The D75N and P161S Mutations in the C0-C2 Fragment of cMyBP-C Associated with Hypertrophic Cardiomyopathy Disturb the Thin Filament Activation, Nucleotide Exchange in Myosin, and Actin–Myosin Interaction
Abstract
:1. Introduction
2. Results
2.1. Effects of cMyBP-C Mutations on the Thermal Unfolding of the C0-C2 Fragment Studied with Differential Scanning Calorimetry (DSC)
2.2. Effects of cMyBP-C Mutations on the Binding of C0-C2 Fragment of cMyBP-C to F-Actin
2.3. Effects of cMyBP-C Mutations on the Actin–Myosin Interaction
C0-C2 Fragment | Vmax, µm/s | pCa50 |
---|---|---|
0 nM C0-C2 | 2.0 ± 0.1 | 6.56 ± 0.01 |
500 nM WT C0-C2 | 1.4 ± 0.1 # | 7.26 ± 0.01 # |
500 nM D75N C0-C2 | 0.6 ± 0.1 *# | 6.62 ± 0.01 * |
500 nM P161S C0-C2 | 2.0 ± 0.1 * | 6.56 ± 0.01 * |
C0-C2 Fragment | c50 (pCa4), µg/mL | c50 (F-Actin–Tpm), µg/mL |
---|---|---|
0 nM C0-C2 | 44.4 ± 0.7 | 47.1 ± 1.5 |
500 nM WT C0-C2 | 25.0 ± 0.1 | 43.2 ± 1.0 |
500 nM D75N C0-C2 | 40.1 ± 1.2 * | 55.1 ± 1.1 * |
500 nM P161S C0-C2 | 46.1 ± 0.1 * | 56.4 ± 1.0 * |
2.4. Molecular Dynamics (MD) Simulations
3. Discussion
3.1. Effects of the Mutations on the Properties of the cMyBP-C C0-C2 Fragment
3.2. Mechanisms of HCM Pathogenesis
4. Materials and Methods
4.1. Proteins
4.2. Differential Scanning Calorimetry (DSC) Experiments
4.3. In Vitro Motility Assay
4.4. Binding of cMyBP-C C0-C2 Fragment to F-Actin
4.5. Statistics
4.6. Molecular Dynamics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carrier, L.; Mearini, G.; Stathopoulou, K.; Cuello, F. Cardiac myosin-binding protein C (MYBPC3) in cardiac pathophysiology. Gene 2015, 573, 188–197. [Google Scholar] [CrossRef] [PubMed]
- Ho, C.Y.; Carlsen, C.; Thune, J.J.; Havndrup, O.; Bundgaard, H.; Farrohi, F.; Rivero, J.; Cirino, A.L.; Andersen, P.S.; Christiansen, M.; et al. Echocardiographic strain imaging to assess early and late consequences of sarcomere mutations in hypertrophic cardiomyopathy. Circ. Cardiovasc. Genet. 2009, 2, 314–321. [Google Scholar] [CrossRef]
- Ho, C.Y.; Sweitzer, N.K.; McDonough, B.; Maron, B.J.; Casey, S.A.; Seidman, J.G.; Seidman, C.E.; Solomon, S.D. Assessment of diastolic function with Doppler tissue imaging to predict genotype in preclinical hypertrophic cardiomyopathy. Circulation 2002, 105, 2992–2997. [Google Scholar] [CrossRef] [PubMed]
- Spudich, J.A. Hypertrophic and dilated cardiomyopathy: Four decades of basic research on muscle lead to potential therapeutic approaches to these devastating genetic diseases. Biophys. J. 2014, 106, 1236–1249. [Google Scholar] [CrossRef] [PubMed]
- Witjas-Paalberends, E.R.; Ferrara, C.; Scellini, B.; Piroddi, N.; Montag, J.; Tesi, C.; Stienen, G.J.; Michels, M.; Ho, C.Y.; Kraft, T.; et al. Faster cross-bridge detachment and increased tension cost in human hypertrophic cardiomyopathy with the R403Q MYH7 mutation. J. Physiol. 2014, 592, 3257–3272. [Google Scholar] [CrossRef]
- Li, J.; Gresham, K.S.; Mamidi, R.; Doh, C.Y.; Wan, X.; Deschenes, I.; Stelzer, J.E. Sarcomere-based genetic enhancement of systolic cardiac function in a murine model of dilated cardiomyopathy. Int. J. Cardiol. 2018, 273, 168–176. [Google Scholar] [CrossRef]
- Ren, X.; Hensley, N.; Brady, M.B.; Gao, W.D. The Genetic and Molecular Bases for Hypertrophic Cardiomyopathy: The Role for Calcium Sensitization. J. Cardiothorac. Vasc. Anesth. 2018, 32, 478–487. [Google Scholar] [CrossRef]
- Alfares, A.A.; Kelly, M.A.; McDermott, G.; Funke, B.H.; Lebo, M.S.; Baxter, S.B.; Shen, J.; McLaughlin, H.M.; Clark, E.H.; Babb, L.J.; et al. Results of clinical genetic testing of 2,912 probands with hypertrophic cardiomyopathy: Expanded panels offer limited additional sensitivity. Genet. Med. 2015, 17, 880–888. [Google Scholar] [CrossRef]
- Gómez, J.; Reguero, J.R.; Coto, E. The ups and downs of genetic diagnosis of hypertrophic cardiomyopathy. Rev. Española Cardiol. Engl. Ed. 2016, 69, 61–68. [Google Scholar] [CrossRef]
- Liu, W.; Liu, W.; Hu, D.; Zhu, T.; Ma, Z.; Yang, J.; Xie, W.; Li, C.; Li, L.; Yang, J.; et al. Mutation spectrum in a large cohort of unrelated Chinese patients with hypertrophic cardiomyopathy. Am. J. Cardiol. 2013, 112, 585–589. [Google Scholar] [CrossRef]
- Nagayama, T.; Takimoto, E.; Sadayappan, S.; Mudd, J.O.; Seidman, J.G.; Robbins, J.; Kass, D.A. Control of in vivo left ventricular [correction] contraction/relaxation kinetics by myosin binding protein C: Protein kinase A phosphorylation dependent and independent regulation. Circulation 2007, 20, 2399–2408. [Google Scholar] [CrossRef] [PubMed]
- Palmer, B.M.; Georgakopoulos, D.; Janssen, P.M.; Wang, Y.; Alpert, N.R.; Belardi, D.F.; Harris, S.P.; Moss, R.L.; Burgon, P.G.; Seidman, C.E. Role of cardiac myosin binding protein C in sustaining left ventricular systolic stiffening. Circ. Res. 2004, 94, 1249–1255. [Google Scholar] [CrossRef] [PubMed]
- Janssen, P.M. Kinetics of cardiac muscle contraction and relaxation are linked and determined by properties of the cardiac sarcomere. Am. J. Physiol. Heart Circ. Physiol. 2010, 299, 1092–1099. [Google Scholar] [CrossRef]
- Fazlollahi, F.; Santini Gonzalez, J.J.; Repas, S.J.; Canan, B.D.; Billman, G.E.; Janssen, P.M.L. Contraction-relaxation coupling is unaltered by exercise training and infarction in isolated canine myocardium. J. Gen. Physiol. 2021, 153, e202012829. [Google Scholar] [CrossRef]
- Hanft, L.M.; Fitzsimons, D.P.; Hacker, T.A.; Moss, R.L.; McDonald, K.S. Cardiac MyBP-C phosphorylation regulates the Frank-Starling relationship in murine hearts. J. Gen. Physiol. 2021, 153, e202012770. [Google Scholar] [CrossRef]
- Stelzer, J.E.; Fitzsimons, D.P.; Moss, R.L. Ablation of myosin-binding protein-C accelerates force development in mouse myocardium. Biophys. J. 2006, 90, 4119–4127. [Google Scholar] [CrossRef]
- Razumova, M.V.; Shaffer, J.F.; Tu, A.Y.; Flint, G.V.; Regnier, M.; Harris, S.P. Effects of the N-terminal domains of myosin binding protein-C in an in vitro motility assay: Evidence for long-lived cross-bridges. J. Biol. Chem. 2006, 281, 35846–35854. [Google Scholar] [CrossRef]
- Saber, W.; Begin, K.J.; Warshaw, D.M.; VanBuren, P. Cardiac myosin binding protein-C modulates actomyosin binding and kinetics in the in vitro motility assay. J. Mol. Cell. Cardiol. 2008, 44, 1053–1061. [Google Scholar] [CrossRef]
- Shchepkin, D.V.; Kopylova, G.V.; Nikitina, L.V.; Katsnelson, L.B.; Bershitsky, S.Y. Effects of cardiac myosin binding protein-C on the regulation of interaction of cardiac myosin with thin filament in an in vitro motility assay. Biochem. Biophys. Res. Commun. 2010, 401, 159–163. [Google Scholar] [CrossRef]
- Risi, C.; Belknap, B.; Forgacs-Lonart, E.; Harris, S.P.; Schröder, G.F.; White, H.D.; Galkin, V.E. N-Terminal domains of cardiac myosin binding protein C cooperatively activate the thin filament. Structure 2018, 26, 1604–1611.e4. [Google Scholar] [CrossRef]
- Harris, S.P.; Belknap, B.; Van Sciver, R.E.; White, H.D.; Galkin, V.E. C0 and C1 N-terminal Ig domains of myosin binding protein C exert different effects on thin filament activation. Proc. Natl. Acad. Sci. USA 2016, 113, 1558–1563. [Google Scholar] [CrossRef] [PubMed]
