (D) The expression of genes after knockout of MSTN. (E) The expression of genes after overexpression of MyoD. (F) The expression of genes after knockout of MyoD. (G) The expression of genes after overexpression of SMAD4. (H) The expression of genes after knockout of SMAD4. Statistical differences between groups were determined using one-way ANOVA, and a p-value < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). K indicates a negative control.
Figure 6. The expression of regulatory genes for the induction and differentiation into myocytes. (A) The expression of genes after overexpression of Nfix. (B) The expression of genes after knockout of Nfix. (C) The expression of genes after overexpression of MSTN. (D) The expression of genes after knockout of MSTN. (E) The expression of genes after overexpression of MyoD. (F) The expression of genes after knockout of MyoD. (G) The expression of genes after overexpression of SMAD4. (H) The expression of genes after knockout of SMAD4. Statistical differences between groups were determined using one-way ANOVA, and a p-value < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). K indicates a negative control.
Ijms 25 11988 g006
Figure 7. Construction of Nfix–miRNA–MSTN interaction regulation network. (A) Prediction of miRNAs interacting with Nfix in four databases. (B) Prediction of miRNAs interacting with MSTN in four databases. (C) Common target miRNAs of Nfix and MSTN. (D) Nfix–miRNA–MSTN interaction regulation network.
Figure 7. Construction of Nfix–miRNA–MSTN interaction regulation network. (A) Prediction of miRNAs interacting with Nfix in four databases. (B) Prediction of miRNAs interacting with MSTN in four databases. (C) Common target miRNAs of Nfix and MSTN. (D) Nfix–miRNA–MSTN interaction regulation network.
Ijms 25 11988 g007
Table 1. Top 10 potential genes with relatively high expression levels.
Table 1. Top 10 potential genes with relatively high expression levels.
Gene NameD45_FPKMD40_FPKMLog2 Fold Changep-Valuepadj
COL1A11380.63389.612.102.77 × 10−292.46 × 10−26
KERA91.8129.501.933.51 × 10−239.24 × 10−21
DLC139.2833.851.575.94 × 10−284.44 × 10−25
MYH7B34.6210.981.883.43 × 10−183.62 × 10−16
AEBP121.778.371.661.71 × 10−171.57 × 10−15
NFIX20.289.161.622.26 × 10−138.88 × 10−12
HIF3A19.436.281.922.36 × 10−193.09 × 10−17
SSC5D12.675.171.605.37 × 10−153.04 × 10−13
RYR310.954.301.596.89 × 10−164.52 × 10−14
CAMTA210.804.621.532.38 × 10−141.17 × 10−12
Table 2. Nucleotide sequence of primers related to cloning the Nfix-sgRNA/Plex-Nfix expression vector.
Table 2. Nucleotide sequence of primers related to cloning the Nfix-sgRNA/Plex-Nfix expression vector.
GenePrimer Sequence (5′→3′)
Nfix-Fccgactctactagaggatccactagtgccaccatgtactccccgtactgcctcacccag
Nfix-Rgacgcgtcgggccctctagactcgagtcaagcgtagtctgggacgtcgtatgggtagag
Nfix-sgRNA-CF1CaccgACTTGCGCTTCCGCGCCTGC
Nfix-sgRNA-CR1aaacGCAGGCGCGGAAGCGCAAGTc
Nfix-sgRNA-CF2CaccgGGGGGGCTTCTTGCCCGTGA
Nfix-sgRNA-CR2aaacTCACGGGCAAGAAGCCCCCCc
Nfix-sgRNA-CF3CaccgACCAGAAGGGCAAGATCCGG
Nfix-sgRNA-CR3aaacCCGGATCTTGCCCTTCTGGTc
Note: The text in bold represents the BsmB I enzyme cut site.
Table 3. Sequences of real-time fluorescent quantitative PCR-related primers.
Table 3. Sequences of real-time fluorescent quantitative PCR-related primers.
GenePrimer Sequence (5′→3′)Annealing Temperature (°C)Product Length (bp)
MSTNF:GTGATGAGCACTCCACAGAA60118
R:CCAGAGCAGTAATTGGCCTT
SMAD4F:ACACACCTAATTTGCCTCAC60124
R:TTAGAAATAGGAGGCTGGAA
MyoDF:CGACTCGGACGCTTCCAGT60105
R:TAAGCGCGGTCGTAGCAGTT
NfixF:GCCCGAGATCAAGCAGAAGTG60176
R:CCTGGCGAAGGCAGTCAATCC
GAPDHF:GAAGGTCGGAGTGAACGGATT60217
R:GGTCATAAGTCCCTCCACGAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Qiu, M.; Zhang, X.; Liao, L.; Zhang, N.; Liu, M. Regulatory Role of Nfix Gene in Sheep Skeletal Muscle Cell Development and Its Interaction Mechanism with MSTN. Int. J. Mol. Sci. 2024, 25, 11988. https://doi.org/10.3390/ijms252211988

AMA Style

Qiu M, Zhang X, Liao L, Zhang N, Liu M. Regulatory Role of Nfix Gene in Sheep Skeletal Muscle Cell Development and Its Interaction Mechanism with MSTN. International Journal of Molecular Sciences. 2024; 25(22):11988. https://doi.org/10.3390/ijms252211988

Chicago/Turabian Style

Qiu, Meiyu, Xuemei Zhang, Li Liao, Ning Zhang, and Mingjun Liu. 2024. "Regulatory Role of Nfix Gene in Sheep Skeletal Muscle Cell Development and Its Interaction Mechanism with MSTN" International Journal of Molecular Sciences 25, no. 22: 11988. https://doi.org/10.3390/ijms252211988

APA Style

Qiu, M., Zhang, X., Liao, L., Zhang, N., & Liu, M. (2024). Regulatory Role of Nfix Gene in Sheep Skeletal Muscle Cell Development and Its Interaction Mechanism with MSTN. International Journal of Molecular Sciences, 25(22), 11988. https://doi.org/10.3390/ijms252211988

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop