1. Introduction
Representatives of the genus
Beggiatoa belong to the group of filamentous colorless sulfur bacteria. These microorganisms are found in biotopes where reduced sulfur compounds such as hydrogen sulfide or thiosulfate are usually present. Presently, the genus includes two species of heterotrophic freshwater representatives,
Beggiatoa alba and
Beggiatoa leptomitoformis, which are able to grow lithotrophically by oxidizing reduced inorganic sulfur compounds [
1,
2]. Bacteria use these compounds as electron donors for energy metabolism. As a result of their oxidation, globules of elemental sulfur accumulate in the invaginates of the cytoplasmic membrane of these bacteria [
1,
2,
3,
4,
5]. For representatives of the genus
Beggiatoa, the mechanism of further conversion of accumulated sulfur into sulfate is not shown [
6,
7]. Although, previously Schmidt et al. [
6] suggested that under anaerobic conditions
B. alba can use intracellular elemental sulfur as a terminal electron acceptor, as sulfide accumulation was observed during short-term culture under anaerobic conditions. However, there is still no conclusive evidence for this process.
An interesting fact is that when Beggiatoa is cultured on a medium without an exogenous sulfur source under aerobic conditions, the cells begin to lose accumulated sulfur globules, but how this process is realized has not yet been studied.
The best known enzyme systems that are involved in the dissimilatory conversion of elemental sulfur to sulfite in bacteria are the reverse dissimilatory sulfite reductase rDsr pathway and the sulfur-oxidizing heterodisulfide reductase-like sHdr pathway. Both pathways are widely distributed in the domain of Bacteria among chemotrophic and phototrophic sulfur-oxidizing prokaryotes, and the sHdr pathway is also found in archaea [
8,
9].
Oxidation of sulfane sulfur can also be carried out by persulfide dioxygenase (PDO) from the superfamily of metallo-β-lactamase enzymes [
10]. However, PDO does not oxidize elemental sulfur directly because its direct substrate is glutathione persulfide (GSSH) [
10,
11]. There is a mechanism for the oxidation of hydrogen sulfide to sulfate involving sulfide:quinoxidoreductase (SQR) and PDO, which is used by many heterotrophic and chemoautotrophic bacteria to detoxify hydrogen sulfide [
12,
13,
14,
15,
16]. In this process, SQR oxidizes sulfide to sulfane sulfur (S
0/polysulfide), which then reacts with reduced glutathione (GSH) to form GSSH [
17]. Rhodanese can accelerate the reaction of sulfane sulfur with GSH [
17,
18]. Then, PDO oxidizes GSSH to sulfite according to the following reaction [
10,
12,
19]:
The sulfite formed is able to spontaneously react with sulfane sulfur to form thiosulfate [
15], which is then oxidized to sulfate with the participation of the Sox-system.
Currently, persulfide dioxygenases are categorized into three types [
12,
14]. Type I includes known PDOs of human (hETHE1, pdb id 4CHL),
Arabidopsis thaliana (pdb id 2GCU), and many bacterial PDOs, including PDO from
Paraburkholderia phytofirmans (
BpPRF, pdb id 5VE5), which fuses a C-terminal region with a rhodanese domain, and
Myxococcus xanthus (
MxPDO, pdb id 4YSB) [
13,
20,
21,
22]. Type II is widely distributed in
Pseudomonadota (formerly
Proteobacteria), e.g., PDO of
Pseudomonas putida (PpPDO2, pdb id 4YSL) [
13]. Type III PDOs are characterized by the presence of a rhodanese domain similar to
BpPRF, but these enzymes differ in substrate specificity [
23]. In enzymes of the metallo-β-lactamase superfamily, the dominant form of metal in the active site is Fe
2+. However, some type II PDOs can also use Mn
2+ for catalysis, and glyoxalase II proteins can contain two metal ions in the active site at once [
12].
The present study reports a putative mechanism for the oxidation of intracellular elemental sulfur in B. leptomitoformis involving persulfide dioxygenase similar to that described for heterotrophic microorganisms, and shows for the first time its link to energy metabolism. Here, we report the first structure of a recombinant PDO obtained for a representative from a group of colorless filamentous sulfur bacteria, Beggiatoa leptomitoformis, and provide a comparative structural and biochemical characterization with known PDOs.
3. Discussion
Representatives of the genus
Beggiatoa use oxidation reactions of reduced sulfur compounds to obtain energy. As a result of these reactions, elemental sulfur, which accumulates in the cell, and sulfate are formed as products [
1,
2,
6,
33]. The way in which the further transformation of intracellular sulfur is carried out in members of the genus was unknown and remained a mystery for decades.
Observation of the strain B. leptomitoformis D-402 during growth in the presence of reduced sulfur compounds showed that the cells obviously lose intracellular sulfur and, more interestingly, re-accumulate it. While other sulfur-oxidizing prokaryotes use sHdr and rDsr to oxidize elemental sulfur, the genome of B. leptomitoformis lacks these genes, as well as genes encoding the sulfur reductase SOR of the elemental sulfur reduction. Thus, it is not clear how the disappearance of intracellular sulfur inclusions in representatives of the genus Beggiatoa occurs.
In this connection, the question of elemental sulfur oxidation in representatives of the genus
Beggiatoa remained open for a long time. A BLASTP search identified two protein sequences (ALG68607.1 and WP_201800136.1) in
B. leptomitoformis D-402 presumably related to persulfide dioxygenase from the metallo-β-lactamase superfamily. Phylogenetic analysis showed clustering of one of the proteins found with type I PDO (
Figure 2).
To date, there is no information on the role of this enzyme for members of the genus
Beggiatoa. However, a sulfide oxidation pathway involving persulfide dioxygenase is described for the heterotrophic bacterium
Cupriavidus pinatubonensis JMP134 [
15,
34]. The initial oxidation of sulfide occurs in the cytoplasm under the action of SQR. The resulting sulfane sulfur (S
0 and polysulfide) is metabolized to sulfite by the action of persulfide dioxygenase. In turn, sulfite is able to chemically react with sulfane sulfur to form thiosulfate, which is then transported to the periplasm and oxidized to sulfate by the Sox-system. This mechanism in heterotrophic prokaryotes is primarily aimed at the detoxification of hydrogen sulfide. However, it should be noted that, to date, persulfide dioxygenase is the only enzyme found that could potentially be involved in the oxidation of stored elemental sulfur in representatives of
Beggiatoa, such as
B. leptomitoformis and
B. alba.
The SQR and FCSD genes of the two systems for the oxidation of sulfide to elemental sulfur are encoded in the D-402 genome. FCSD proteins are soluble periplasmic enzymes, while SQRs can be localized in both periplasm and cytoplasm but are always membrane bound [
35]. The use of hydrogen sulfide as an energy substrate during lithotrophic growth requires the presence of multiple, mutually complementary enzymes with well-defined optima of hydrogen sulfide concentration, but which enzyme is preferentially used for sulfide oxidation by
B. leptomitoformis is not yet clear.
Also, genes for a number of sulfur compound transporters, Rhd, DsrE, and TusA, are present in the genome. In most chemolithoautotrophic sulfur-oxidizing bacteria the
rhd,
dsrE, and
tusA genes are located directly with the
rdsr and
shdr genes of intracellular elemental sulfur oxidation. For the purple sulfur-oxidizing bacterium
Allochromatium vinosum, it was shown that Rhd, TusA, and DsrE are involved in the cytoplasmic transport of persulfide intermediates to the sHdr and rDsr complex in the dissimilatory sulfur-oxidation reaction [
36,
37,
38]. In some cases, the
dsrE–
rhd–
tusA cluster is located immediately upstream of the
dsr gene cluster, or
tusA and
dsrE are linked to the
hdr genes, or
tusA is located next to the
dsr and
soeABC genes [
39,
40].
In
B. leptomitoformis, genes encoding enzymes of dissimilatory sulfur metabolism do not occur in the same cluster but in different parts of the genome. However, in the absence of
rdsr and
shdr genes in
B. leptomitoformis, it is not completely clear what function Rhd, TusA, and DsrE could play in these bacteria. It is possible that in
B. leptomitoformis these proteins are similarly involved in the transfer of sulfane sulfur through a cascade mechanism with the formation of GSSH, which is oxidized by PDO to sulfite [
16,
22,
38]. In this case, GSH and sulfite can act as sulfane sulfur acceptors [
10,
14,
16].
For
Beggiatoa spp., it has been shown that sulfur arranged into sulfur globules is in the form of a combination of cyclooctasulfur and inorganic polysulfides [
7]. Polysulfides are a versatile pool of bioavailable sulfur. However, cyclooctasulfur requires activation to convert it to the available glutathione persulfide form, which is formed by the non-enzymatic reaction of GSH and elemental sulfur, as shown for representatives of
Acidithiobacillus and
Acidiphilium [
10]. This produces glutathione persulfide, which is a substrate for persulfide dioxygenase [
10].
