Influence of Acute Inflammation on the Expression of Clock Genes in the Ovine Pars Tuberalis Under Different Photoperiodic Conditions
Abstract
1. Introduction
2. Results
Effect of LPS Administration on the Expression of Clock Genes in the PT
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Analysis of Relative Gene Expression by RT-qPCR
4.3. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, J.-M.; Yang, Y.-M.; Xu, W.; Li, X.-D. Regulation of Circadian Physiology and Behavior by Light in Mammals: Entrainment and Masking. Life Res. 2024, 7, 7. [Google Scholar] [CrossRef]
- Shinomiya, A.; Shimmura, T.; Nishiwaki-Ohkawa, T.; Yoshimura, T. Regulation of Seasonal Reproduction by Hypothalamic Activation of Thyroid Hormone. Front. Endocrinol. 2014, 5, 12. [Google Scholar] [CrossRef] [PubMed]
- Rosa, H.J.D.; Bryant, M.J. Seasonality of Reproduction in Sheep. Small Rumin. Res. 2003, 48, 155–171. [Google Scholar] [CrossRef]
- Astiz, M.; Heyde, I.; Oster, H. Mechanisms of Communication in the Mammalian Circadian Timing System. Int. J. Mol. Sci. 2019, 20, 343. [Google Scholar] [CrossRef]
- Landgraf, D.; McCarthy, M.J.; Welsh, D.K. Circadian Clock and Stress Interactions in the Molecular Biology of Psychiatric Disorders. Curr. Psychiatry Rep. 2014, 16, 483. [Google Scholar] [CrossRef]
- Carter, S.J.; Durrington, H.J.; Gibbs, J.E.; Blaikley, J.; Loudon, A.S.; Ray, D.W.; Sabroe, I. A Matter of Time: Study of Circadian Clocks and Their Role in Inflammation. J. Leukoc. Biol. 2016, 99, 549–560. [Google Scholar] [CrossRef]
- Stehle, J.H.; Von Gall, C.; Korf, H.-W. Melatonin: A Clock-Output, A Clock-Input. J. Neuroendocrinol. 2003, 15, 383–389. [Google Scholar] [CrossRef]
- Ahmad, S.B.; Ali, A.; Bilal, M.; Rashid, S.M.; Wani, A.B.; Bhat, R.R.; Rehman, M.U. Melatonin and Health: Insights of Melatonin Action, Biological Functions, and Associated Disorders. Cell. Mol. Neurobiol. 2023, 43, 2437–2458. [Google Scholar] [CrossRef]
- Pfeffer, M.; Korf, H.-W.; Wicht, H. Synchronizing Effects of Melatonin on Diurnal and Circadian Rhythms. Gen. Comp. Endocrinol. 2018, 258, 215–221. [Google Scholar] [CrossRef]
- Reiter, R.J.; Tan, D.X.; Kim, S.J.; Cruz, M.H.C. Delivery of Pineal Melatonin to the Brain and SCN: Role of Canaliculi, Cerebrospinal Fluid, Tanycytes and Virchow–Robin Perivascular Spaces. Brain Struct. Funct. 2014, 219, 1873–1887. [Google Scholar] [CrossRef]
- Acuña-Castroviejo, D.; Rahim, I.; Acuña-Fernández, C.; Fernández-Ortiz, M.; Solera-Marín, J.; Sayed, R.K.A.; Díaz-Casado, M.E.; Rusanova, I.; López, L.C.; Escames, G. Melatonin, Clock Genes and Mitochondria in Sepsis. Cell. Mol. Life Sci. 2017, 74, 3965–3987. [Google Scholar] [CrossRef] [PubMed]
- Tsang, A.H.; Astiz, M.; Friedrichs, M.; Oster, H. Endocrine Regulation of Circadian Physiology. J. Endocrinol. 2016, 230, R1–R11. [Google Scholar] [CrossRef] [PubMed]
- Gamble, K.L.; Berry, R.; Frank, S.J.; Young, M.E. Circadian Clock Control of Endocrine Factors. Nat. Rev. Endocrinol. 2014, 10, 466–475. [Google Scholar] [CrossRef] [PubMed]