- Mun, J.Y.; Previs, M.J.; Yu, H.Y.; Gulick, J.; Tobacman, L.S.; Beck Previs, S.; Robbins, J.; Warshaw, D.M.; Craig, R. Myosin-binding protein C displaces tropomyosin to activate cardiac thin filaments and governs their speed by an independent mechanism. Proc. Natl. Acad. Sci. USA 2014, 111, 2170–2175. [Google Scholar] [CrossRef]
- Inchingolo, A.V.; Previs, S.B.; Previs, M.J.; Warshaw, D.M.; Kad, N.M. Revealing the mechanism of how cardiac myosin-binding protein C N-terminal fragments sensitize thin filaments for myosin binding. Proc. Natl. Acad. Sci. USA 2019, 116, 6828–6835. [Google Scholar] [CrossRef]
- Barefield, D.; Sadayappan, S. Phosphorylation and function of cardiac myosin binding protein-C in health and disease. J. Mol. Cell. Cardiol. 2010, 48, 866–875. [Google Scholar] [CrossRef]
- Previs, M.J.; Mun, J.Y.; Michalek, A.J.; Previs, S.B.; Gulick, J.; Robbins, J.; Saber, D.M.; Craig, R. Phosphorylation and calcium antagonistically tune myosin-binding protein C’s structure and function. Proc. Natl. Acad. Sci. USA 2016, 113, 3239–3244. [Google Scholar] [CrossRef]
- Kumar, M.; Haghigh, I.K.; Kranias, E.G.; Sadayappan, S. Phosphorylation of cardiac myosin-binding protein-C contributes to calcium homeostasis. J. Biol. Chem. 2020, 295, 11275–11291. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Torre, I.; Chiappi, M.; Yin, Z.; Vydyanath, A.; Cao, S.; Raschdorf, O.; Beeby, M.; Quigley, B.; de Tombe, P.P.; et al. Cryo-electron tomography of intact cardiac muscle reveals myosin binding protein-C linking myosin and actin filaments. J. Muscle Res. Cell Motil. 2023, 44, 165–178. [Google Scholar] [CrossRef] [PubMed]
- Suay-Corredera, C.; Alegre-Cebollada, J. The mechanics of the heart: Zooming in on hypertrophic cardiomyopathy and cMyBP-C. FEBS Lett. 2022, 596, 703–746. [Google Scholar] [CrossRef]
- Dutta, D.; Nguyen, V.; Campbell, K.S.; Padrón, R.; Craig, R. Cryo-EM structure of the human cardiac myosin filament. Nature 2023, 623, 853–862. [Google Scholar] [CrossRef]
- Gruen, M.; Gautel, M. Mutations in β-myosin S2 that cause familial hypertrophic cardiomyopathy (FHC) abolish the interaction with the regulatory domain of myosin binding protein-C. J. Mol. Biol. 1999, 286, 933–949. [Google Scholar] [CrossRef]
- Kulikovskaya, I.; McClellan, G.; Flavigny, J.; Carrier, L.; Winegrad, S. Effect of MyBP-C binding to actin on contractility in heart muscle. J. Gen. Physiol. 2003, 122, 761–774. [Google Scholar] [CrossRef] [PubMed]
- Whitten, A.E.; Jeffries, C.M.; Harris, S.P.; Trewhella, J. Cardiac myosin-binding protein C decorates F-actin: Implications for cardiac function. Proc. Natl. Acad. Sci. USA 2008, 105, 18360–18365. [Google Scholar] [CrossRef] [PubMed]
- Shaffer, J.F.; Kensler, R.W.; Harris, S.P. The myosin-binding protein C motif binds to F-actin in a phosphorylation-sensitive manner. J. Biol. Chem. 2009, 284, 12318–12327. [Google Scholar] [CrossRef] [PubMed]
- Orlova, A.; Galkin, V.E.; Jeffries, C.M.; Egelman, E.H.; Trewhella, J. The N-terminal domains of myosin binding protein C can bind polymorphically to F-actin. J. Mol. Biol. 2011, 412, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Bhuiyan, M.S.; McLendon, P.; James, J.; Osinska, H.; Gulick, J.; Bhandary, B.; Lorenz, J.N.; Robbins, J. In vivo definition of cardiac myosin-binding protein C’s critical interactions with myosin. Pflügers Arch. 2016, 468, 1685–1695. [Google Scholar] [CrossRef] [PubMed]
- Tamborrini, D.; Wang, Z.; Wagner, T.; Tacke, S.; Stabrin, M.; Grange, M.; Kho, A.L.; Rees, M.; Bennett, P.; Gautel, M.; et al. Structure of the native myosin filament in the relaxed cardiac sarcomere. Nature 2023, 623, 863–871. [Google Scholar] [CrossRef]
