Next Article in Journal
Kinetic Study of Coprinus cinereus Peroxidase-Catalyzed Oxidation of 2,2′-Dihydroxyazobenzene
Previous Article in Journal
The Sensitization Profile for Selected Food Allergens in Polish Children Assessed with the Use of a Precision Allergy Molecular Diagnostic Technique
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 2
10.3390/ijms25020827
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Knockdown of the ABCG23 Gene Disrupts the Development and Lipid Accumulation of Panonychus citri (Acari/Tetranychidae)

by
Hongyan Wang
†,
Haifeng Wang
†,
Tianrong Xin
and
Bin Xia
*
School of Life Sciences, Nanchang University, Nanchang 330031, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work as co-first authors.
Int. J. Mol. Sci. 2024, 25(2), 827; https://doi.org/10.3390/ijms25020827
Submission received: 7 November 2023 / Revised: 4 January 2024 / Accepted: 8 January 2024 / Published: 9 January 2024
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

:
Panonychus citri is a worldwide citrus pest that is currently controlled through the use of insecticides. However, alternative strategies are required to manage P. citri. Recent studies suggest that the ATP-binding cassette (ABC) transporter G subfamily plays a crucial role in transporting cuticular lipids, which are essential for the insect’s barrier function against microbial penetration. Therefore, investigating the potential of the ABC transporter G subfamily as a control measure for P. citri could be a promising approach. Based on the genome database, the gene was cloned, and the transcriptional response of ABCG23 for the different developmental stages of P. citri and under spirobudiclofen stress was investigated. Our results showed that the expression level of ABCG23 was significantly lower in adult females exposed to treatment compared to the control and was higher in females than males. The knockdown of ABCG23 using RNAi led to a decrease in the survival rate, fecundity, and TG contents of P. citri. Additionally, a lethal phenotype was characterized by body wrinkling and darkening. These results indicate that ABCG23 may be involved in cuticular lipid transportation and have adverse effects on the development and reproduction of P. citri, providing insight into the discovery of new targets for pest management based on the insect cuticle’s penetration barrier function.

1. Introduction

ATP-binding cassette (ABC) transporters are the largest transport family found in plants, animals, and other living organisms. They use the energy released by ATP hydrolysis to move a broad range of biological molecules across cell membranes, such as lipids, amino acids, polypeptides, toxins, and chemical drugs [1]. These transporters can be classified into eight subfamilies (ABCA to ABCH) based on their sequence similarity and domain conservation [2]. ABC transporter proteins consist of the following two domains that are conserved across species: nucleotide-binding domains (NBDs) and transmembrane domains (TMDs).
These domains are crucial for the function of transporter proteins [3,4,5]. In insects, ABC transporters play crucial roles in various physiological processes, including development, reproduction, and insecticide resistance. For instance, when ApABCG4 was silenced during wing development, approximately 50% of the aphids had malformed wings [6]. The injection of TcABCH-9C dsRNA significantly decreased the number of eggs laid by Tribolium castaneum, resulting in no egg hatching [7]. Furthermore, the overexpression of ABCC1 has been associated with resistance against imidacloprid and chlorpyrifos in Rhopalosiphum padi [8], while specific ABCA and ABCC genes have been discovered to confer resistance to diflubenzuron in T. castaneum [9]. Moreover, ABC transporters have been implicated in the formation of the cuticle barrier in insects [10]. Overall, ABC transporters exhibit a diverse range of functions in insects.
The ABC transporter G subfamily has been identified as the largest subfamily of the ABC transporter across multiple species [11,12]. Recently, the involvement of ABCG transporters in insect development, reproduction, and insecticide resistance has been widely reported. The ABC transporter G subfamily consists of half transporters that require dimerization to form functional homo- or heterodimeric transporters. In insect genomes, a range of 12 to 23 genes from the ABC transporter G subfamily have been identified [13,14,15]. These proteins not only potentially play a role in insecticide elimination but also participate in the transport of cuticular lipids [7,10,16], eye pigment precursors [7,17,18], and ecdysteroids [7,19].
The insect cuticle comprises mainly chitin, proteins, and lipids that interact to form a layered structure [20]. Secreted by the underlying epidermal cells, it covers the surface of the insect body and serves as a muscle attachment site that is necessary for locomotion, maintains the shape of the insect body, prevents water loss, and resists microbial penetration [21]. The loss or alteration of its components can affect the function of cuticles in insects, leading to abnormal growth and development. Therefore, disrupting the formation and function of the cuticle is a promising strategy for controlling pests [10]. The barrier function of the cuticle, which protects against microbial penetration, is primarily determined by the cuticular lipids.
Panonychus citri McGregor (Acari/Tetranychidae) is a highly destructive agricultural pest that is commonly controlled through the use of chemical insecticides [22,23,24]. One of these insecticides is spirobudiclofen, a tetronic acid derivative, acaricide, that targets lipid biosynthesis. The toxic stress treatments of the present study refer to our previous study [19] for the experimental results of the toxicity of spirobudiclofen against P. citri (LC30: 2.945 g/L and LC50: 5.847 g/L) [25]. However, to minimize the use of these chemicals, it is necessary to find new methods for managing P. citri.
In our study, the ABCG23 of P. citri was identified, which may offer a potential new target gene for controlling these pests. Meanwhile, PcABCG23 is specifically expressed in adult females and likely plays a role in lipid accumulation. In addition, our study found that inhibiting the expression of PcABCG23 resulted in decreased survival rates and fecundity in P. citri. These findings contribute to our understanding of the molecular functions of ABCG23 in the transport of insect cuticular lipids. Moreover, these results may help in the discovery of new targets for pest management based on the penetration barrier function.