- Mahoney, M.M.; Sisk, C.; Ross, H.E.; Smale, L. Circadian Regulation of Gonadotropin-Releasing Hormone Neurons and the Preovulatory Surge in Luteinizing Hormone in the Diurnal Rodent, Arvicanthis Niloticus, and in a Nocturnal Rodent, Rattus Norvegicus1. Biol. Reprod. 2004, 70, 1049–1054. [Google Scholar] [CrossRef] [PubMed]
- Rahman, S.A.; Grant, L.K.; Gooley, J.J.; Rajaratnam, S.M.W.; Czeisler, C.A.; Lockley, S.W. Endogenous Circadian Regulation of Female Reproductive Hormones. J. Clin. Endocrinol. Metab. 2019, 104, 6049–6059. [Google Scholar] [CrossRef]
- Kopycińska, K.; Wojtulewicz, K.; Herman, A.P.; Tomaszewska-Zaremba, D. The Effect of Photoperiodic Conditions on GnRH/LH Secretion in Ewes. Animals 2022, 12, 283. [Google Scholar] [CrossRef]
- Wojtulewicz, K.; Tomaszewska-Zaremba, D.; Krawczyńska, A.; Tomczyk, M.; Przemysław Herman, A. The Effect of Inflammation on the Synthesis of Luteinizing Hormone and Gonadotropin-Releasing Hormone Receptor Expression in the Pars Tuberalis of Ewe during Different Photoperiodic Conditions. Can. J. Anim. Sci. 2018, 98, 675–687. [Google Scholar] [CrossRef]
- Wojtulewicz, K.; Tomczyk, M.; Wójcik, M.; Bochenek, J.; Antushevich, H.; Krawczyńska, A.; Załęcki, M.; Herman, A.P. Circadian and Seasonal Changes in the Expression of Clock Genes in the Ovine Pars Tuberalis. J. Anim. Feed Sci. 2023, 32, 363–371. [Google Scholar] [CrossRef]
- Chappell, P.E.; Goodall, C.P.; Tonsfeldt, K.J.; White, R.S.; Bredeweg, E.; Latham, K.L. Modulation of Gonadotrophin-Releasing Hormone Secretion by an Endogenous Circadian Clock. J. Neuroendocrinol. 2009, 21, 339–345. [Google Scholar] [CrossRef]
- Perez-Castro, C.; Renner, U.; Haedo, M.R.; Stalla, G.K.; Arzt, E. Cellular and Molecular Specificity of Pituitary Gland Physiology. Physiol. Rev. 2012, 92, 1–38. [Google Scholar] [CrossRef]
- Lafarque, M.M.; Ezquer, M.; Aguado, L.I.; Oliveros, L.B. Bovine Pars Tuberalis Secretions Release Growth Hormone from Rat Pars Distalis of Pituitary Gland. Neuroendocrinol. Lett. 2004, 25, 273–277. [Google Scholar] [PubMed]
- Dardente, H.; Simonneaux, V. GnRH and the Photoperiodic Control of Seasonal Reproduction: Delegating the Task to Kisspeptin and RFRP-3. J. Neuroendocrinol. 2022, 34, e13124. [Google Scholar] [CrossRef] [PubMed]
- Król, K.; Tomaszewska-Zaremba, D.; Herman, A. Photoperiod-Dependent Effect of Inflammation on Nocturnal Gene Expression of Proinflammatory Cytokines and Their Receptors in Pars Tuberalis of Ewe. J. Anim. Feed Sci. 2016, 25, 3–11. [Google Scholar] [CrossRef]
- Tomaszewska-Zaremba, D.; Herman, A.; Haziak, K. How Does Bacterial Endotoxin Influence Gonadoliberin/Gonadotropins Secretion and Action? J. Anim. Feed Sci. 2016, 25, 283–291. [Google Scholar] [CrossRef]
- Tomaszewska-Zaremba, D.; Herman, A. The Role of Immunological System in the Regulation of Gonadoliberin and Gonadotropin Secretion. Reprod. Biol. 2009, 9, 11–23. [Google Scholar] [CrossRef]
- Weiss, G.; Goldsmith, L.T.; Taylor, R.N.; Bellet, D.; Taylor, H.S. Inflammation in Reproductive Disorders. Reprod. Sci. 2009, 16, 216–229. [Google Scholar] [CrossRef]
- Yoo, D.K.; Lee, S.-H. Effect of Lipopolysaccharide (LPS) Exposure on the Reproductive Organs of Immature Female Rats. Dev. Reprod. 2016, 20, 113–121. [Google Scholar] [CrossRef]