- Ponnam, S.; Kampourakis, T. Microscale thermophoresis suggests a new model of regulation of cardiac myosin function via interaction with cardiac myosin-binding protein C. J. Biol. Chem. 2022, 298, 101485. [Google Scholar] [CrossRef]
- Doh, C.Y.; Bharambe, N.; Holmes, J.B.; Dominic, K.L.; Swanberg, C.E.; Mamidi, R.; Chen, Y.; Bandyopadhyay, S.; Ramachandran, R.; Stelzer, J.E. Molecular characterization of linker and loop-mediated structural modulation and hinge motion in the C4-C5 domains of cMyBPC. J. Struct. Biol. 2022, 214, 107856. [Google Scholar] [CrossRef]
- Sadayappan, S.; de Tombe, P.P. Cardiac myosin binding protein-C: Redefining its structure and function. Biophys. Rev. 2012, 4, 93–106. [Google Scholar] [CrossRef]
- Walcott, S.; Docken, S.; Harris, S.P. Effects of cardiac Myosin binding protein-C on actin motility are explained with a drag-activation-competition model. Biophys. J. 2015, 108, 10–13. [Google Scholar] [CrossRef]
- Colson, B.A.; Thompson, A.R.; Espinoza-Fonseca, L.M.; Thomas, D.D. Site-directed spectroscopy of cardiac myosin-binding protein C reveals effects of phosphorylation on protein structural dynamics. Proc. Natl. Acad. Sci. USA 2016, 113, 3233–3238. [Google Scholar] [CrossRef] [PubMed]
- Moss, R.L. Cardiac myosin-binding protein C: A protein once at loose ends finds its regulatory groove. Proc. Natl. Acad. Sci. USA 2016, 113, 3133–3135. [Google Scholar] [CrossRef] [PubMed]
- Stelzer, J.E.; Patel, J.R.; Moss, R.L. Protein kinase A-mediated acceleration of the stretch activation response in murine skinned myocardium is eliminated by ablation of cMyBP-C. Circ. Res. 2006, 99, 884–890. [Google Scholar] [CrossRef]
- Napierski, N.C.; Granger, K.; Langlais, P.R.; Moran, H.R.; Strom, J.; Touma, K.; Harris, S.P. A Novel “Cut and Paste” Method for In Situ Replacement of cMyBP-C Reveals a New Role for cMyBP-C in the Regulation of Contractile Oscillations. Circ. Res. 2020, 126, 737–749. [Google Scholar] [CrossRef]
- Dominic, K.L.; Choi, J.; Holmes, J.B.; Singh, M.; Majcher, M.J.; Stelzer, J.E. The contribution of N-terminal truncated cMyBPC to in vivo cardiac function. J. Gen. Physiol. 2023, 155, e202213318. [Google Scholar] [CrossRef]
- Lynch, T.L., 4th; Kumar, M.; McNamara, J.W.; Kuster, D.W.D.; Sivaguru, M.; Singh, R.R.; Previs, M.J.; Lee, K.H.; Kuffel, G.; Zilliox, M.J.; et al. Amino terminus of cardiac myosin binding protein-C regulates cardiac contractility. J. Mol. Cell. Cardiol. 2021, 156, 33–44. [Google Scholar] [CrossRef] [PubMed]
- Kuster, D.W.D.; Lynch, T.L.; Barefield, D.Y.; Sivaguru, M.; Kuffel, G.; Zilliox, M.J.; Lee, K.H.; Craig, R.; Namakkal-Soorappan, R.; Sadayappan, S. Altered C10 domain in cardiac myosin binding protein-C results in hypertrophic cardiomyopathy. Cardiovasc. Res. 2019, 115, 1986–1997. [Google Scholar] [CrossRef]
- Glazier, A.A.; Thompson, A.; Day, S.M. Allelic imbalance and haploinsufficiency in MYBPC3-linked hypertrophic cardiomyopathy. Pflugers Arch. 2019, 471, 781–793. [Google Scholar] [CrossRef]
- Wijnker, P.J.; Friedrich, F.W.; Dutsch, A.; Reischmann, S.; Eder, A.; Mannhardt, I.; Mearini, G.; Eschenhagen, T.; van der Velden, J.; Carrier, L. Comparison of the effects of a truncating and a missense MYBPC3 mutation on contractile parameters of engineered heart tissue. J. Mol. Cell. Cardiol. 2016, 97, 82–92. [Google Scholar] [CrossRef]
- Smelter, D.F.; de Lange, W.J.; Cai, W.; Ge, Y.; Ralphe, J.C. The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability. Am. J. Physiol. Heart Circ. Physiol. 2018, 314, H1179–H1191. [Google Scholar] [CrossRef]