2. Results

2.1. Cloning and Sequence Analysis

The cDNA full-length ABCG23 gene was 2749 bp, including an ORF of 2073 bp that encoded 690 amino acid proteins (GenBank OR912982). The study analyzed multiple alignments of known amino acid sequences of the ABCG23 transporter gene and found that the sequences were highly conserved among different species, as shown in Figure 1. The amino acid sequence of PcABCG23 had the highest degree of conservation among acarina, sharing an 82.57% sequence identity with Tetranychus urticae.
SMART online software (https://smart.embl.de/smart/set_mode.cgi?NORMAL=1 accessed on 13 August 2022) analysis revealed that the PcABCG23 contained 3-7 transmembrane regions. The 11 ABCG23 genes contained AAA domains (nucleotide binding domains (NBDs), Figure 2). To verify whether there was an error in the PcABCG23 protein sequence, we analyzed similar sequences from T. urticae, H. destructor, H. saltator, P. hypophthalmus, C. virginica, S. meridionalis, T. fulvidraco, I. punctatus, S. asotus, and A. mexicanus. We found that the ABCG23 gene in other species had the same AAA domain (Figure 2), which indicates that this protein is a member of the ABCG subfamily.
Phylogenetic tree analysis revealed a close evolutionary relationship between PcABCG23 and TuABCG23, indicating their recent differentiation and potential functional similarities (refer to Figure 3). In contrast, insects, acarina, and actinopterygii were separated from each other. The amino acid sequence of PcABCG23 showed the closest genetic distance to ABCG23 of T. urticae while showing the farthest genetic distance to ABCG23 of Ictalurus punctatus. Moreover, the genetic distances between acarina and insects were generally found to be close.

2.2. Expression of the PcABCG23

Regarding developmental stages, the RT-qPCR results demonstrated that the expression of ABCG23 was significantly higher in adults (both females and males) and eggs (Figure 4). Additionally, the expression of ABCG23 was found to be higher in females than in males and higher in adults compared to eggs. However, there was no significant difference in the expression of ABCG23 among the larva to deutonymph stages (Figure 4). According to different concentrations of spirobudiclofen stress, qPCR results showed a gradual decrease in the expression level of ABCG23 as the concentration increased (Figure 4).
The transcriptional responses of ABCG23 genes in P. citri adult females varied depending on the dsRNA concentration and feeding time (Figure 3 and Figure 4). The expression of ABCG23 was significantly affected by dsRNA concentration and feeding time, except that the expression of ABCG23 was not significantly affected by dsRNA fed to 500 ng/µL of dsRNA for 24 h (Figure 4). At all two feeding times, the expression of ABCG23 was increased when fed dsRNA (Figure 4). However, the expression of ABCG23 was reduced by 37% when fed with 1000 ng/µL of dsRNA for 24 h and by 55% when fed with 1500 ng/µL of dsRNA for 48 h (Figure 4). RT-qPCR analysis indicated that the expression level of ABCG23 was significantly lower in adult females fed on 1500 ng/µL of ABCG23 dsRNA for 48 h than those fed with the control dsGFP.

2.3. Effect of PcABCG23 Knockdown in P. citri

The survival rate of adult females exhibited a significant decrease when ABCG23 was silenced compared to being fed dsGFP for 48 h. Meanwhile, as the feeding time of dsRNA increased, the survival rate of adult females decreased more significantly, and the most significant decrease occurred at 24 h and 48 h (Figure 5). Moreover, the hatchability and oviposition of adult females were significantly lower when fed 1500 ng/µL of ABCG23 dsRNA compared to being fed dsGFP for 48 h (Figure 5).
After the successful gene silencing of PcABCG23, we investigated whether the inhibition of mRNA expression of the ABCG23 genes led to abnormal or lethal phenotypes. The P. citri phenotypes were observed and recorded at 48 h after PcABCG23 administration, and phenotypic deformities were classified into body shrinkage and those that did not shed their skin normally (Figure 5). No such phenotype was seen in the dsGFP group. Overall, in the adult females after RNAi, individuals showed severe abnormal phenotypes, such as abnormal body shrinkage phenotypes, and small individuals who died because of an inability to molt were observed (Figure 5).
Because ABCG23 showed a much lower expression in dsRNA treatment than dsGFP, which role in the synthesis of fatty acids was evaluated in P. citri using RNAi. Furthermore, treating adult females with ABCG23 dsRNA resulted in a 39% decrease in TG contents compared to control groups treated with dsGFP (Figure 5). Therefore, silencing ABCG23 led to a significant reduction in fatty acid synthesis in P. citri.

3. Materials and Methods

3.1. Mite Rearing and Acaricide

In 2019, a stable population of P. citri was established by collecting a colony from Nanchang University, Nanchang, China, and maintaining them through continuous breeding. P. citri were fed citrus tender leaves and kept in an artificial climate box (Percival Scientific, Model: ARC-36VL-DR, Haidian District, Beijing, China) with the following environmental conditions: a temperature of 25 ± 1 °C, a relative humidity (RH) of 70 ± 5%, and a photoperiod of 16:8 h. The population was not exposed to any pesticides until the present study (in 2022), which was considered the acaricide-susceptible strain (SS).
Spirobudiclofen at 24% SC, IUPAC: 3-(2,4-dichlorophenyl)-2-oxo-1-oxaspiro [4,5] dec-3-en-4-yl dibutyl carbonate, was bought from Zhejiang Yulong Biotechnology Co., Ltd. (Jiaxing, China).

3.2. Cloning and Sequencing the ABCG23 Gene

3.2.1. RNA Extraction, cDNA Synthesis

The total RNA was isolated from 200 adult females of P. citri using Trizol according to the manufacturer’s instructions (Sangon Biotechnology, Shanghai, China). Three biological replicates were set for each treatment group in all experiments.
The first strand synthesis kit (PrimeScript™ II 1st Strand cDNA Synthesis Kit, Takara Bio, Dalian, China) was used to reverse cDNA.
The SMARTer™ RACE 5′/3′ kit (Takara Bio, Dalian, China) was used to build libraries of 3′ RACE and 5′ RACE. Reverse-transcribed cDNA was placed at −20 °C.