- He, D.; Sato, I.; Kimura, F.; Akema, T. Lipopolysaccharide Inhibits Luteinizing Hormone Release Through Interaction with Opioid and Excitatory Amino Acid Inputs to Gonadotropin-Releasing Hormone Neurones in Female Rats: Possible Evidence for a Common Mechanism Involved in Infection and Immobilization Stress. J. Neuroendocrinol. 2003, 15, 559–563. [Google Scholar] [CrossRef]
- Refojo, D.; Arias, P.; Moguilevsky, J.A.; Feleder, C. Effect of Bacterial Endotoxin on in Vivo Pulsatile Gonadotropin Secretion in Adult Male Rats. Neuroendocrinology 1998, 67, 275–281. [Google Scholar] [CrossRef]
- Takeuchi, Y.; Nagabukuro, H.; Kizumi, O.; Mori, Y. Lipopolysaccharide-Induced Suppression of the Hypothalamic Gonadotropin-Releasing Hormone Pulse Generator in Ovariectomized Goats. J. Vet. Med. Sci. 1997, 59, 93–96. [Google Scholar] [CrossRef]
- Daniel, J.A.; Abrams, M.S.; deSouza, L.; Wagner, C.G.; Whitlock, B.K.; Sartin, J.L. Endotoxin Inhibition of Luteinizing Hormone in Sheep. Domest. Anim. Endocrinol. 2003, 25, 13–19. [Google Scholar] [CrossRef] [PubMed]
- Herman, A.; Kopycińska, K.; Krawczyńska, A.; Romanowicz, K.; Tomaszewska-Zaremba, D. The Effect of Repeated Endotoxin Injections on Gonadotropin Secretion in Ewes. J. Anim. Feed Sci. 2014, 23, 217–221. [Google Scholar] [CrossRef]
- Lincoln, G.A.; Andersson, H.; Hazlerigg, D. Clock Genes and the Long-Term Regulation of Prolactin Secretion: Evidence for a Photoperiod/Circannual Timer in the Pars Tuberalis. J. Neuroendocrinol. 2003, 15, 390–397. [Google Scholar] [CrossRef] [PubMed]
- Barrett, P.; Bolborea, M. Molecular Pathways Involved in Seasonal Body Weight and Reproductive Responses Governed by Melatonin. J. Pineal Res. 2012, 52, 376–388. [Google Scholar] [CrossRef] [PubMed]
- Marpegán, L.; Bekinschtein, T.A.; Costas, M.A.; Golombek, D.A. Circadian Responses to Endotoxin Treatment in Mice. J. Neuroimmunol. 2005, 160, 102–109. [Google Scholar] [CrossRef]
- Okada, K.; Yano, M.; Doki, Y.; Azama, T.; Iwanaga, H.; Miki, H.; Nakayama, M.; Miyata, H.; Takiguchi, S.; Fujiwara, Y.; et al. Injection of LPS Causes Transient Suppression of Biological Clock Genes in Rats. J. Surg. Res. 2008, 145, 5–12. [Google Scholar] [CrossRef]
- Shimizu, T.; Watanabe, K.; Anayama, N.; Miyazaki, K. Effect of Lipopolysaccharide on Circadian Clock Genes Per2 and Bmal1 in Mouse Ovary. J. Physiol. Sci. 2017, 67, 623–628. [Google Scholar] [CrossRef]
- Challet, E. Minireview: Entrainment of the Suprachiasmatic Clockwork in Diurnal and Nocturnal Mammals. Endocrinology 2007, 148, 5648–5655. [Google Scholar] [CrossRef]
- Gibbs, J.E.; Blaikley, J.; Beesley, S.; Matthews, L.; Simpson, K.D.; Boyce, S.H.; Farrow, S.N.; Else, K.J.; Singh, D.; Ray, D.W.; et al. The Nuclear Receptor REV-ERB Mediates Circadian Regulation of Innate Immunity through Selective Regulation of Inflammatory Cytokines. Proc. Natl. Acad. Sci. USA 2012, 109, 582–587. [Google Scholar] [CrossRef]
- Curtis, A.M.; Bellet, M.M.; Sassone-Corsi, P.; O’Neill, L.A.J. Circadian Clock Proteins and Immunity. Immunity 2014, 40, 178–186. [Google Scholar] [CrossRef]