- Nadvi, N.A.; Michie, K.A.; Kwan, A.H.; Guss, J.M.; Trewhella, J. Clinically Linked Mutations in the Central Domains of Cardiac Myosin-Binding Protein C with Distinct Phenotypes Show Differential Structural Effects. Structure 2016, 24, 105–115. [Google Scholar] [CrossRef]
- Mertens, J.; De Lange, W.J.; Farrell, E.T.; Harbaugh, E.C.; Gauchan, A.; Fitzsimons, D.P.; Moss, R.L.; Ralphe, J.C. The W792R HCM missense mutation in the C6 domain of cardiac myosin binding protein-C increases contractility in neonatal mouse myocardium. J. Mol. Cell. Cardiol. 2024, 195, 14–23. [Google Scholar] [CrossRef]
- Pearce, A.; Ponnam, S.; Holt, M.R.; Randall, T.; Beckingham, R.; Kho, A.L.; Kampourakis, T.; Ehler, E. Missense mutations in the central domains of cardiac myosin binding protein-C and their potential contribution to hypertrophic cardiomyopathy. J. Biol. Chem. 2024, 300, 105511. [Google Scholar] [CrossRef]
- van Dijk, S.J.; Kooiker, K.B.; Napierski, N.C.; Touma, K.D.; Mazzalupo, S.; Harris, S.P. Point mutations in the tri-helix bundle of the M-domain of cardiac myosin binding protein-C influence systolic duration and delay cardiac relaxation. J. Mol. Cell. Cardiol. 2018, 119, 116–124. [Google Scholar] [CrossRef]
- Bezold, K.L.; Shaffer, J.F.; Khosa, J.K.; Hoye, E.R.; Harris, S.P. A gain-of-function mutation in the M-domain of cardiac myosin-binding protein-C increases binding to actin. J. Biol. Chem. 2013, 288, 21496–21505. [Google Scholar] [CrossRef]
- Wong, F.L.; Bunch, T.A.; Lepak, V.C.; Steedman, A.L.; Colson, B.A. Cardiac myosin-binding protein C N-terminal interactions with myosin and actin filaments: Opposite effects of phosphorylation and M-domain mutations. J. Mol. Cell. Cardiol. 2024, 186, 125–137. [Google Scholar] [CrossRef]
- Bunch, T.A.; Lepak, V.C.; Bortz, K.M.; Colson, B.A. A high-throughput fluorescence lifetime-based assay to detect binding of myosin-binding protein C to F-actin. J. Gen. Physiol. 2021, 153, e202012707. [Google Scholar] [CrossRef] [PubMed]
- Mun, J.Y.; Kensler, R.W.; Harris, S.P.; Craig, R. The cMyBP-C HCM variant L348P enhances thin filament activation through an increased shift in tropomyosin position. J. Mol. Cell. Cardiol. 2016, 91, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Doh, C.Y.; Li, J.; Mamidi, R.; Stelzer, J.E. The HCM-causing Y235S cMyBPC mutation accelerates contractile function by altering C1 domain structure. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 661–677. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-García, M.I.; Monserrat, L.; Ortiz, M.; Fernández, X.; Cazón, L.; Núñez, L.; Barriales-Villa, R.; Maneiro, E.; Veira, E.; Castro-Beiras, A.; et al. Screening mutations in myosin binding protein C3 gene in a cohort of patients with Hypertrophic Cardiomyopathy. BMC Med. Genet. 2010, 11, 67. [Google Scholar] [CrossRef]
- Alders, M.; Jongbloed, R.; Deelen, W.; van den Wijngaard, A.; Doevendans, P.; Ten Cate, F.; Regitz-Zagrosek, V.; Vosberg, H.P.; van Langen, I.; Wilde, A.; et al. The 2373insG mutation in the MYBPC3 gene is a founder mutation, which accounts for nearly one-fourth of the HCM cases in the Netherlands. Eur. Heart J. 2003, 24, 1848–1853. [Google Scholar] [CrossRef]
- Brito, D.; Miltenberger-Miltenyi, G.; Vale Pereira, S.; Silva, D.; Diogo, A.N.; Madeira, H. Sarcomeric hypertrophic cardiomyopathy: Genetic profile in a Portuguese population. Rev. Port. Cardiol. 2012, 31, 577–587. [Google Scholar] [CrossRef]
- Gordon, A.M.; Homsher, E.; Regnier, M. Regulation of contraction in striated muscle. Physiol. Rev. 2000, 80, 853–924. [Google Scholar] [CrossRef]