3.2.2. Target Gene Fragment Cloning

Partial sequences of PcABCG23 were retrieved from the NCBI website (http://www.ncbi.nlm.nih.gov/gorf/gorf.html accessed on 2 May 2022). The open reading frames (ORFs) of the target nucleotide sequences were found using the ORF Finder at the NCBI website (https://www.ncbi.nlm.nih.gov/orffinder accessed on 5 July 2022) and verified via PCR. For full-length cDNA cloning, the rapid amplification of the cDNA Ends (RACE) kit (Clontech, Dalian, China) was used. Specific primers (Table 1) were designed using Oligo 7.0 software based on the intermediate fragment of PcABCG23.

3.3. PcABCG23 Expression Analysis

After the eggs were produced, developmental stages, including the egg (n = 500), larva (n = 400), protonymph (n = 300), deutonymph (n = 300), adult females (n = 200), and males (n = 200), were collected to determine the transcription levels of PcABCG23.
Based on previous multi-omics studies [25], the experimental results for the toxicity determination of spirobudiclofen against P. citri were obtained, and two concentrations of spirobudiclofen (LC30 and LC50 treated groups) were used for the treatment. According to the leaf disc impregnation method, the adult females of P. citri were treated with two sublethal concentrations of spirobudiclofen (n = 500 and three biological replicates per treatment group). After 24 h, samples (n = 200, three biological replicates per treatment group) were collected for RNA extraction to determine PcABCG23 expression levels.
The mRNA levels of the ABCG23 gene were measured via RT-qPCR using the 2×TaqPCR Master Mix in a StepOne Plus real-time quantitative PCR system. Specific primer pairs for each gene were designed using Oligo 7.0 (Table 1). The qPCR cycling parameters were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s and 60 °C for 30 s.
The RT-qPCR analysis was conducted as described [26], with the relative mRNA level of the target gene normalized to the expression of the internal marker genes glyceraldehyde phosphate dehydrogenase and elongation factor1a (GAPDH and ELF1A). The relative expression levels of PcABCG23 were measured using three biological replicates (egg (n = 500), larva (n = 400), protonymph (n = 300), deutonymph (n = 300), adult females (n = 200), adult males (n = 200)) and each sample was calculated in triplicate using the 2−ΔΔCT method [27]. The primers used for this analysis are listed in Table 1.

3.4. Synthesis of dsRNA and RNAi Efficiency Evaluation

3.4.1. dsRNA Synthesis and Delivery

Additionally, the functional verification of the ABCG23 gene with significantly different changes was performed via RNAi. RNAi experiments were subsequently performed using the collected adult females of P. citri.
Gene-specific primers (Table 1) containing a T7 polymerase promoter sequence were designed on the E-RNAi website (https://www.dkfz.de/signaling/e-rnai3/ accessed on 13 October 2022). The Aequorea Victoria (dsGFP) RNA sequence was used as a control. A T7 High Yield Transcription Kit (Vazyme Biotech Co., Ltd., Nanjing, China) was used for dsRNA synthesis. dsRNA was diluted with RNase-free water adjusted to the final concentration at 10 μg/μL and stored at −80 °C for RNAi experiments.
For the RNAi assay, the dsRNA sequences were introduced into P. citri through the feeding pattern. Adult females who were not exposed to insecticides were transferred to the citrus leaf dish (2 × 2 cm) with dsRNA for feeding. After that, the adult females were cultured in a climate-controlled chamber. After 24 h and 48 h of RNAi treatment, the samples were collected (n = 200, with 3 biological replicates per treatment) for RNA extraction.

3.4.2. RNAi Efficiency Evaluation

To establish the optimal dsRNA concentration of PcABCG23, adult females were fed with 500, 1000, 1500, and 2000 ng/μL dsRNA, and qRT-PCR was used to determine RNAi efficiency after 24 h. Two optimal dsRNA concentrations of PcABCG23 were identified, and RNAi efficiency was assessed at 24 h and 48 h after feeding to determine the duration of PcABCG23 silencing. Each sample contained 50 dsRNA-fed P. citri, and each treatment contained 3 biological replicates.

3.5. Evaluation of Biological Changes in P. citri after RNAi

3.5.1. Biological Observation after RNAi

We placed 60 adult females fed to dsRNA on citrus leaves to evaluate whether the PcABCG23 had adverse effects on their development and reproduction. Before calculating the survival rate and fecundity, we observed the individuals every 12 h until they died. dsGFP-fed individuals served as the control group (3 biological replicates per treatment group).

3.5.2. Evaluation of Fecundity after RNAi

To evaluate the fecundity of P. citri after PcABCG23 silencing, the adult females (n = 60) were transferred to citrus leaves in a climate-controlled chamber. After the dsABCG23 and dsGFP were fed for 48 h, the oviposition, hatchability, and survival of individuals were counted every 24 h until death.

3.5.3. Determination of Triacylglycerol (TG) after RNAi

To evaluate the TG contents of P. citri after PcABCG23 silencing, 300 adult females were prepared for an RNAi assay, and 60 surviving P. citri adult females were collected for determination. The TG contents were measured using the double antibody sandwich method, following the insect TG test instructions of the ELISA kit (Jingmei Biotechnology Co., Ltd., Yancheng, China). The OD values were determined using a photometer set at 450 nm. The amount of TG in the sample solution was computed based on the standard curve (3 biological replicates per treatment group). The experiment was completed by Wuhan Seville Biological Co., Ltd., Wuhan, China.