- Sun, Y.; Yang, Z.; Niu, Z.; Peng, J.; Li, Q.; Xiong, W.; Langnas, A.N.; Ma, M.Y.; Zhao, Y. MOP3, a Component of the Molecular Clock, Regulates the Development of B Cells. Immunology 2006, 119, 451–460. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, K.D.; Fentress, S.J.; Qiu, Y.; Yun, K.; Cox, J.S.; Chawla, A. Circadian Gene Bmal1 Regulates Diurnal Oscillations of Ly6Chi Inflammatory Monocytes. Science 2013, 341, 1483–1488. [Google Scholar] [CrossRef] [PubMed]
- Bellet, M.M.; Deriu, E.; Liu, J.Z.; Grimaldi, B.; Blaschitz, C.; Zeller, M.; Edwards, R.A.; Sahar, S.; Dandekar, S.; Baldi, P.; et al. Circadian Clock Regulates the Host Response to Salmonella. Proc. Natl. Acad. Sci. USA 2013, 110, 9897–9902. [Google Scholar] [CrossRef] [PubMed]
- Spengler, M.L.; Kuropatwinski, K.K.; Comas, M.; Gasparian, A.V.; Fedtsova, N.; Gleiberman, A.S.; Gitlin, I.I.; Artemicheva, N.M.; Deluca, K.A.; Gudkov, A.V.; et al. Core Circadian Protein CLOCK Is a Positive Regulator of NF-κB–Mediated Transcription. Proc. Natl. Acad. Sci. USA 2012, 109, E2457–E2465. [Google Scholar] [CrossRef] [PubMed]
- Yu, E.A.; Weaver, D.R. Disrupting the Circadian Clock: Gene-Specific Effects on Aging, Cancer, and Other Phenotypes. Aging 2011, 3, 479–493. [Google Scholar] [CrossRef]
- Gul, S.; Akyel, Y.K.; Gul, Z.M.; Isin, S.; Ozcan, O.; Korkmaz, T.; Selvi, S.; Danis, I.; Ipek, O.S.; Aygenli, F.; et al. Discovery of a Small Molecule That Selectively Destabilizes Cryptochrome 1 and Enhances Life Span in P53 Knockout Mice. Nat. Commun. 2022, 13, 6742. [Google Scholar] [CrossRef]
- Kastan, M.B.; Bartek, J. Cell-Cycle Checkpoints and Cancer. Nature 2004, 432, 316–323. [Google Scholar] [CrossRef]
- Lee, S.; Donehower, L.A.; Herron, A.J.; Moore, D.D.; Fu, L. Disrupting Circadian Homeostasis of Sympathetic Signaling Promotes Tumor Development in Mice. PLoS ONE 2010, 5, e10995. [Google Scholar] [CrossRef]
- Ozturk, N.; Lee, J.H.; Gaddameedhi, S.; Sancar, A. Loss of Cryptochrome Reduces Cancer Risk in P53 Mutant Mice. Proc. Natl. Acad. Sci. USA 2009, 106, 2841–2846. [Google Scholar] [CrossRef]
- Dubrovsky, Y.V.; Samsa, W.E.; Kondratov, R.V. Deficiency of Circadian Protein CLOCK Reduces Lifespan and Increases Age-Related Cataract Development in Mice. Aging 2010, 2, 936–944. [Google Scholar] [CrossRef]
- Abo, S.M.C.; Layton, A.T. Modeling the Circadian Regulation of the Immune System: Sexually Dimorphic Effects of Shift Work. PLoS Comput. Biol. 2021, 17, e1008514. [Google Scholar] [CrossRef] [PubMed]
- Härmä, M.; Ojajärvi, A.; Koskinen, A.; Lie, J.-A.; Hansen, J. Shift Work with and without Night Shifts and Breast Cancer Risk in a Cohort Study from Finland. Occup. Environ. Med. 2023, 80, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Haghayegh, S.; Liu, Y.; Zhang, Y.; Strohmaier, S.; Papantoniou, K.; Markt, S.; Giovannucci, E.; Schernhammer, E. Rotating Night Shift Work and Bladder Cancer Risk in Women: Results of Two Prospective Cohort Studies. Int. J. Environ. Res. Public Health 2023, 20, 2202. [Google Scholar] [CrossRef] [PubMed]
- Solymanzadeh, F.; Rokhafroz, D.; Asadizaker, M.; Dastoorpoor, M. Prediction of Risk of Coronary Artery Disease Based on the Framingham Risk Score in Association with Shift Work among Nurses. Int. J. Occup. Saf. Ergon. 2023, 29, 56–61. [Google Scholar] [CrossRef]