Proteomic data obtained for the strain D-402 under growth conditions in the presence of endogenous sulfur alone showed a statistically significant change in expression profiles for PDO, SoxB, DsrE, and TusA proteins. SoxAXYZ proteins did not show a statistically significant change in expression levels. However, quantitative RT-PCR data showed an average 6- and 15-fold increase in the expression of the
pdo persulfide dioxygenase gene and Sox-system genes, respectively, under chemolithoautotrophic conditions in the presence of elemental sulfur alone compared with chemolithoautotrophic growth in the presence of sodium sulfide (
Figure 9).
Despite the fact that sulfite is the final intermediate of elemental sulfur oxidation with the participation of persulfide dioxygenase, it could not be registered among the products. According to data for other heterotrophic bacteria, the absence of sulfite among the detected products seems to indicate that the released sulfite does not accumulate in the medium but reacts immediately non-enzymatically with sulfane sulfur to form thiosulfate [
13,
14,
17,
41].
The gene of the membrane-bound cytoplasmic sulfite:quinone oxidoreductase SoeABC complex is encoded in the genome of
B. leptomitoformis. Thus it can be assumed that the complex may be involved in sulfite oxidation following the persulfide dioxygenase reaction. However, according to previously obtained data for
B. leptomitoformis, SoeABC exhibits its activity only under microaerobic conditions, which excludes the possibility of this enzyme functioning in the investigated process, which is carried out under aerobic conditions [
2]. These conclusions are confirmed by proteomic analysis, for which culture samples were grown under aerobic conditions, where we were unable to detect any of the proteins of the SoeABC complex.
During the growth of the B. leptomitoformis strain, the re-appearance of intracellular sulfur inclusions was observed, and the only products detected other than intracellular sulfur were thiosulfate and sulfate. A similar pattern could be observed if the Sox-system is involved. The genes of the branched Sox-system are encoded in the genome of B. leptomitoformis, in which thiosulfate is oxidized to form sulfate and elemental sulfur, which accumulates in cells. Thus, thiosulfate is most likely formed by secondary chemical interaction of sulfite and sulfane sulfur in B. leptomitoformis. It is subsequently oxidized in the periplasm with the participation of the branched Sox-system, without SoxCD proteins. This produces elemental sulfur, which re-accumulates in the cell, and sulfate, which we observed as one of the products during the growth of B. leptomitoformis in the presence of endogenous sulfur alone. This concept is also confirmed by the results of RT-qPCR and proteomic analysis. However, we did not observe a tendency for thiosulfate to oxidize relative to accumulated sulfate. Probably, this may be due to the fact that the processes of thiosulfate formation and its oxidation through the Sox-system are spatially separated (thiosulfate formation occurs in the cytoplasm and its oxidation in the periplasm).
The formation and further dissimilatory conversion of thiosulfate is crucial for B. leptomitoformis because persulfide dioxygenase catalyzes the reaction without generating energy. At the first view, the persulfide dioxygenase reaction seems to be an unnecessary loss to the cell. We should take into account the fact that the strain D-402 grew well when using intracellular elemental sulfur as the only energy source and CO2 as an inorganic carbon source. That is, thiosulfate here may act as an indirect electron donor for energy metabolism, being oxidized by the dissimilatory pathway through the Sox-system.
Structural and Biochemical Characterization of Recombinant PDO from B. leptomitoformis D-402.
The physicochemical properties of
B. leptomitoformis PDO were similar to those of other previously studied enzymes of this family. PDOs were characterized by maximum activity at the physiological pH of the cytoplasm (from 7.4 to 7.8) [
12]. In this study, the optimal pH for GSSH oxidation was pH 7.5, which agrees well with the previously obtained data. The enzyme demonstrated maximal activity at 40 °C, which also agrees well with previously obtained data for other enzymes (usually PDO enzymes show maximal activity at 35–45 °C) [
11,
12,
28,
42]. The enzyme was not characterized by high thermal stability. A decrease in PDO activity was observed after one hour of incubation at 30 °C. This may be due to the fact that the strain producing the enzyme is a mesophilic strain that lives at temperatures ranging from 8 °C to 32 °C, and, therefore, it is not necessary to produce thermally stable enzymes for normal metabolic processes.
The study of the effect of inhibitors on PDO activity showed that Cu
2+, Zn
2+, and Ni
2+ at a concentration of 1 mM significantly reduce the enzyme activity, Mn
2+ inhibited the PDO to a much lesser extent, while Mg
2+ and EDTA reduced the activity marginally. Several studies have also reported the inhibitory effect of Cu
2+, Zn
2+, and Ni
2+ on PDO activity [
11,
42]. The inhibitory effect of Cu
2+, Zn
2+, and Ni
2+ may be related to the substitution of an iron ion in the active site of the PDO.