3.6. Statistical Analysis

Data analysis was performed using one-way ANOVA and Student’s t-test. The data were presented as the mean ± standard error. To evaluate the differences in the expression level of PcABCG23 across different stages and under two concentrations of spirobudiclofen stress, ANOVA followed by Tukey’s Honestly Significant Difference test was utilized. Student’s t-test was used to determine the statistical significance of the difference between the control and treatment groups.

4. Discussion

ABC transporters have been found to have a significant impact on insecticide resistance, as well as playing a crucial role in various physiological processes such as the construction of cuticle barriers, the synthesis of 20-hydroxyecdysone, transportation of xenobiotics, and the development of wings in aphids [6,10,28,29,30]. Previous studies have identified certain target genes, such as FAS, ELO, FAR, and P450, that are involved in the cuticular penetration barrier function, specifically related to lipid synthesis [31,32,33,34]. All animals, including insects, in all stages of their life cycle, necessitate the transportation of internal lipids from production sites to the cuticle and developing embryos [35]. Insects primarily rely on ABCG23, a major transport protein that acts as a reusable carrier, to accept and transport lipids between different tissues. At present, the involvement of ABCG23 in cuticular lipid accumulation and its precise role in P. citri reproduction remains unclear.
Therefore, we focused on the PcABCG23 gene and explored whether it contributes to the cuticular penetration barrier function. The ABCG23-coding gene was cloned and characterized based on P. citri genome sequences. Our results show that the ABCG23 gene shares similar characteristics with other species, as indicated by its AAA domain (Figure 2 and Figure 3). However, we also observed certain differences in the number of transmembrane domains.
To explore the function of PcABCG23, we determined the development-dependent mRNA expression of ABCG23 in P. citri. Our findings demonstrate that the transcript of PcABCG23 was abundantly expressed during the egg and adult stages of P. citri, while it was poorly expressed in other stages (Figure 4). This study suggests that the active expression of PcABCG23 can impact the reproduction of P. citri. Previous research has shown that insect eggs require an adequate nutrient reserve for successful embryonic development [36]. During oogenesis, lipids serve as the primary energy source for embryo development and must accumulate in growing oocytes. This is especially significant as lipids provide almost all the energy required for developing oocytes in mosquitos, such as Culex quinquefasciatus [37]. It can promote egg development by providing sufficient energy, which makes the lipid transport function particularly important.
To investigate the transcriptional response of PcABCG23 to spirobudiclofen stress, this study examined the mRNA expression in two sublethal concentrations of spirobudiclofen-treated groups of P. citri. The results show that the mRNA expression level of ABCG23 decreased with an increasing insecticide concentration. Our findings suggest that simply observing changes in transcript levels in response to insecticide treatment is not enough to determine if a particular gene is involved in insecticide detoxification. Numerous transcriptomic studies have reported changes in gene expression in response to insecticide treatment at sublethal concentrations across various insect species, including Bactrocera dorsalis, Drosophila melanogaster, and Plutella xyostella [38,39,40,41]. According to these studies, a large number of genes were determined to be changed in response to insecticide stress. However, it seems unlikely that all of these genes are directly involved in pesticide elimination. These findings are important for pest management as even low concentrations of pesticides may not exhibit a clear phenotypic change, and the regulation of genes affecting the entire genome can have unknown physiological and ecological effects.
In this work, we were particularly interested in ABCG23, which is involved in barrier formation and function. Insect epidermal lipids are mainly found on the surface of the cuticle. They help prevent the penetration of exogenous and potentially harmful substances [42]. Their amounts and composition include CHCs, sterols, fatty alcohols, triglycerides, fatty acids, and wax esters that vary by stage and species [21].
To analyze the possible biological role of PcABCG23 in the epidermal lipid transport and reproduction of P. citri, this gene was silenced using RNAi technology to observe the specific phenotype of P. citri adult females. An RNAi phenotype was found during the silencing of PcABCG23, which resulted in a significant decrease in the oviposition, hatchability, and survival rate. Overall, this phenotype was described for the knockdown of the ABCG23 gene as P. citri was not able to shed the old cuticle. Moreover, these adult females had wrinkles upon observation. Notably, the content of triglyceride significantly decreased when the ABCG23 gene was silenced. The phenotype of wrinkling is similar to the previously described phenotype of knocking down the lipoprotein (Lp) and lipoprotein receptor (LpR) in Locusta migratoria [21]. At the same time, we also found a phenomenon of pigment deposition in P. citri, also known as the melanization reaction. However, the blackening reaction is an important and special innate immune defense mechanism in insects. Among them, melanin is an important component of an insect’s sturdy epidermis, playing a barrier-protective role. As far as we know, this is the first study to verify the role of ABCG23 in cuticle lipid transportation and the reproduction of P. citri.
Here, our results indicate that the ABCG23 gene does not function alone but together with other mechanisms to promote the synthesis of cuticles. Further work is needed to assess the contribution of ABCG23. In summary, the ABCG23 transporter gene was suggested to be involved in cuticle lipid transportation and the reproduction of P. citri. The results help to better understand the evolution of cuticles and further study the function of the ABCG gene in cuticle lipid synthesis (Supplementary Materials).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25020827/s1.