- Sich, N.M.; O’Donnell, T.J.; Coulter, S.A.; John, O.A.; Carter, M.S.; Cremo, C.R.; Baker, J.E. Effects of actin-myosin kinetics on the calcium sensitivity of regulated thin filaments. J. Biol. Chem. 2010, 285, 39150–39159. [Google Scholar] [CrossRef]
- Risi, C.M.; Villanueva, E.; Belknap, B.; Sadler, R.L.; Harris, S.P.; White, H.D.; Galkin, V.E. Cryo-Electron Microscopy Reveals Cardiac Myosin Binding Protein-C M-Domain Interactions with the Thin Filament. J. Mol. Biol. 2022, 434, 167879. [Google Scholar] [CrossRef]
- Doran, M.H.; Rynkiewicz, M.J.; Rasicci, D.; Bodt, S.M.L.; Barry, M.E.; Bullitt, E.; Yengo, C.M.; Moore, J.R.; Lehman, W. Conformational changes linked to ADP release from human cardiac myosin bound to actin-tropomyosin. J. Gen. Physiol. 2023, 155, e202213267. [Google Scholar] [CrossRef]
- Sevrieva, I.R.; Ponnam, S.; Yan, Z.; Irving, M.; Kampourakis, T.; Sun, Y.B. Phosphorylation-dependent interactions of myosin-binding protein C and troponin coordinate the myofilament response to protein kinase A. J. Biol. Chem. 2023, 299, 102767. [Google Scholar] [CrossRef]
- Muresan, I.D.; Agoston-Coldea, L. Phenotypes of hypertrophic cardiomyopathy: Genetics, clinics, and modular imaging. Heart Fail. Rev. 2021, 26, 1023–1036. [Google Scholar] [CrossRef]
- Dass, S.; Suttie, J.; Karamitsos, T.; Watkins, H.; Neubauer, S. Acute Derangement of Cardiac Energy Metabolism and Oxygenation during Stress in Hypertrophic Cardiomyopathy-a Potential Mechanism for Sudden Cardiac Death. Heart 2012, 98, A45–A46. [Google Scholar] [CrossRef]
- Dass, S.; Cochlin, L.E.; Suttie, J.J.; Holloway, C.J.; Rider, O.J.; Carden, L.; Tyler, D.J.; Karamitsos, T.D.; Clarke, K.; Neubauer, S.; et al. Exacerbation of cardiac energetic impairment during exercise in hypertrophic cardiomyopathy: A potential mechanism for diastolic dysfunction. Eur. Heart J. 2015, 36, 1547–1554. [Google Scholar] [CrossRef] [PubMed]
- O’Leary, T.S.; Snyder, J.; Sadayappan, S.; Day, S.M.; Previs, M.J. MYBPC3 truncation mutations enhance actomyosin contractile mechanics in human hypertrophic cardiomyopathy. J. Mol. Cell. Cardiol. 2019, 127, 165–173. [Google Scholar] [CrossRef] [PubMed]
- Previs, M.J.; Prosser, B.L.; Mun, J.Y.; Previs, S.B.; Gulick, J.; Lee, K.; Robbins, J.; Craig, R.; Lederer, W.J.; Warshaw, D.M. Myosin-binding protein C corrects an intrinsic inhomogeneity in cardiac excitation-contraction coupling. Sci. Adv. 2015, 1, e1400205. [Google Scholar] [CrossRef]
- Tanner, B.C.; Wang, Y.; Robbins, J.; Palmer, B.M. Kinetics of cardiac myosin isoforms in mouse myocardium are affected differently by presence of myosin binding protein-C, J. Muscle Res. Cell Motil. 2014, 35, 267–278. [Google Scholar] [CrossRef]
- Wang, L.; Sadayappan, S.; Kawai, M. Cardiac myosin binding protein C phosphorylation affects cross-bridge cycle’s elementary steps in a site-specific manner. PLoS ONE 2014, 9, e113417. [Google Scholar] [CrossRef]
- Desai, D.; Song, T.; Singh, R.R.; Baby, A.; McNamara, J.; Green, L.; Nabavizadeh, P.; Ericksen, M.; Bazrafshan, S.; Natesan, S.; et al. MYBPC3 D389V Variant Induces Hypercontractility in Cardiac Organoids. bioRxiv 2024. [Google Scholar] [CrossRef]
- Steczina, S.; Mohran, S.; Bailey, L.R.J.; McMillen, T.S.; Kooiker, K.B.; Wood, N.B.; Davis, J.; Previs, M.J.; Olivotto, I.; Pioner, J.M.; et al. MYBPC3-c.772G>A mutation results in haploinsufficiency and altered myosin cycling kinetics in a patient induced stem cell derived cardiomyocyte model of hypertrophic cardiomyopathy. J. Mol. Cell. Cardiol. 2024, 191, 27–39. [Google Scholar] [CrossRef]