The crystal structure of PDO B. leptomitoformis allowed us to perform a comparative structural analysis with the active sites of other type I PDOs. We compared the putative substrate-binding PDO pocket of B. leptomitoformis with corresponding sites in hETHE1, MxPDOI, and BpPRF in complex with glutathione.
The amino acid residues of the putative substrate-binding pocket of the
B. leptomitoformis PDO, as in other type I PDOs, form two walls, one structurally rigid, conserved wall formed by, among others, Arg194 and Tyr177, and a second wall opposite, a structurally mobile wall formed by two loops (
Figure 11 and
Figure 12). One of these loops (containing Thr213, Asn215, and Arg217) is more variable (
Figure 11a), both in shape (Arg217 in the PDO from
B. leptomitoformis and
BpPRF is oriented in the other direction unlike Lys216 in hETHE1) and charge (Asn215 and Thr213 in the PDO from
B. leptomitoformis instead of His214 and Leu212 as in hETHE1 and
BpPRF).
As for the second loop, the position of the conserved Phe146 and Gln147 varies in different type I PDOs (
Figure 11b and
Figure 12), apparently depending on which amino acid residue is at position 148 (Ala, Gln, Arg, Glu, or Asn). It is interesting to note the difference in the position of the side groups of the polar (glutamine) and hydrophobic (phenylalanine) residues in this loop in different PDOs. In hETHE1 and
MxPDOI, the polar group of Gln146 is involved in the formation of the active site, while the hydrophobic side group of Phe145 is turned aside. However, in the PDO of
B. leptomitoformis, Phe146 makes a hydrophobic contribution to the active site surface, while the charged group of Gln147 participates in the formation of the dimer interface. A similar loop arrangement is observed in the structure of the active site of
BpPRF. The rotation of the phenyl group of phenylalanine can affect the location of substrate/product in the active site of the enzyme.
The second coordination sphere of the iron ion in the PDO of
B. leptomitoformis differs from other known type I PDO structures by a single residue (His117), with His replaced by Cys in hETHE1 and
BpPRF (
Figure 11b) or Ser in
MxPDOI (
Figure 12). The His117 side group, unlike cysteine and serine in the corresponding position, displaces water molecules located in the internal cavity of the enzyme, which can stabilize the hydrogen bonding network near the active center and affect the enzyme activity.
Thus, the structural analyses demonstrate that there are differences both in the intermonomers’ interface and in the substrate-binding pocket geometry of PDO B. leptomitoformis compared with other type I PDOs.
The data obtained suggest that the reaction of sulfur oxidation to sulfite in
B. leptomitoformis D-402 is catalyzed by persulfide dioxygenase similar to the mechanism described for the heterotrophic bacterium
Cupriavidus pinatubonensis JMP134 (
Figure 13). The thiosulfate formed as an intermediate is used by
B. leptomitoformis during lithotrophic growth. In this process, the oxidation of thiosulfate occurs with the participation of the Sox-system to generate energy.
The main difference between
B. leptomitoformis compared to
C. pinatubonensis JMP134 is in the transformation of thiosulfate, or rather in its oxidation products. In the first case, a branched Sox-system functions, without SoxCD proteins, resulting in the formation of elemental sulfur and sulfate. In the second case, the full Sox-system functions and only sulfates are formed. In a recent study, cells of the mutant strain of
C. pinatubonensis JMP134, in which the
soxCD gene was deleted, produced sulfane sulfur, which was almost immediately oxidized with PDO participation [
34]. Due to the fact that the sulfur in
B. leptomitoformis is enclosed in a protein envelope, there is no need for its urgent removal to avoid toxic effects on the cell [
2]. Therefore, bacteria can store it as an energy reserve for a long period to re-incorporate it into energy metabolism when needed.
4. Materials and Methods
4.1. Composition of Nutrient Media
The
B. leptomitoformis D-402 strain was cultured under different conditions, which were based on the following mineral composition medium, g L
−1: NaNO
3 (0.620); NaH
2PO
4 (0.125); CaCl
2·2H
2O (0.030); Na
2SO
4 (0.500); KCl (0.125); MgCl
2·6H
2O (0.050). The pH of the medium was adjusted to 7.0 before sowing. Before culturing, 1 mL each of vitamin (thiamine (B
1), biotin (B
7) and cobalamin (B
12)) and 1 mL of trace elements were added to the medium [
43]. The culture was incubated at 27 °C.