Author Contributions

H.W. (Hongyan Wang): Writing, data analysis, completion of the experiments. H.W. (Haifeng Wang): Data analysis, mapping. T.X.: Experimental design. B.X.: Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This research is funded by the Ministry of Agriculture and Rural Affairs of China, grant number (13220141) and the APC is funded by the Graduate Innovation Foundation of Jiangxi Province, China, grant number (YC2022-B024).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained at: https://www.alipan.com/s/aXVE9BxM2Xz (accessed on 1 March 2023).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Higgins, C. ABC Transporters: From Microorganisms to Man. Annu. Rev. Cell Biol. 1992, 8, 67–113. [Google Scholar] [CrossRef] [PubMed]
  2. Dean, M.; Rzhetsky, A.; Allikmets, R. The human ATP-binding cassette (ABC) transporter superfamily. Genome Res. 2001, 11, 1156–1166. [Google Scholar] [CrossRef] [PubMed]
  3. Sara, E.; Daniele, P.; Valentina, M.; Francesco, C.; Davide, S.; Paolo, R.; Claudia, C.; Domenico, O.; Guido, F.; Claudio, G.; et al. ABC transporters are involved in defense against permethrin insecticide in the malaria vector Anopheles stephensi. Parasites Vectors 2014, 7, 349. [Google Scholar]
  4. Rees, D.; Johnson, E.; Lewinson, O. ABC transporters: The power to change. Nat. Rev. Mol. Cell Biol. 2009, 10, 218–227. [Google Scholar] [CrossRef] [PubMed]
  5. Chen, Z.; Charles, R.; Rishil, J.; Pranav, G. The modulation of ABC transporter-mediated multidrug resistance in cancer: A review of the past decade. Drug Resist. Updates 2015, 18, 1–17. [Google Scholar]
  6. Shang, F.; Niu, J.; Ding, B.; Zhang, W.; Wei, D.D.; Wei, D.; Jiang, H.; Wang, J. The miR-9b microRNA mediates dimorphism and development of wing in aphids. Proc. Natl. Acad. Sci. USA 2020, 117, 8404–8409. [Google Scholar] [CrossRef] [PubMed]
  7. Broehan, G.; Kroeger, T.; Lorenzen, M.; Merzendorfer, H. Functional analysis of the ATP-binding cassette(ABC) transporter gene family of Tribolium castaneum. BMC Genom. 2013, 14, 6. [Google Scholar] [CrossRef]
  8. Kang, X.; Zhang, M.; Wang, K.; Qiao, X.; Chen, M. Molecular Cloning, Expression Pattern of Multidrug Resistance Associated Protein 1 (Mrp1, Abcc1) Gene, and the Synergistic Effects of Verapamil on Toxicity of Two Insecticides in the Bird Cherry-Oat Aphid. Arch. Insect Biochem. Physiol. 2016, 92, 65–84. [Google Scholar] [CrossRef]
  9. Rösner, J.; Merzendorfer, H. Transcriptional plasticity of different ABC transporter genes from Tribolium castaneum contributes to diflubenzuron resistance. Insect Biochem Mol. Biol. 2020, 116, 103282. [Google Scholar] [CrossRef]
  10. Yu, Z.; Wang, Y.; Zhao, X.; Liu, X.; Ma, E.; Moussian, B.; Zhang, J. The ABC transporter ABCH-9C is needed for cuticle barrier construction in Locusta migratoria. Insect Biochem. Mol. Biol. 2017, 87, 90–99. [Google Scholar] [CrossRef]
  11. Michael, D.; Yannick, H.; Giovanna, C. The human ATP-binding cassette (ABC) transporter superfamily. J. Lipid Res. 2001, 42, 1007–1017. [Google Scholar]
  12. Pignatelli, P.; Ingham, V.A.; Balabanidou, V.; Vontas, J.; Lycett, G.; Ranson, H. The Anopheles gambiae ATP-binding cassette transporter family: Phylogenetic analysis and tissue localization provide clues on function and role in insecticide resistance. Insect Mol. Biol. 2017, 27, 110–122. [Google Scholar] [CrossRef] [PubMed]
  13. Merzendorfer, H. ABC Transporters and Their Role in Protecting Insects from Pesticides and Their Metabolites. Adv. Insect Physiol. 2014, 46, 1–72. [Google Scholar]
  14. Dermauw, W.; Van Leeuwen, T. The ABC gene family in arthropods: Comparative genomics and role in insecticide transport and resistance. Insect Biochem. Mol. Biol. 2014, 45, 89–110. [Google Scholar] [CrossRef] [PubMed]
  15. Tian, L.; Song, T.; He, R.; Zeng, Y.; Xie, W.; Wu, Q.; Wang, S.; Zhou, X.; Zhang, Y. Genome-wide analysis of ATP-binding cassette (ABC) transporters in the sweetpotato whitefly, Bemisia tabaci. BMC Genom. 2017, 18, 330. [Google Scholar] [CrossRef] [PubMed]
  16. Zuber, R.; Michaela, N.; Yiwen, W.; Kathrin, O.; Nicole, G.; Davide, A.; Slawomir, B.; Jurgen, B.; Matthias, F.; Bernard, M. The ABC transporter Snu and the extracellular protein Snsl cooperate in the formation of the lipid-based inward and outward barrier in the skin of Drosophila. Eur. J. Cell Biol. 2018, 97, 90–101. [Google Scholar] [CrossRef] [PubMed]
  17. Gary, D.; Anthony, J. ABC Transporters Involved in Transport of Eye Pigment Precursors in Drosophila melanogaster. Method Enaymol. 1998, 292, 213–224. [Google Scholar]
  18. Grubbs, N.; Haas, S.; Beeman, R.; Lorenzen, M. The ABCs of eye color in Tribolium castaneum: Orthologs of the Drosophila white, scarlet, and brown Genes. Genetics 2015, 199, 749–759. [Google Scholar] [CrossRef]