- De Lange, W.J.; Grimes, A.C.; Hegge, L.F.; Spring, A.M.; Brost, T.M.; Ralphe, J.C. E258K HCM-causing mutation in cardiac MyBP-C reduces contractile force and accelerates twitch kinetics by disrupting the cMyBP-C and myosin S2 interaction. J. Gen. Physiol. 2013, 142, 241–255. [Google Scholar] [CrossRef]
- Pioner, J.M.; Vitale, G.; Steczina, S.; Langione, M.; Margara, F.; Santini, L.; Giardini, F.; Lazzeri, E.; Piroddi, N.; Scellini, B.; et al. Slower Calcium Handling Balances Faster Cross-Bridge Cycling in Human MYBPC3 HCM. Circ. Res. 2023, 132, 628–644. [Google Scholar] [CrossRef]
- van Dijk, S.J.; Bezold Kooiker, K.; Mazzalupo, S.; Yang, Y.; Kostyukova, A.S.; Mustacich, D.J.; Hoye, E.R.; Stern, J.A.; Kittleson, M.D.; Harris, S.P. The A31P missense mutation in cardiac myosin binding protein C alters protein structure but does not cause haploinsufficiency. Arch. Biochem. Biophys. 2016, 601, 133–140. [Google Scholar] [CrossRef]
- Pellegrino, A.; Daniel, A.G.; Pereira, G.G.; Itikawa, P.H.; Larsson, M.H. Assessment of regional left ventricular systolic function by strain imaging echocardiography in phenotypically normal and abnormal Maine coon cats tested for the A31P mutation in the MYBPC3 gene. Can. J. Vet. Res. 2017, 81, 137–146. [Google Scholar]
- Ratti, J.; Rostkova, E.; Gautel, M.; Pfuhl, M. Structure and interactions of myosin-binding protein C domain C0: Cardiac-specific regulation of myosin at its neck? J. Biol. Chem. 2011, 286, 12650–12658. [Google Scholar] [CrossRef] [PubMed]
- Margossian, S.S.; Lowey, S. Preparation of myosin and its subfragments from rabbit skeletal muscle. Methods Enzymol. 1982, 85, 55–71. [Google Scholar] [CrossRef] [PubMed]
- Pardee, J.D.; Spudich, J.A. Purification of muscle actin. Methods Enzymol. 1982, 85 Pt B, 164–179. [Google Scholar] [CrossRef]
- Matyushenko, A.M.; Shchepkin, D.V.; Kopylova, G.V.; Popruga, K.E.; Artemova, N.V.; Pivovarova, A.V.; Bershitsky, S.Y.; Levitsky, D.I. Structural and Functional Effects of Cardiomyopathy-Causing Mutations in the Troponin T-Binding Region of Cardiac Tropomyosin. Biochemistry 2017, 56, 250–259. [Google Scholar] [CrossRef] [PubMed]
- Monteiro, P.B.; Lataro, R.C.; Ferro, J.A.; Reinach Fde, C. Functional alpha-tropomyosin produced in Escherichia coli. A dipeptide extension can substitute the amino-terminal acetyl group. J. Biol. Chem. 1994, 269, 10461–10466. [Google Scholar] [CrossRef]
- Lapshina, K.K.; Nefedova, V.V.; Nabiev, S.R.; Roman, S.G.; Shchepkin, D.V.; Kopylova, G.V.; Kochurova, A.M.; Beldiia, E.A.; Kleymenov, S.Y.; Levitsky, D.I.; et al. Functional and Structural Properties of Cytoplasmic Tropomyosin Isoforms Tpm1.8 and Tpm1.9. Int. J. Mol. Sci. 2024, 25, 6873. [Google Scholar] [CrossRef]
- Matyushenko, A.M.; Nefedova, V.V.; Kochurova, A.M.; Kopylova, G.V.; Koubassova, N.A.; Shestak, A.G.; Yampolskaya, D.S.; Shchepkin, D.V.; Kleymenov, S.Y.; Ryabkova, N.S.; et al. Novel Mutation Glu98Lys in Cardiac Tropomyosin Alters Its Structure and Impairs Myocardial Relaxation. Int. J. Mol. Sci. 2023, 24, 12359. [Google Scholar] [CrossRef]
- Mashanov, G.I.; Molloy, J.E. Automatic detection of single fluorophores in live cells. Biophys. J. 2007, 92, 2199–2211. [Google Scholar] [CrossRef]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef]
- Webb, B.; Sali, A. Comparative Protein Structure Modeling Using MODELLER. Curr. Protoc. Bioinform. 2016, 54, 5.6.1–5.6.37. [Google Scholar] [CrossRef]
- Shapovalov, M.V.; Dunbrack Jr, R.L. A smoothed backbone-dependent rotamer library for proteins derived from adaptive kernel density estimates and regressions. Structure 2011, 19, 844–858. [Google Scholar] [CrossRef]