For chemolithoautotrophic growth in the presence of reduced sulfur compounds, sodium thiosulfate (1.0 g/L Na2S2O3·5H2O) or sodium sulfide (0.6 g/L Na2S·9H2O) was added to the medium as an electron donor for energy metabolism. When cultured with the addition of sodium sulfide, the method of creating gradient media was used. An agar column at a concentration of 15 g/L containing 0.6 g/L Na2S·9H2O was used as the bottom layer; nutrient medium of the above composition was used as the top layer. Vials with a capacity of 0.5 L were used for cultivation. The height of the bottom layer was 3–4 cm, and the height of the top layer was 7–8 cm.
Chemolithoautotrophic growth in the presence of elemental sulfur was initiated by adding inoculum from the medium containing sodium sulfide as an energy source to the starvation mineral medium with only 0.5 g/L NaHCO
3 as an inorganic carbon source. The starvation mineral medium contained only a basic mineral composition and NaHCO
3 as an inorganic carbon source. When such medium was inoculated with
B. leptomitoformis D-402 cells, elemental sulfur located intracellularly acted as an electron donor for energy metabolism. To remove trace amounts of the energy substrate, two successive passages were performed. Under these conditions, by the second passage, the only possible energy substrate or its precursor is intracellular sulfur. The absence of traces of sodium sulfide in the medium was confirmed using iodometric titration [
44]. Intracellular sulfur was observed visually.
To create chemolithoheterotrophic culturing conditions, Na2S2O3·5H2O and lactate were added to the mineral medium at concentrations of 1.0 and 0.25 g/L, respectively. Chemoorganoheterotrophic growth of B. leptomitoformis D-402 was initiated by adding 0.25 g/L lactate to the mineral medium.
4.2. Genome Annotation and Phylogenetic Analysis
Gene search and annotation were carried out using the RAST server 2 [
45], followed by manual correction of the annotation by comparing the predicted protein sequences with the National Center for Biotechnology Information (NCBI) databases.
The search for PDO homologs was performed using NCBI BLASTP (
http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 10 May 2023). The obtained amino acid sequences were aligned using ClustalW software for multiple sequence alignment. The phylogenetic tree of homologous proteins was constructed by the neighbor-joining method [
46] using p-distance in the MEGA 11 program [
47]. The fidelity values of branching nodes were evaluated using bootstrap analysis by constructing 1000 alternative trees. Subcellular localization of proteins was predicted using the PSORTB v3.0 tool (
http://www.psort.org/psortb/, accessed on 15 May 2023). The presence of signal peptides was predicted using Signal P v.5.0 (
https://services.healthtech.dtu.dk/service.php?SignalP-5.0, accessed on 15 May 2023) and InterPro (
https://www.ebi.ac.uk/interpro/, accessed on 15 May 2023).
4.3. Sample Preparation for Proteomic Analysis
Samples were ultrasonicated on ice in pulse mode for 30 s in triethylammonium bicarbonate (TEAB) buffer containing 4% SDS. The homogenate was centrifuged at 14,000×
g for 10 min at 10 °C. Protein concentration was determined by the Bradford method on an Evolution 260 Bio spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Sample preparation was carried out by suspension trapping on an S-trap filter using 5% SDS [
48].
4.4. High-Performance Liquid Chromatography in Combination with Tandem Mass Spectrometry (HPLC-MS/MS)
The mass spectrometric analysis of samples after hydrolysis was performed using an Ultimate 3000 RSLCnano chromatography HPLC system (Thermo Fisher Scientific, Waltham, MA, USA) coupled to a Q-Exactive HF-X mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). Chromatographic separation of peptides was performed on an analytical reverse phase column Acclaim Pepmap® C18 of 15 cm in length and with an inner diameter of 75 μm (C₁₈-reversed phase silica gel was used as packing material (particle size 3 μm, pore size 10 nm); Thermo Fisher Scientific, Waltham, MA, USA) in gradient elution mode. The gradient was formed with mobile phase A (0.1% formic acid in deionized water) and mobile phase B (80% acetonitrile, 0.1% formic acid in deionized water) from 5% to 30% for 70 min at a flow rate of 0.4 μL/min followed by equilibration of the chromatographic system at initial gradient conditions (A:B = 2:98) for 8 min.