  19. Yamanaka, N.; Marques, G.; O’Connor, M. Vesicle-Mediated Steroid Hormone Secretion in Drosophila melanogaster. Cell 2015, 163, 907–919. [Google Scholar] [CrossRef]
  20. Moussian, B. Recent advances in understanding mechanisms of insect cuticle differentiation. Insect Biochem. Mol. Biol. 2010, 40, 363–375. [Google Scholar] [CrossRef]
  21. Zhao, X.; Yang, Y.; Niu, N.; Zhao, Y.; Liu, W.; Ma, E.; Moussian, B.; Zhang, J. The fatty acid elongase gene LmELO7 is required for hydrocarbon biosynthesis and cuticle permeability in the migratory locust, Locusta migratoria. J. Insect Physiol. 2020, 123, 104052. [Google Scholar] [CrossRef] [PubMed]
  22. Qayyoum, M.; Song, Z.; Zhang, B.; Li, D.; Blanco, C. Dispersal Mechanism Assessment for Panonychus citri (Acari: Tetranychidae) Secondary Outbreaks. Ann. Entomol. Soc. Am. 2021, 114, 501–510. [Google Scholar] [CrossRef]
  23. Cheng, L.; Hou, D.; Sun, Q.; Yu, S.; Li, S.; Liu, H.; Cong, L.; Ran, C. Biochemical and Molecular Analysis of Field Resistance to Spirodiclofen in Panonychus citri (McGregor). Insects 2022, 13, 1011. [Google Scholar] [CrossRef]
  24. Alavijeh, E.; Khajehali, J.; Snoeck, S.; Panteleri, R.; Ghadamyari, M.; Jonckheere, W.; Bajda, S.; Saalwaechter, C.; Geibel, S.; Douris, V.; et al. Molecular and genetic analysis of resistance to METI-I acaricides in Iranian populations of the citrus red mite Panon. citri. Pestic. Biochem. Physiol. 2020, 164, 73–84. [Google Scholar] [CrossRef]
  25. Wang, H.; Xin, T.; Wang, H.; Wen, K.; Liu, Y.; Wang, J.; Zou, Z.; Zhong, L.; Xia, B. Stress response and tolerance mechanisms of spirobudiclofen exposure based on multiomics in Panonychus citri (Acari: Tetranychidae). iScience 2023, 26, 107111. [Google Scholar] [CrossRef] [PubMed]
  26. Zhao, Y.; Wang, Q.; Ding, J.; Wang, Y.; Zhang, Z.; Liu, F.; Mu, W. Sublethal effects of chlorfenapyr on the life table parameters, nutritional physiology and enzymatic properties of Bradysia odoriphaga (Diptera: Sciaridae). Pestic. Biochem. Physiol. 2018, 148, 93–102. [Google Scholar] [CrossRef] [PubMed]
  27. Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  28. Hughes, H. Structure of the ABC ATPase domain of humanTAP1, the transporter associated with antigen processing. EMBO J. 2001, 20, 4964–4972. [Google Scholar]
  29. Liu, S.; Zhou, S.; Tian, L.; Guo, E.; Luan, Y.; Zhang, J.; Li, S. Genome-wide identification and characterization of ATP-binding cassette transporters in the silkworm, Bombyx mori. BMC Genom. 2011, 12, 491. [Google Scholar] [CrossRef]
  30. Wu, C.; Chakrabarty, S.; Jin, M.; Liu, K.; Xiao, Y. Insect ATP-Binding Cassette (ABC) Transporters: Roles in Xenobiotic Detoxification and Bt Insecticidal Activity. Int. J. Mol. Sci. 2019, 20, 11. [Google Scholar] [CrossRef]
  31. Chen, N.; Fan, Y.; Bai, Y.; Li, X.D.; Zhang, Z.; Liu, T. Cytochrome P450 gene, CYP4G51, modulates hydrocarbon production in the pea aphid, Acyrthosiphon pisum. Insect Biochem. Mol. Biol. 2016, 76, 84–94. [Google Scholar] [CrossRef] [PubMed]
  32. Finet, C.; Slavik, K.; Pu, J.; Carroll, S.B.; Chung, H. Birth-and-Death Evolution of the Fatty Acyl-CoA Reductase (FAR) Gene Family and Diversification of Cuticular Hydrocarbon Synthesis in Drosophila. Genome Biol. Evol. 2019, 11, 1541–1551. [Google Scholar] [CrossRef] [PubMed]
  33. Moriconi, D.; Dulbecco, A.; Juarez, M.; Calderon Fernandez, G. A fatty acid synthase gene (FASN3) from the integument tissue of Rhodnius prolixus contributes to cuticle water loss regulation. Insect Mol. Biol. 2019, 28, 850–861. [Google Scholar] [CrossRef] [PubMed]
  34. Pei, X.; Chen, N.; Bai, Y.; Qiao, J.; Li, S.; Fan, Y.; Liu, T. BgFas1: A fatty acid synthase gene required for both hydrocarbon and cuticular fatty acid biosynthesis in the German cockroach, Blattella germanica (L.). Insect Biochem. Mol. Biol. 2019, 112, 103203. [Google Scholar] [CrossRef] [PubMed]
  35. Qiao, J.; Fan, Y.; Bai, T.; Wu, B.; Pei, X.; Wang, D.; Liu, T. Lipophorin receptor regulates the cuticular hydrocarbon accumulation and adult fecundity of the pea aphid Acyrthosiphon pisum. Insect Sci. 2021, 28, 1018–1032. [Google Scholar] [CrossRef] [PubMed]
  36. Tennessen, J.; Bertagnolli, N.; Evans, J.; Sieber, M.; Cox, J.; Thummel, C. Coordinated metabolic transitions during Drosophila embryogenesis and the onset of aerobic glycolysis. G3 2014, 4, 839–850. [Google Scholar] [CrossRef]
  37. Emile, V. Fuel Metabolism of the Mosquito (Culex quinquefasciatus) Embryo. J. Insect Physiol. 1993, 39, 831–833. [Google Scholar]
  38. Merzendorfer, H.; Kim, H.; Chaudhari, S.; Kumari, M.; Specht, C.; Butcher, S.; Brown, S.; Manak, J.; Beeman, R.; Kramer, K.; et al. Genomic and proteomic studies on the effects of the insect growth regulator diflubenzuron in the model beetle species Tribolium castaneum. Insect Biochem. Mol. Biol. 2012, 42, 264–276. [Google Scholar] [CrossRef]