- Bortkiewicz, A. Whether Shiftwork, Long Working Hours and Noise Affect the Cardiovascular System. Heart 2022, 109, 338–339. [Google Scholar] [CrossRef]
- Blancas-Velazquez, A.S.; Bering, T.; Bille, S.; Rath, M.F. Role and Neural Regulation of Clock Genes in the Rat Pineal Gland: Clock Modulates Amplitude of Rhythmic Expression of Aanat Encoding the Melatonin-producing Enzyme. J. Pineal Res. 2023, 75, e12893. [Google Scholar] [CrossRef]
- Vu, C.H.V.; Kawashima, M.; Nakamura, W.; Nakamura, T.J.; Tsubota, K. Circadian Clock Regulates Tear Secretion in the Lacrimal Gland. Exp. Eye Res. 2021, 206, 108524. [Google Scholar] [CrossRef]
- Tsukamoto-Yamauchi, N.; Terasaka, T.; Iwasaki, Y.; Otsuka, F. Interaction of Pituitary Hormones and Expression of Clock Genes Modulated by Bone Morphogenetic Protein-4 and Melatonin. Biochem. Biophys. Res. Commun. 2015, 459, 172–177. [Google Scholar] [CrossRef]
- Morgan, P.; Williams, L.M. The Pars Tuberalis of the Pituitary: A Gateway for Neuroendocrine Output. Rev. Reprod. 1996, 1, 153–161. [Google Scholar] [CrossRef]
- Wojtulewicz, K.; Tomaszewska-Zaremba, D.; Herman, A. Endotoxin-Induced Inflammation Suppresses the Effect of Melatonin on the Release of LH from the Ovine Pars Tuberalis Explants—Ex Vivo Study. Molecules 2017, 22, 1933. [Google Scholar] [CrossRef]
- Herman, A.P.; Wojtulewicz, K.; Bochenek, J.; Krawczyńska, A.; Antushevich, H.; Pawlina, B.; Zielińska-Górska, M.; Herman, A.; Romanowicz, K.; Tomaszewska-Zaremba, D. Endotoxin-Induced Inflammation Disturbs Melatonin Secretion in Ewe. Asian-Australas. J. Anim. Sci. 2017, 30, 1784–1795. [Google Scholar] [CrossRef] [PubMed]
- Chu, A.; Zhu, L.; Blum, I.D.; Mai, O.; Leliavski, A.; Fahrenkrug, J.; Oster, H.; Boehm, U.; Storch, K.-F. Global But Not Gonadotrope-Specific Disruption of Bmal1 Abolishes the Luteinizing Hormone Surge Without Affecting Ovulation. Endocrinology 2013, 154, 2924–2935. [Google Scholar] [CrossRef] [PubMed]
- Soejima, Y.; Iwata, N.; Nakano, Y.; Yamamoto, K.; Suyama, A.; Nada, T.; Otsuka, F. Biphasic Roles of Clock Genes and Bone Morphogenetic Proteins in Gonadotropin Expression by Mouse Gonadotrope Cells. Int. J. Mol. Sci. 2021, 22, 11186. [Google Scholar] [CrossRef]
- Szlis, M.; Przybył, B.J.; Pałatyńska, K.; Wójcik-Gładysz, A. QRFP43 Modulates the Activity of the Hypothalamic Appetite Regulatory Centre in Sheep. J. Anim. Feed Sci. 2024, 33, 281–286. [Google Scholar] [CrossRef]
- Wójcik, M.; Zięba, D.A.; Tomczyk, M.; Bochenek, J.; Antushevich, H.; Krawczyńska, A.; Herman, A.P. Time-Dependent Effect of Inflammation on the Gene Expression of pro-Inflammatory Cytokines and Their Receptors at the Different Levels of the Somatotropic Axis in Ewe. J. Anim. Feed Sci. 2023, 32, 400–412. [Google Scholar] [CrossRef]
- Strzetelski, J. Standards for Ruminant Feeding; Instytut Zootechniki PIB: Kraków, Poland, 2009. [Google Scholar]
- Młotkowska, P.; Misztal, T.; Kowalczyk, P.; Marciniak, E. Effect of Kynurenic Acid on Enzymatic Activity of the DNA Base Excision Repair Pathway in Specific Areas of the Sheep Brain. Sci. Rep. 2024, 14, 15506. [Google Scholar] [CrossRef] [PubMed]
- Szczepkowska, A.; Bochenek, J.; Wójcik, M.; Tomaszewska-Zaremba, D.; Antushevich, H.; Tomczyk, M.; Skipor, J.; Herman, A. Effect of Caffeine on Adenosine and Ryanodine Receptor Gene Expression in the Hypothalamus, Pituitary, and Choroid Plexus in Ewes under Basal and LPS Challenge Conditions. J. Anim. Feed Sci. 2022, 32, 17–25. [Google Scholar] [CrossRef]
GenBank Acc. No. | Gene | Amplicon Size [bp] | Forward/Reverse | Sequence 5′→3′ | Reference |
---|---|---|---|---|---|
NM_001009284.2 | B2M beta-2 microglobulin | 119 | Forward | CTTCTGTCCCACGCTGAGTT | Originally designed |
Reverse | GGTGCTGCTTAGAGGTCTCG | ||||
U39357 | ACTB actin beta | 168 | Forward | CTTCCTTCCTGGGCATGG | [68] |
Reverse | GGGCAGTGATCTCTTTCTGC | ||||
NM_001034034 | GAPDH glyceraldehyde-3-phosphate dehydrogenase | 134 | Forward | AGAAGGCTGGGGCTCACT | [68] |
Reverse | GGCATTGCTGACAATCTTGA | ||||
NM_001130932.1 | CLOCK clock circadian regulator | 115 | Forward | CAGTCAGTCTCAAGGAAGCGT | Originally designed |
Reverse | GGTGTAGAGGAAGGGTCCGA | ||||
NM_001129734.1 | BMAL Basic helix-loop-helix-ARNT like 1 | 92 | Forward | CGGAGTCGGTGGTTCAGTTT | Originally designed |
Reverse | TCCAGGACGTTGGCTAAAACA | ||||
NM_001129735.1 | CRY1 cryptochrome circadian regulator 1 | 150 | Forward | TAGCAGCAGTGCAAGTTGT | Originally designed |
Reverse | TGCGTGTCCTCTTCCTGACTA | ||||
NM_001129736.1 | CRY2 cryptochrome circadian regulator 2 | 139 | Forward | GATTGCGGCTCCATGACAAC | Originally designed |
Reverse | GACTGAAGCAGGAACCTCCA | ||||
XM_027974927.1 | PER1 period circadian regulator 1 | 138 | Forward | GTCCCTGCTACTGGCACATT | Originally designed |
Reverse | GGAGCAACTGGAGGCTTCTT | ||||
NM_001078109.1 | CK1ε casein kinase 1 epsilon | 143 | Forward | CACCTGGGCATCGAGCAAA | Originally designed |
Reverse | TTCTTCTCGCTGATCCGCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wojtulewicz, K.; Tomczyk, M.; Wójcik, M.; Antushevich, H.; Bochenek, J.; Herman, A.P. Influence of Acute Inflammation on the Expression of Clock Genes in the Ovine Pars Tuberalis Under Different Photoperiodic Conditions. Int. J. Mol. Sci. 2024, 25, 11471. https://doi.org/10.3390/ijms252111471
Wojtulewicz K, Tomczyk M, Wójcik M, Antushevich H, Bochenek J, Herman AP. Influence of Acute Inflammation on the Expression of Clock Genes in the Ovine Pars Tuberalis Under Different Photoperiodic Conditions. International Journal of Molecular Sciences. 2024; 25(21):11471. https://doi.org/10.3390/ijms252111471
Chicago/Turabian StyleWojtulewicz, Karolina, Monika Tomczyk, Maciej Wójcik, Hanna Antushevich, Joanna Bochenek, and Andrzej Przemysław Herman. 2024. "Influence of Acute Inflammation on the Expression of Clock Genes in the Ovine Pars Tuberalis Under Different Photoperiodic Conditions" International Journal of Molecular Sciences 25, no. 21: 11471. https://doi.org/10.3390/ijms252111471
APA StyleWojtulewicz, K., Tomczyk, M., Wójcik, M., Antushevich, H., Bochenek, J., & Herman, A. P. (2024). Influence of Acute Inflammation on the Expression of Clock Genes in the Ovine Pars Tuberalis Under Different Photoperiodic Conditions. International Journal of Molecular Sciences, 25(21), 11471. https://doi.org/10.3390/ijms252111471