- Abraham, M.J.; Murtola, T.; Schulz, R.; Páll, S.; Smith, J.C.; Hess, B.; Lindahl, E. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX 2015, 1–2, 19–25. [Google Scholar] [CrossRef]
- Lindorff-Larsen, K.; Piana, S.; Palmo, K.; Maragakis, P.; Klepeis, J.L.; Dror, R.O.; Shaw, D.E. Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins 2010, 78, 1950–1958. [Google Scholar] [CrossRef]
- Best, R.B.; Zhu, X.; Shim, J.; Lopes, P.E.M.; Mittal, J.; Feig, M.; Mackerell, A.D. Optimization of the additive CHARMM all-atom protein force field targeting improved sampling of the backbone ϕ, ψ and side-chain χ1 and χ2 dihedral angles. J. Chem. Theory Comput. 2012, 8, 3257–3273. [Google Scholar] [CrossRef]
- Koubassova, N.A.; Tsaturyan, A.K. Molecular Dynamics Assessment of Mechanical Properties of the Thin Filaments in Cardiac Muscle. Int. J. Mol. Sci. 2023, 24, 4792. [Google Scholar] [CrossRef]
C0-C2 Fragment | cATP, µM | cADP, µM |
---|---|---|
0 nM C0-C2 | 164.9 ± 42.5 | 1414 ± 588 |
500 nM WT C0-C2 | 191.4 ± 54.5 | 766 ± 120 |
500 nM D75N C0-C2 | 58.4 ± 12.5 * | - |
500 nM P161S C0-C2 | 197.6 ± 60.5 | 539 ± 165 |
Primer Name | Primer Sequence (5′ → 3′) |
cMYBPC (C0) fw | GAATTCGAGCTCCGTCGACAAGCT |
cMYBPC (C2) rev | TCAGTGATGGTGATGGTGATGCGGGCCCTGAAACAGCACTTCCAGGGGCTCTTTCACAAAGAGCTCCGT |
cMYBPC D75N fw | TGCCAACCAGGGATCTTACGC |
cMYBPC D75N adj | GGGCCCACTTCCCGCAC |
cMYBPC P161S fw | GCGGTCACAGGATGGAGAGG |
cMYBPC P161S adj | ATCACGAAGAGGCCAATGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kochurova, A.M.; Beldiia, E.A.; Nefedova, V.V.; Yampolskaya, D.S.; Koubassova, N.A.; Kleymenov, S.Y.; Antonets, J.Y.; Ryabkova, N.S.; Katrukha, I.A.; Bershitsky, S.Y.; et al. The D75N and P161S Mutations in the C0-C2 Fragment of cMyBP-C Associated with Hypertrophic Cardiomyopathy Disturb the Thin Filament Activation, Nucleotide Exchange in Myosin, and Actin–Myosin Interaction. Int. J. Mol. Sci. 2024, 25, 11195. https://doi.org/10.3390/ijms252011195
Kochurova AM, Beldiia EA, Nefedova VV, Yampolskaya DS, Koubassova NA, Kleymenov SY, Antonets JY, Ryabkova NS, Katrukha IA, Bershitsky SY, et al. The D75N and P161S Mutations in the C0-C2 Fragment of cMyBP-C Associated with Hypertrophic Cardiomyopathy Disturb the Thin Filament Activation, Nucleotide Exchange in Myosin, and Actin–Myosin Interaction. International Journal of Molecular Sciences. 2024; 25(20):11195. https://doi.org/10.3390/ijms252011195
Chicago/Turabian StyleKochurova, Anastasia M., Evgenia A. Beldiia, Victoria V. Nefedova, Daria S. Yampolskaya, Natalia A. Koubassova, Sergey Y. Kleymenov, Julia Y. Antonets, Natalia S. Ryabkova, Ivan A. Katrukha, Sergey Y. Bershitsky, and et al. 2024. "The D75N and P161S Mutations in the C0-C2 Fragment of cMyBP-C Associated with Hypertrophic Cardiomyopathy Disturb the Thin Filament Activation, Nucleotide Exchange in Myosin, and Actin–Myosin Interaction" International Journal of Molecular Sciences 25, no. 20: 11195. https://doi.org/10.3390/ijms252011195
APA StyleKochurova, A. M., Beldiia, E. A., Nefedova, V. V., Yampolskaya, D. S., Koubassova, N. A., Kleymenov, S. Y., Antonets, J. Y., Ryabkova, N. S., Katrukha, I. A., Bershitsky, S. Y., Matyushenko, A. M., Kopylova, G. V., & Shchepkin, D. V. (2024). The D75N and P161S Mutations in the C0-C2 Fragment of cMyBP-C Associated with Hypertrophic Cardiomyopathy Disturb the Thin Filament Activation, Nucleotide Exchange in Myosin, and Actin–Myosin Interaction. International Journal of Molecular Sciences, 25(20), 11195. https://doi.org/10.3390/ijms252011195