  39. Pavlidi, N.; Kampouraki, A.; Tseliou, V.; Wybouw, N.; Dermauw, W.; Roditakis, E.; Nauen, R.; Van Leeuwen, T.; Vontas, J. Molecular characterization of pyrethroid resistance in the olive fruit fly Bactrocera oleae. Pestic. Biochem. Physiol. 2018, 148, 1–7. [Google Scholar] [CrossRef]
  40. Misra, J.; Horner, M.; Lam, G.; Thummel, C. Transcriptional regulation of xenobiotic detoxification in Drosophila. Genes Dev. 2011, 25, 1796–1806. [Google Scholar] [CrossRef]
  41. Hsu, J.; Lin, Y.; Chang, C.; Hua, K.; Chen, M.; Huang, L.; Chen, C. Discovery of Organophosphate Resistance-Related Genes Associated With Well-known Resistance Mechanisms of Plutella xylostella (L.) (Lepidoptera: Plutellidae) by RNA-Seq. J. Econ. Entomol. 2016, 109, 1378–1386. [Google Scholar] [CrossRef] [PubMed]
  42. Zamora, L.; Prospero, J.; Hansell, D.; Trapp, J. Atmospheric P deposition to the subtropical North Atlantic: Sources, properties, and relationship to N deposition. J. Geophys. Res. Atmos. 2013, 118, 1546–1562. [Google Scholar] [CrossRef]
Ijms 25 00827 g001
Figure 1. Multiple sequence alignments of PcABCG23. The deduced amino acid sequences of ABCG23 from P. citri (OR912982), T. urticae (XP_015781176.1), Halotydeus destructor (KAI1291018.1), Harpegnathos saltator (XP_019699572.1), Pangasianodon hypophthalmus (XP_026799872.1), Crassostrea virginica (XP_022323233.1), Silurus meridionalis (XM_015519618.1), Ictalurus punctatus (XP_017331852.1), Tachysurus fulvidraco (XP_026998856.1), Silurus asotus (XM_001942896.5), and Astyanax mexicanus (XP_007244688.1). For the interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.
Figure 1. Multiple sequence alignments of PcABCG23. The deduced amino acid sequences of ABCG23 from P. citri (OR912982), T. urticae (XP_015781176.1), Halotydeus destructor (KAI1291018.1), Harpegnathos saltator (XP_019699572.1), Pangasianodon hypophthalmus (XP_026799872.1), Crassostrea virginica (XP_022323233.1), Silurus meridionalis (XM_015519618.1), Ictalurus punctatus (XP_017331852.1), Tachysurus fulvidraco (XP_026998856.1), Silurus asotus (XM_001942896.5), and Astyanax mexicanus (XP_007244688.1). For the interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.
Ijms 25 00827 g001
Ijms 25 00827 g002
Figure 2. Conserved domain analysis of P. citri (OR912982), T. urticae (XP_015781176.1), H. destructor (KAI1291018.1), H. saltator (XP_019699572.1), P. hypophthalmus (XP_026799872.1), C. virginica (XP_022323233.1), S. meridionalis (XM_015519618.1), T. fulvidraco (XP_026998856.1), I. punctatus (XP_017331852.1), S. asotus (XM_001942896.5), and A. mexicanus (XP_007244688.1) ABCG23 transporters. Analysis using SMART online software (SMART: Main page (embl.de)); purple marks signify low complexity; blue marks signify the transmembrane region. The black annular regions with AAA represent NBDs.
Figure 2. Conserved domain analysis of P. citri (OR912982), T. urticae (XP_015781176.1), H. destructor (KAI1291018.1), H. saltator (XP_019699572.1), P. hypophthalmus (XP_026799872.1), C. virginica (XP_022323233.1), S. meridionalis (XM_015519618.1), T. fulvidraco (XP_026998856.1), I. punctatus (XP_017331852.1), S. asotus (XM_001942896.5), and A. mexicanus (XP_007244688.1) ABCG23 transporters. Analysis using SMART online software (SMART: Main page (embl.de)); purple marks signify low complexity; blue marks signify the transmembrane region. The black annular regions with AAA represent NBDs.
Ijms 25 00827 g002
Ijms 25 00827 g003
Figure 3. Phylogeny of the ABCG23 gene. The phylogenetic tree was built based on the amino acid sequences (Tachysurus fulvidraco (XP_026998856.1), Fragariocoptes setiger (KAG9508995.1), T. urticae (XP_015781176.1), P. citri (OR912982), H. destrutor (KAI1291018.1), H. saltator (XP_019699572.1), Cephus cinctus (XP_015609354.1), Wasmannia auropunctata (XP_011700766.1), Halyomorpha halys (XP_014283071.1), Diuraphis noxia (XP_015375104.1), Acyrthosiphon pisum (XP_001942931.1), and Cimex lectularius (XP_014247326.1)) via the Neighbor-Joining method using the program MEGA 7.0, while the phylogenetic test was carried out using a bootstrap analysis with 1000 replications.
Figure 3. Phylogeny of the ABCG23 gene. The phylogenetic tree was built based on the amino acid sequences (Tachysurus fulvidraco (XP_026998856.1), Fragariocoptes setiger (KAG9508995.1), T. urticae (XP_015781176.1), P. citri (OR912982), H. destrutor (KAI1291018.1), H. saltator (XP_019699572.1), Cephus cinctus (XP_015609354.1), Wasmannia auropunctata (XP_011700766.1), Halyomorpha halys (XP_014283071.1), Diuraphis noxia (XP_015375104.1), Acyrthosiphon pisum (XP_001942931.1), and Cimex lectularius (XP_014247326.1)) via the Neighbor-Joining method using the program MEGA 7.0, while the phylogenetic test was carried out using a bootstrap analysis with 1000 replications.