The mass spectrometric analysis was performed in four replicates on a Q Exactive HF mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) in positive ionization mode using a nanoelectrospray ionization source (nESI). Mass spectra were obtained with a resolution of 60,000 (MS) and 15,000 (MS/MS) in the range of m/z 375–1300 (MS) and 200–2000 (MS/MS), respectively. An isolation threshold of 50,000 counts was determined for precursor selection and the top 10 precursors were selected for fragmentation with high-energy collision-induced dissociation at 29 NCE and an accumulation time of 100 ms. Precursors with a charged state of +1 were discarded and all measured precursors were excluded from the measurement for 10 s. The maximum accumulation time for precursor ions was 50 ms and 150 ms for fragment ions.
The proteins were identified using the MaxQuant v.1.6.17.0 program with the Andromeda search algorithm [
49]. The UniProt (Swiss-prot) database of
Beggiatoa leptomitoformis D-402 was used for protein identification. The following parameters were determined: the proteolytic cleavage enzyme was trypsin; the mass accuracy of monoisotopic peptides was ±5 ppm; the mass accuracy of the MS/MS spectra was ±0.01 Da; and there was the possibility of missing two cleavage sites by trypsin. Modification of cysteine by chloroacetoamide was considered as a fixed peptide modification, and methionine oxidation and N-terminal acetylation were considered as variable modifications. An FDR (False Discovery Rate) value of no more than 1.0% was used for validation of PSMs (Peptide-Spectrum Matches), peptide identification, and protein identification. Proteins for which at least two peptides were detected were considered as reliably identified. The protein content label-free quantification was based on iBAQ and LFQ.
Statistical analysis of the data obtained during identification was performed in the Perseus v.1.6.15.0 program. The data were preliminarily filtered to select the most significant points: possible contaminant proteins and unreliable identified proteins were removed.
To isolate significant differences between sample proteins, the list of proteins was further filtered; proteins that occurred in at least two repetitions of the analysis out of four were retained.
4.5. Cloning of the PdoI Gene
Genomic DNA was isolated using the diaGene Kit (Dia-M, Moscow, Russia) according to the manufacturer’s instructions. The gene of persulfide dioxygenase was identified in the annotated genome sequence of
B. leptomitoformis and analyzed using Blast (
https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 10 May 2023) and InterPro (
https://www.ebi.ac.uk/interpro/, accessed on 15 May 2023). The full-length gene of PDO was amplified from genomic DNA by PCR using BlitzMasterMix (Belbiolabs, Moscow, Russia). The sequences of the forward PdoIFe_Nde and the reverse PdoIRe_Xho_22 primer were AGTCATATGATTTTTCAACAATTATTTGAGTCTAG and ATATCTCGAGCACCAGTGTTTCACATAACTG, respectively. The PCR amplification program was as follows: 98 °C, 30″ + [(98 °C, 10″ + 50 °C, 30″ + 72 °C, 1′) × 35] + 72 °C 2′. The PCR product of the appropriate size was purified using the diaGene Kit (Dia-M, Moscow, Russia), and the gene sequence was confirmed by sequencing.
To clone the gene into the pET-22b(+) expression vector at the NdeI and XhoI restriction endonuclease sites, the plasmid and PCR product were treated with restriction endonucleases (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Then, the ligation reaction of the vector and amplicon was carried out at +15 °C using T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA). Competent cells of E. coli DH5a were transformed with a ligation mixture containing the pET22b::pdoI construct. Insertion plasmids were obtained from the overnight culture of transformants. The sequence of the inserted pdoI was verified for the absence of mutations by sequencing.
4.6. Recombinant Expression and Purification
For the production of recombinant PDO, the strain
E. coli BL21-CodonPlus (DE3) was transformed with the
pET22b::pdoI plasmid and grown at 37 °C with agitation at 250 rpm to a cell density of 0.6–0.8 (A600). Then, 0.9 mM isopropyl-β-D-thiogalactopyranoside was added to the culture medium and the cells were incubated for 18 h at 16 °C with agitation at 100 rpm. Cells were collected by centrifugation at 4000×
g for 20 min, suspended in 35 mL of 50 mM KPi buffer, pH 7.5, containing 0.5 M NaCl, 1 mM imidazole (buffer 1) with the addition of protease inhibitors (1 mM alpha-aminocaproic acid, 1 mM PMSF, and 1 mM benzamidine) and disrupted by sonication. Cell debris was removed by centrifugation (90 min at 12,000×
g) and protein was purified by affinity chromatography on a HisTrap 5 mL column (GE Healthcare, Chicago, IL, USA). Cell extract was loaded onto a HisTrap column equilibrated with Buffer 1, then washed with five volumes of Buffer 1 and then washed with five volumes of Buffer 2 (50 mM KPi buffer, 0.5 M NaCl, 50 mM imidazole, pH 7.5). Fractions containing the enzyme were eluted with Buffer 3 (50 mM KPi buffer, 0.5 M NaCl, 300 mM imidazole, pH 7.5). After the chromatography stage, the protein was dialyzed against 50 mM KPi buffer (pH 7.5). The concentration of the protein was determined using the molar extinction at 280 nm (ε = 15,040 M
−1 × cm
−1) calculated from the protein sequence using the Vector NTI Program (Life Technologies, Carlsbad, CA, USA). The molecular mass of enzyme was determined by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) according to Laemmli, 1970 [
50].
4.7. PDO Activity Assay
PDO activity was analyzed using the method of Suzuki, 1965 [
51], based on the detection of oxygen consumption [
17] with modifications. The O
2 consumption rate was measured with a Clarke-type electrode in a 1 mL cell (Hansatech Instruments Ltd., Norfolk, UK) at 35 °C (unless otherwise indicated) in the reaction media containing a mixture of 50 mM KPi buffer (pH 7.0) and GSSH in a 1:1 ratio. GSSH was produced by mixing equal volumes of 17 mM reduced glutathione in distilled water and a saturated sulfur solution, containing about 17 mM elemental sulfur [
52]. Before the measurement, the reaction mixture was pre-incubated for 1 min in the cell covered with a cap; after that, the non-enzymatic change in the O
2 level was recorded for 140 s. The enzymatic reaction was initiated by the PDO addition through the channel in the chamber cap with a gel loading tip. Before measurements, the GSSH mixture and PDO were kept on ice. For calculation of the maximum O
2 consumption rate, a linear part of the curve was selected. The concentration of the enzyme in the cell was 30 µg. The calibration of the electrode was performed by adding a few grains of dithionite, and the concentration of dissolved O
2 was assumed as 219 µM mL
−1. The O
2 consumption rate was determined as µmol O
2 mg
−1 h
−1. One unit (U) of PDO activity was defined to consume 1 nmol O
2 mg
−1 min
−1 [
16].
4.8. Biochemical Characteristics of PDO
The effect of pH and temperature on PDO activity and stability was tested using GSSH as a substrate. The pH optimum of PDO activity was measured in the range of 6.0 to 8.0 in increments of 0.5 units at 35 °C in 50 mM KPi buffer. The optimum temperature of enzyme activity was measured from 25 °C to 55 °C in increments of 5 °C in 50 mM KPi buffer (pH 7.0). The thermal stability of PDO was determined by measuring the residual enzyme activity after one hour of incubation at 30 °C, 40 °C, 45 °C, and 50 °C in the same buffer at pH 7.0. The stability of the enzyme at different pH values was evaluated by incubating the protein in 50 mM KPi buffer in cold conditions for a week over the pH range of 6.0 to 11.0 by increments of 1.0 unit.
Residual activity assay was determined in 50 mM KPi buffer (pH 7.0) at 35 °C using GSSH as a substrate.
The inhibition of enzyme activity was evaluated using metal ions (Cu
2+, Zn
2+, Mn
2+, Mg
2+, Fe
3+) and EDTA by assaying PDO activity as described above in the presence of each reagent at a concentration of 1 mM in 50 mM KPi buffer (pH 7.0) at 35 °C [
11].
4.9. Crystallization
Crystallization experiments were performed at 22 °C using the hanging-drop vapor-diffusion method on siliconized glass cover slides in Linbro plates (Molecular Dimensions Ltd., Sheffield, UK). Crystallization drops were made by mixing 1 μL of protein solution with a concentration of 10 mg/mL in 50 mM KPi buffer (pH 7.0) containing 100 mM NaCl and 1 μL of reservoir solution. Crystals of PDO were obtained in 8% w/v PEG 4000, 0.2 M imidazole malate, pH 6.0 (condition # 13 of Stura Footprint Screen-2, Molecular Dimensions Ltd., Sheffield, UK). Prior to flash freezing, a single crystal was soaked in a cryo solution consisting of 25.5% w/v PEG 4000, 15% glycerol, 0.085 M sodium citrate, pH 5.6, 0.17 M ammonium acetate (Condition # 9 of Crystal Screen Cryo, Hampton Research, Aliso Viejo, CA, USA).
4.10. Crystallography
Diffraction data from the PDO crystal were collected on a beamline BL18U1 at SSRF, China. The reflection dataset was processed using XDS [
53]. The structures were determined using molecular replacement with Phaser [
54], with the hETHE1 structure, determined at a 2.6 Å resolution (pdb id 4CHL), being used as a search model. The water molecules and metal ions were removed from the model. The initial model was subjected to crystallographic refinement with REFMAC5 [
55]. The manual rebuilding of the model was carried out in Coot [
56]. The final cycle, with occupancy refinement, was performed in Phenix [
57]. The data and refinement statistics are summarized in
Table 2. The atom coordinates and structure factors have been deposited in the Protein Data Bank (
http://wwpdb.org/, accessed on 26 April 2024). Figures were prepared using PyMOL (
http://www.pymol.org/, accessed on 20 October 2023) [
58].
4.11. Gene Expression Analysis
Gene expression was analyzed during the chemolithoautotrophic growth of B. leptomitoformis D-402, when either sodium sulfide or intracellular sulfur was used as an electron donor for energy metabolism, and during organoheterotrophic growth as a control. The gene of DNA gyrase subunit B (gyrB) and the 16S rRNA gene (rrs) were used as reference genes for analysis.
RNA was isolated using the ExtractRNA reagent (Evrogen, Moscow, Russia) in accordance with the manufacturer’s protocol. RNA quality was evaluated by electrophoresis on a 1.1% agarose gel with 2.2 M formaldehyde added. RNA concentration was measured using an HS Equalbit RNA assay kit (Vazyme, Nanjing, China) on a Fluo-200 fluorometer (Allsheng, Hangzhou, China). Then, 2000 ng of RNA was reverse transcribed using M-MulV (SybEnzyme, Moscow, Russia) according to the manufacturer’s protocol. Quantitative RT-PCR was performed using SYBR Green I on a Bio-Rad CFX96 touch real-time PCR detection system (Bio-Rad, Hercules, CA, USA).
A temperature gradient was used to find optimal amplification conditions. The resulting program for
soxAXBYZ genes of the Sox-system included 95 °C, 5′ + [(95 °C, 10″ + 58 °C, 20″ + 72 °C, 15″) × 35]; for the
rrs,
gyrB, and
pdo genes, the program included 95 °C, 5′ + [(95 °C, 20″ + 60 °C, 20″ + 72 °C, 15″) × 35]. Fragments of genes were amplified using the primers 5′–TGGGCTGTACCAGAAGTAGGT–3′ and 5′–GTTACGACTTCACCCCAGTCA–3′ for the
rrs gene; 5′–ACGCATTTATTCAACGGGGC–3′ and 5′–ACGGCGGGCTTCATTCATTA–3′ for the
gyrB gene; 5′–TTTCCCACCTATCGCACCAG–3′ and 5′–TCGAATAGCGACACCACACC–3′ for
soxAX; 5′–AACACGATGCACAAATCGCC–3′ and 5′–TGCAGGTTTGGTCTAGGACG–3′ for
soxB; 5′–TAAAATGGGTGGGACGGGTG–3′ and 5′–CCACAACCGCCAATAGTCAC–3′ for
soxY; 5′–ATACGGGCGAGTTGATTCCTG–3′ and 5′–GCTCCAAATGGCACTCATCAC–3′ for
soxZ; and 5′–TTGCCCAAGAAAAACAGCGT–3′ and 5′–TTTGCGCGGATTTGGTGTTT–3′ for
pdo. All primers were designed with PrimerBLAST (
http://www.ncbi.nlm.nih.gov/tools/primer-blast, accessed on 8 June 2023).
4.12. Quantitative Method for the Determination of Elemental Sulfur, Thiosulfate, and Sulfate
Sulfate and thiosulfate were assayed using a Stayer HPLC chromatograph (Aquilon, Moscow, Russia) equipped with a conductivity detector. Separation was operated isocratically at 35 °C on a Dionex IonPac AS22 column (Thermo Fisher Scientific, Waltham, MA, USA) with 4.5 mM sodium carbonate/1.4 mM sodium bicarbonate buffer plus 10% of methanol with a flow rate of 1.0 mL/min. The column (250 × 4 mm, particle size 6 µm) had a polyvinylbenzyl ammonium matrix cross-linked with 55% of divinylbenzene and alkanol quaternary ammonium as a functional group. Before injection, the samples of microbial suspensions were freed from the cells by centrifugation at 15,000× g and 15 min.
Changes in the content of sulfur inclusions in B. leptomitoformis D-402 cells were observed visually using an Olympus CX31 HD Digital microscope (Olympus, Tokyo, Japan) equipped with objectives of the AmScope Infinity Plan 100X/1.25 Oil with phase contrast. The culture of strain D-402 was analyzed by microscope in at least 30 fields of view. Sulfur globules were defined as highly refractive intracellular inclusions of a spherical shape.