Ijms 25 00827 g003
Ijms 25 00827 g004
Figure 4. (A) mRNA expression levels of PcABCG23 across different concentrations of spirobudiclofen stress, CK: (n = 200), LC30: (n = 200), LC50: (n = 200) were used for total RNA extraction. (B) mRNA expression level of PcABCG23 across different developmental stages of P. citri. egg (n = 500), larva (n = 400), protonymph (n = 300), deutonymph (n = 300), adult females (n = 200), and adult males (n = 200) were used for total RNA extraction. Data represent the means ± SEM of three biological replicates. Different letters on the bars indicate significant differences among different samples (ANOVA, Tukey’s Honestly Significant Difference, p < 0.05). (C) Concentration-response of PcABCG23 transcript to receive dsRNA (500 ng/μL, 1000 ng/μL, 1500 ng/μL and 2000 ng/μL with 50 μL dsPcABCG23 24 h); (D) RNAi efficiencies were tested 48 h after receiving 50 μLdsRNA (1000 ng/μL and 1500 ng/μL) ((ns) no significance, * p < 0.05, ** 0.001 < p < 0.05, *** p < 0.001).
Figure 4. (A) mRNA expression levels of PcABCG23 across different concentrations of spirobudiclofen stress, CK: (n = 200), LC30: (n = 200), LC50: (n = 200) were used for total RNA extraction. (B) mRNA expression level of PcABCG23 across different developmental stages of P. citri. egg (n = 500), larva (n = 400), protonymph (n = 300), deutonymph (n = 300), adult females (n = 200), and adult males (n = 200) were used for total RNA extraction. Data represent the means ± SEM of three biological replicates. Different letters on the bars indicate significant differences among different samples (ANOVA, Tukey’s Honestly Significant Difference, p < 0.05). (C) Concentration-response of PcABCG23 transcript to receive dsRNA (500 ng/μL, 1000 ng/μL, 1500 ng/μL and 2000 ng/μL with 50 μL dsPcABCG23 24 h); (D) RNAi efficiencies were tested 48 h after receiving 50 μLdsRNA (1000 ng/μL and 1500 ng/μL) ((ns) no significance, * p < 0.05, ** 0.001 < p < 0.05, *** p < 0.001).
Ijms 25 00827 g004
Ijms 25 00827 g005
Figure 5. (A) The survival rate, (B) hatchability, and (C) oviposition of dsABCG23-fed P. citri was recorded every 12 h; dsGFP-fed P. citri were used as the control (n = 60). Phenotypic images of adult females (D) and TG contents (E) of adult females from P. citri 48 h after being fed dsABCG23 and dsGFP. (Student’s t-test, *** p < 0.001).
Figure 5. (A) The survival rate, (B) hatchability, and (C) oviposition of dsABCG23-fed P. citri was recorded every 12 h; dsGFP-fed P. citri were used as the control (n = 60). Phenotypic images of adult females (D) and TG contents (E) of adult females from P. citri 48 h after being fed dsABCG23 and dsGFP. (Student’s t-test, *** p < 0.001).
Ijms 25 00827 g005
Table 1. Primers for PCR, dsRNA and RT-qPCR.
Table 1. Primers for PCR, dsRNA and RT-qPCR.
Primer Sequence (5′-3′)
For gene cloning
PcABCG23-FTTTCGTCACCGATCCAGTCC
PcABCG23-RTGACACGACTTAGGGCGAAC
PcABCG23-3′F1TCGTGTCCGCTCTCTGTGA
PcABCG23-3′F2CTTATTTCCGTTGGCTGTG
PcABCG23-5′R1CGAAGTGCTGCTGATGGTGAT
PcABCG23-5′R2TGCTGCTGATGGTGATTGC
UPM longCTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
UPM shortCTAATACGACTCACTATAGGGC
NUPAAGCAGTGGTAACAACGCAGAGT
For qRT-PCR
PcGAPDH -F CTTTGGCCAAGGTCATCAAT
PcGAPDH -R CGGTAGCGGCAGGTATAATG
PcELF1A -F GGCACTTCGTCTTCCACTTC
PcELF1A -R ATGATTCGTGGTGCATCTCA
PcABCG23-qF TATGGAATGGTCGTGTCCGC
PcABCG23-qR CGCGTATTCACACAGCCAAC
For ABCG23
dsRNA synthesis
T7 GFP ds-FTAATACGACTCACTATAGGGCCACAAGTTCAGCGTGTCCG
T7 GFP ds-RTAATACGACTCACTATAGGGTGGGTGCTCAGGTAGTGGTTGT
T7 ABCG23 ds-FTAATACGACTCACTATAGGGCGGTTGTCTTCGACCTCAAT
T7 ABCG23 ds-RTAATACGACTCACTATAGGGCTTGTCTCATGAAGCCCACA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, H.; Wang, H.; Xin, T.; Xia, B. Knockdown of the ABCG23 Gene Disrupts the Development and Lipid Accumulation of Panonychus citri (Acari/Tetranychidae). Int. J. Mol. Sci. 2024, 25, 827. https://doi.org/10.3390/ijms25020827

AMA Style

Wang H, Wang H, Xin T, Xia B. Knockdown of the ABCG23 Gene Disrupts the Development and Lipid Accumulation of Panonychus citri (Acari/Tetranychidae). International Journal of Molecular Sciences. 2024; 25(2):827. https://doi.org/10.3390/ijms25020827

Chicago/Turabian Style

Wang, Hongyan, Haifeng Wang, Tianrong Xin, and Bin Xia. 2024. "Knockdown of the ABCG23 Gene Disrupts the Development and Lipid Accumulation of Panonychus citri (Acari/Tetranychidae)" International Journal of Molecular Sciences 25, no. 2: 827. https://doi.org/10.3390/ijms25020827

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop