Next Article in Journal
Thymosin β4 Regulates the Differentiation of Thymocytes by Controlling the Cytoskeletal Rearrangement and Mitochondrial Transfer of Thymus Epithelial Cells
Previous Article in Journal
Hepatic Alterations in a BTBR T + Itpr3tf/J Mouse Model of Autism and Improvement Using Melatonin via Mitigation Oxidative Stress, Inflammation and Ferroptosis
Previous Article in Special Issue
Exploring the Metabolic and Endocrine Preconditioning Associated with Thyroid Disorders: Risk Assessment and Association with Acne Severity
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 2
10.3390/ijms25021087
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nutrient Combinations Sensed by L-Cell Receptors Potentiate GLP-1 Secretion

by
Nalini Sodum
1,
Orvokki Mattila
1,
Ravikant Sharma
1,
Remi Kamakura
1,
Vesa-Pekka Lehto
2,
Jaroslaw Walkowiak
3,
Karl-Heinz Herzig
1,3 and
Ghulam Shere Raza
1,*
1
Research Unit of Biomedicine and Internal Medicine, Biocentre of Oulu, Medical Research Center, University of Oulu, Oulu University Hospital, Aapistie 5, 90220 Oulu, Finland
2
Department of Technical Physics, Faculty of Science, Forestry and Technology, University of Eastern Finland, 70210 Kuopio, Finland
3
Department of Gastroenterology and Metabolism, Poznan University of Medical Sciences, 60572 Poznań, Poland
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(2), 1087; https://doi.org/10.3390/ijms25021087
Submission received: 11 December 2023 / Revised: 11 January 2024 / Accepted: 14 January 2024 / Published: 16 January 2024
(This article belongs to the Special Issue Molecular Mechanisms of Metabolic Syndrome)
Browse Figures
Review Reports Versions Notes

Abstract

:
Obesity is a risk factor for cardiometabolic diseases. Nutrients stimulate GLP-1 release; however, GLP-1 has a short half-life (<2 min), and only <10–15% reaches the systemic circulation. Human L-cells are localized in the distal ileum and colon, while most nutrients are absorbed in the proximal intestine. We hypothesized that combinations of amino acids and fatty acids potentiate GLP-1 release via different L-cell receptors. GLP-1 secretion was studied in the mouse enteroendocrine STC-1 cells. Cells were pre-incubated with buffer for 1 h and treated with nutrients: alpha-linolenic acid (αLA), phenylalanine (Phe), tryptophan (Trp), and their combinations αLA+Phe and αLA+Trp with dipeptidyl peptidase-4 (DPP4) inhibitor. After 1 h GLP-1 in supernatants was measured and cell lysates taken for qPCR. αLA (12.5 µM) significantly stimulated GLP-1 secretion compared with the control. Phe (6.25–25 mM) and Trp (2.5–10 mM) showed a clear dose response for GLP-1 secretion. The combination of αLA (6.25 µM) and either Phe (12.5 mM) or Trp (5 mM) significantly increased GLP-1 secretion compared with αLA, Phe, or Trp individually. The combination of αLA and Trp upregulated GPR120 expression and potentiated GLP-1 secretion. These nutrient combinations could be used in sustained-delivery formulations to the colon to prolong GLP-1 release for diminishing appetite and preventing obesity.

1. Introduction

Obesity is a multifactorial chronic disease with excess adiposity [1]. It is a well-known risk factor for metabolic and cardiovascular diseases (CVDs) [2]. Diet and physical activity are two of the major regulators of obesity. Recently, the USFDA approved glucagon-like peptide-1 (GLP-1) agonists for the treatment of obesity. GLP-1 is secreted from the enteroendocrine L-cells of the intestine after ingestion of food. L-cells are found throughout the gastrointestinal (GI) tract, originating in the proximal small intestine and gradually increasing in density towards the distal region of the gut [3]. GLP-1 suppresses food intake, delays gastric emptying, and stimulates insulin secretion from the pancreas [4]. Therefore, GLP-1 has gained significant attention as a therapeutic agent for diabetes and obesity. GLP-1 (7–36) and GLP-1 (7–37) amides are the active forms in human plasma, and are quickly degraded by the enzyme dipeptidyl peptidase-4 (DPP4), leading to inactive GLP-1 (9–36) and GLP-1 (9–37) amides [5]. Only 10–15% of the secreted GLP-1 reaches the systemic circulation in active form and the half-life of GLP-1 is approximately 1–2 min. Hence, employing GLP-1 as a pharmaceutical compound in its native form is not very suitable [6,7].
Nutrients such as carbohydrates, fats, and proteins stimulate GLP-1 secretions [5]. In animals and humans, unsaturated fatty acids are more potent GLP-1 secretagogues than saturated fatty acids [8,9]. Chain length and degree of FFA saturation influence GLP-1 secretion. Longer-chain-length FFAs stimulate gut peptide secretion more potently than shorter-chain FFAs [10,11]. In particular, long-chain polyunsaturated fatty acids (LCPUFAs) such as docosahexaenoic acid (DHA 22:6, n-3), α-linolenic acid (αLA, C18:3, n-3), and eicosapentaenoic acid (EPA, 20:5, n-3) have shown a higher potency than other LCFAs in suppression of body weight gain and appetite [12,13]. The FFAs bind to several receptors on the surface of intestinal L-cells, including G protein-coupled receptors (GPCRs). In addition, other digestion products such as glucose and amino acids also act as stimuli for L-cells via different receptors such as calcium signaling receptor (CaSR), ion channels and transporters (peptide transporter-1 (PEPT1), and sodium/glucose co-transporter 1 (SGLT1) [14,15]. Peptides and amino acids stimulate both cholecystokinin (CCK) and GLP-1 release from the enteroendocrine cell line STC-1 [16].
GLP-1 secretion signals the presence of food in the intestine and suppresses food intake centrally via the vagal nerve [17,18]. GLP-1 exerts its actions through the glucagon-like peptide-1 receptor (GLP1R), which is expressed in numerous tissues including the pancreas, kidney, heart, lung, adipose, smooth muscle, and nerve cells [19]. Fasting GLP-1 concentration in humans typically ranges from 5 to 15 pmol/L and increases 2–4-fold after food ingestion [3]. In insulin resistance, GLP-1 secretion is impaired [20,21,22,23]. In addition, several studies in humans have shown that GLP-1 secretion is impaired in obese subjects [24,25,26]. In contrast, a meta-analysis of 22 trials showed that there was no difference in glucose-stimulated GLP-1 secretion between type-2 diabetics and healthy controls [27]. Recently, a study reported that diabetic subjects had higher fasting and glucose-stimulated GLP-1 levels compared with prediabetic and normal subjects [28]. This inconsistent finding could be due to diagnostic criteria for prediabetes and diabetes, sample size, or detection method for GLP-1 and GLP-1 measurement timing [21,22]. Bariatric surgery is used to treat morbid obesity, resulting in a decrease in food intake and an increase in endogenous postprandial gut hormone secretions, particularly GLP-1 [29,30,31]. Bariatric surgery also demonstrates that increased distal nutrient delivery has the potential to activate a greater number of GLP-1-producing enteroendocrine cells and to enhance endogenous GLP-1 secretion [29].
Several chimeric peptides have been developed to combine their beneficial physiological response [32]. Pan et al. created a novel hybrid peptide utilizing the physiological actions of GLP-1 and glucagon in glucose homeostasis [33]. In addition, dual GLP-1 receptor and glucagon receptor agonist reversed obesity in high-fat-diet-fed mice by daily injections or by employing a polyethylene glycolated agonist injected once per week [34,35]. The synthetic peptide, SAR441255, is a novel tri-agonist of the GLP-1, glucagon, and GIP receptors with better glycemic control in healthy subjects [36]. These studies have demonstrated that hybrid peptides are a suitable approach to combining the physiological functions of different peptides to treat the disease [37,38]. Rather than exogenous application of the various drugs, we wanted to stimulate endogenous GLP-1 secretion with nutrient combinations.
We hypothesized that the combination of different nutrients such as FFAs and amino acids stimulates additively or potentiates endogenous GLP-1 secretion via the different receptors on L-cells. Therefore, we investigated the combined effects of alpha-linolenic acid (αLA) and the amino acids L-phenylalanine (Phe) or L-tryptophan (Trp) for GLP-1 secretion using the enteroendocrine cell line STC-1.

2. Results

2.1. In Vitro GLP-1 Secretions in STC-1 Cells

αLA (6.25–12.5 µM), Phe (6.25–25 mM), and Trp (2.5–10 mM) dose-dependently stimulated GLP-1 secretion in STC-1 cells (Figure 1). αLA (12.5 µM) significantly stimulated GLP-1 secretion ~5-fold and αLA (6.25 µM) ~4-fold, compared with the buffer (control). Similarly, Trp (2.5–10 mM) stimulated GLP-1 secretion ~2–3.5-fold compared with the control. Interestingly, the combination of αLA (6.25 µM) and Trp (5 mM) significantly (~2.5-fold) increased GLP-1 secretion compared with either αLA (6.25 µM) or Trp (5 mM) individually. In addition, the combination of αLA (6.25 µM) and Trp (5 mM) significantly increased GLP-1 secretion compared with a higher dose of αLA (12.5 µM). Higher-dose combinations of αLA (12.5 µM) and Trp (10 mM) and lower-dose combinations αLA (3.125 µM) and Trp (2.5 mM) increased GLP-1, but not statistically significantly, compared with individual nutrients (Figure 1).
Similarly, Phe (6.25–25 mM) showed a clear dose response in GLP-1 secretion compared with the buffer (control). The combination of Phe (12.5 mM) and αLA (6.25 µM) increased GLP-1 secretion ~3-fold compared with αLA (6.25 µM) and Phe (12.5 mM) alone (Figure 2). In addition, the combination of Phe (12.5 mM) and αLA (6.25 µM) significantly increased GLP-1 secretion compared with the higher dose of αLA (12.5 µM). The higher dose combinations of αLA (12.5 µM) and Phe (25 mM) and the lower dose combination of αLA (3.125 µM) and Phe (6.25 mM) increased GLP-1 secretion, but it was not significant compared with individual nutrients (Figure 2).

2.2. Gene Expression

mRNA Expression Levels of Fatty Acid and Amino Acid Receptors

αLA, Phe, and Trp, and their combinations, increased mRNA gene expression of GPR120 and GPR40 compared with the control (Figure 3).
The combination of αLA (6.25 µM) and Trp (5 mM) upregulated GPR120 mRNA expression compared with the positive control αLA. No significant change in GPR119 or GPR40 was found with αLA, Phe, or Trp, or the combinations of αLA and Trp or αLA and Phe (Figure 3). The nutrients Phe and Trp, and their combinations with αLA, showed an upregulating trend in CaSR and GPRC6A mRNA expression compared with the controls (Figure 4).

3. Discussion

Fatty acids such as αLA and L-amino acids such as Phe and Trp significantly increased GLP-1 secretions compared with the control (Figure 1 and Figure 2). Our results are consistent with previous findings on GLP-1 secretion with fatty acids and amino acids in STC-1 cells [39,40,41]. In STZ-induced diabetic rats, oral administration of linoleic acid increased GLP-1 secretion and reduced postprandial hyperglycemia [42]. Adachi et al. demonstrated that unsaturated long-chain fatty acid infusion into the colon of mice increased GLP-1 secretion, but saturated and middle-chain fatty acids did not [43]. Oral ingestion of corn oil (99% triacylglycerol with 59% polyunsaturated FA, 24% monounsaturated FA, and 13% saturated FA) induced GLP-1 secretion in wild-type mice and in GPR120−/− mice, but not in GPR40−/− mice [44]. The author demonstrated that partial GPR40 agonists did not stimulate GLP-1 secretion but the combination of partial and full agonists cooperatively enhanced receptor activation and GLP-1 secretion both in vitro and in vivo [44]. L-Phe stimulated GLP-1 secretion in both STC-1 cells and murine primary colonic L-cell cultures [41]. The author found that L-Phe stimulated GLP-1 secretion in STC-1 cells via CaSR [45]. Oral administration of L-Phe in rodents increased plasma GLP-1 levels and reduced food intake and body weight. CaSR inhibition attenuated the anorectic effect of intra-ileal L-Phe in rats and GLP-1 release from STC-1 and primary L-cells [41]. These results suggest that the effect of Phe on GLP-1 secretion is mediated via CaSR. In humans, intragastric administration of 10 g L-Phe in healthy males suppressed energy intake and increased plasma CCK, but did not affect gastric emptying and plasma GLP-1 levels [46]. The authors reported a reduction in plasma glucose, which they did not explain. Surprisingly, they did not add DPP4 inhibitors for GLP-1 protection, which might have contributed to their GLP-1 results [46]. Oral ingestion of 10 g L-Phe increased plasma GIP but did not change plasma GLP-1, energy intake, or appetite with no DPP4 inhibitors added [47]. L-Phe is primarily absorbed in the proximal gut, while D-Phe reaches the distal gut [48]. Various L-amino acids such as L-Phe, L-Trp, L-proline, L-arginine (Arg), and L-glutamic acid increased GLP-1 secretion in STC-1 cells [49]. The author reported that L-Phe was the most potent among the amino acid in terms of GLP-1 secretion, activating GPR142 receptors [49].
In perfused rat intestine, Modvig and colleagues found that different amino acids such as L-valine, L-Trp, and L-Arg at a concentration of 50 mM stimulated GLP-1 secretion [50]. GLP-1 secretion was increased after intraduodenal administration of L-Trp (100 mg/kg body weight) in rats [40]. In contrast, intraduodenal infusions of L-Trp, leucine, Phe, and glutamine in humans resulted in reduced food intake but no significant differences in plasma GLP-1 levels were found [51]. Again, no DPP4 inhibitor was added for protection of GLP-1 [51]. In obese participants, L-Trp (1.56 g orally) increased GLP-1 secretion and reduced gastric emptying; however, L-Leucine did not stimulate GLP-1 secretion [52]. Furthermore, in humans, oral administration of an amino acid mixture containing 3 g L-arginine, 3 g L-Trp, 6 g L-glutamine, and 6 g L-leucine, modestly reduced appetite and increased GLP-1 levels in obese adolescents [53]. In healthy, lean men, whey protein containing all amino acids including L-Trp increased the GLP-1 and insulin [54].
Our results showed that the combination of a fatty acid with amino acids potentiated GLP-1 secretion in STC-1 cells (Figure 1 and Figure 2). In humans the active GLP-1 is very low (<2 pmol/L) in the fasting state, and peaks around 5–10 pmol/L (~2–5-fold increase) after nutrient consumption [55,56]. We measured active GLP-1 from L-cells. We used an established cell line as an in vitro model, in which individual nutrients increased GLP-1 secretion ~2–3.5-fold compared with the control. However, combinations of nutrients αLA (6.25 µM) and Trp (5 mM), and αLA (6.25 µM) and Phe (12.5 mM) increased GLP-1 secretions ~10-fold compared with the control. In mice, a mixed meal induced more GLP-1 secretions than isocaloric glucose [57], indicating that the presence of all macronutrients may synergistically enhance GLP-1 secretion. In healthy men, the combined intraduodenal administration of 5.55 g lauric acid and 4.07 g L-Trp substantially reduced energy intake with a marked stimulation of CCK and suppression of ghrelin [58]. In addition, the author showed that only lauric acid raised plasma GLP-1, and not the combination of lauric acid and Trp, indicating that the effect on GLP-1 was due to lauric acid. We found an increase in GLP-1 secretion with the αLA and L-Trp combination. The synergistic effects could be due to the activation of different receptors in STC-1 cells. Free fatty acids are sensed mainly via GPR120 and GPR40, which are present on the L-cells [39]. αLA is well known to stimulate GPR120 and GPR40 receptors and increase GLP-1. GPR40 is a fatty acid receptor with a high affinity for medium- to long-chain saturated and unsaturated fatty acids [59]. Both GPR120 and GPR40 receptors enhance intracellular Ca2+ levels [60]. We found that αLA upregulated GPR120 and GPR40 mRNA expression, but this was not significant. αLA (6.25 µM) and the combination αLA 6.25 µM and Trp 5 mM showed similar GPR40 mRNA expression, which is mediated via fatty acid αLA. However, we found that the combination of αLA and L-Trp upregulated GPR120 expression (Figure 3). Both L-Phe and L-Trp activate CaSR and stimulated GLP-1 secretion in STC-1 cells and in rodents [40,41,45,50]. Our results showed an upregulating trend in CaSR expression with L-Phe and L-Trp in STC-1 cells; however, fatty acid αLA and the control showed similar CaSR expression. These results indicate that the combination of αLA and amino acid (Trp/Phe) stimulates their respective receptors and potentiates GLP-1 secretion in our cell model (Figure 4). In addition, it has been shown that L-Phe and L-Trp were sensed by the GPR142 receptor [61] and L-Trp is an agonist of GPR142, stimulating GLP-1 secretion [62]. In addition, we found that the lower-dose combination of αLA 6.25 µM and Trp 5 mM showed higher GPR120, GPR40, GPR119, and GPRC6A mRNA expression than the higher-dose combination of αLA (12.5 µM) and Trp (10 mM). The reduced GLP-1 secretion with a higher dose combination of αLA and amino acids Trp/Phe might have been due to desensitization of receptor signaling. The higher and lower dose combinations showed similar expressions of the above receptors. Amino acids and dietary peptides elicit their effects via GPCRs including CaSR, GPR35, GPR93, GPR142, and GPRC6A, and the umami taste receptor (Tas1R1/Tas1R3), stimulating the release of GLP-1 and PYY [50]. These results indicate that the combination of fatty acids and amino acids is sensed via different receptors and enhances GLP-1 secretion. Our results will need now to be tested in animals and humans for further confirmation.

4. Materials and Methods

4.1. Materials

Dulbecco’s modified eagle medium (DMEM, Cat. No. P04-03500, Aidenbach, Germany), α-linolenic acid (Cat. No. L2376), DPP4 inhibitor (Cat. No. DPP4-010), and active GLP-1 ELISA kit (Cat. No. EGLP-35K) were purchased from Merck (Darmstadt, Germany). Other materials were horse serum Gibco (Cat. No. 16050-122, Thermo Fisher, Waltham, MA, USA), fetal bovine serum Gibco (Cat. No. 10270106, Fisher Scientific, Waltham, MA, USA), L-glutamine Gibco (Cat. No. 25030-024, Thermo Fisher Scientific, Waltham, MA, USA), penicillin–streptomycin Gibco (Cat. No. 15140-122, Thermo Fisher, Waltham, MA, USA), L-Phe (P5482-Merck), L-Trp (T0254-Merck), T-75 flasks (Sarstedt, AG & Co. KG, Nümbrecht, Germany), Nunc Cell-Culture Treated 24-well multi-dishes (Thermo Fisher Scientific, Waltham, MA, USA), RNA NucleoSpin kit (Macherey Nagel GmbH & Co. KG, Düren, Germany), SensiFast cDNA synthesis kit (Meridian Biosciences Inc., Cincinnati, OH, USA), and PowerUp™ and SYBR™ PowerUp™ SYBR™ Green Master Mix for qPCR (A25743, Applied Biosystem, Waltham, MA, USA). Mouse-specific primers for Rt-PCR were purchased TAG Copenhagen, (Copenhagen, Denmark).

4.2. STC-1 Cell Culture

The STC-1 cell line was cultured in T-75 flasks in DMEM supplemented with 15% horse serum, 2.5% fetal bovine serum (FBS), 1% L-glutamine, and penicillin–streptomycin, as previously described [63,64]. Cells were maintained in the above media at 37 °C and 5% CO2, and passage numbers 14–22 were used for GLP-1 secretions.

4.3. In Vitro GLP-1 Secretions from STC-1 Cells

STC-1 cells were seeded at 1.0 × 105 cells/500µL media per well in 24-well cell culture plates. Cells were counted by an automated cell counter (LUNA-Ⅱ™, Logos Biosystems, Inc., Villeneuve-d’Ascq, France). Cells were incubated until they reached 85–90% confluent. On the day of experiments, cells were washed twice with Krebs-Ringer Bicarbonate Buffer (Krebs; 118 mM NaCl, 4.7 mM KCl, 25 mM NaHCO3, 1.25 mM CaCl2, 1.2 mM MgSO4, and 1.2 mM KH2PO4, pH to 7.4), and incubated with buffer for 1 h. After 1 h of preincubation, the buffer was aspirated, and cells were treated with different nutrients and combinations of αLA, Phe, and Trp along with DPP4 inhibitor in Krebs buffer for 1 h at 37 °C: αLA (12.5 µM and 6.25 µM), Phe (6.25–25 mM), and Trp (2.5–10 mM) and their combinations: αLA + Phe (i. 12.5 µM + 25 mM, ii. 6.25 µM + 12.5 mM, and iii. 3.125 µM + 6.25 mM) and αLA + Trp (i. 12.5 µM + 10 mM, ii. 6.25 µM + 5 mM, and iii. 3.125 µM + 2.5 mM) were used. Krebs buffer with ethanol (0.1%) and DPP4 inhibitor (0.25%) were used as control. After 1 h, supernatants were collected, centrifuged at 12,000 rpm for 5 min at 4 °C and stored at −70 °C. Active GLP-1 was measured from the collected supernatant by GLP-1 ELISA kit as per manufacturer instructions [39]. Cells were harvested for gene expression analysis by real-time PCR.

4.4. Gene Expression (RT-PCR)

Gene expression analysis was performed by real-time PCR. RNA was extracted from cell lysates with the total RNA NucleoSpin kit. Genomic DNA was removed by gDNA columns, and concentrations and quality of the RNA were measured by NanoDrop ND-1000 ultraviolet–visible (UV–vis) spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNAs were synthesized from 1 μg of RNA using SensiFast cDNA synthesis kit as per manufacturer instructions. Mouse-specific primers for fatty acid receptors for GPR120 (Far: GGCACTGCTGGCTTTCATA; Rev: GATTTCTCCTATGCGGTTGG), GPR40 (Far: TTTCATAAACCCGGACCTAGGA; Rev: CCAGTGACCAGTGGGTTGAGT), and GPR119 (Far: CTT GCT GTC CTA ACC ATC CTC A; Rev: CCA CGC CAA TCA AGG TAT CAG), and amino acid receptors for GPRC6A (Far: CCC AGT CTT GTC ATA CCC CAG; Rev: TGC TGT GTA TCA TAG CCA GAG T) and CaSR (Far: AGC AGG TGA CCT TCG ATG AGT; Rev: ACT TCC TTG AAC ACA ATG GAG C) were used. Samples were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as endogenous control. PCR reactions were performed in QuantStudio 5 (ThermoFisher Scientific, Waltham, MA, USA) in a total volume of 20–30 μL. All samples were measured in duplicate using the following conditions: 2 min at 50 °C and 10 min at 95 °C, followed by 42 cycles of 15 s at 95 °C and 1 min at 62 °C. Each assay included a standard curve of three serial dilutions of cDNA from the fasted mouse and no template controls. Results were calculated according to the instructions of the manufacturer (ThermoFisher Scientific, Waltham, MA, USA). Gene expression analysis was conducted by delta delta ct method.

4.5. Statistical Analysis

One-way analysis of variance (ANOVA) was used to analyze for statistical significance between the groups using GraphPad Prism, version 7 (GraphPad Software, Inc., La Jolla, CA, USA) and Dunnett’s multiple comparison test was used to analyze the difference between treatment groups. Individual nutrients were compared with buffer, and nutrient combinations were compared with their respective nutrients alone. The values are represented as mean ± standard errors of mean (SEM) and differences were considered statistically significant when p < 0.05 and n = 6.

5. Conclusions

Fatty acids such as α-linolenic acid and amino acids phenylalanine or tryptophan stimulated GLP-1 secretion. The combination of α-linolenic acid with either tryptophan or phenylalanine potentiated GLP-1 secretion. However, these nutrients are absorbed in the proximal intestine and do not reach to the distal part of intestine where most of GLP-1-secreting cells are localized. The combination of these nutrients could be used in sustained-delivery formulations such as mesoporous particles [6] to the colon as food additives, increasing endogenous GLP-1 release, improving insulin secretion, and reducing appetite.

Author Contributions

K.-H.H., G.S.R. and R.K. supervised the study; K.-H.H., J.W. and V.-P.L. financed the investigation; N.S. performed the experiments, analyzed the data, and wrote the first draft of the manuscript; and O.M. performed the gene expression analysis. R.S. contributed to the writing of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The research did not receive external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Klein, S.; Gastaldelli, A.; Yki-Järvinen, H.; Scherer, P.E. Why Does Obesity Cause Diabetes? Cell Metab. 2022, 34, 11–20. [Google Scholar] [CrossRef]
  2. Ortega, F.B.; Lavie, C.J.; Blair, S.N. Obesity and Cardiovascular Disease. Circ. Res. 2016, 118, 1752–1770. [Google Scholar] [CrossRef] [PubMed]
  3. Holst, J.J. The Physiology of Glucagon-like Peptide 1. Physiol. Rev. 2007, 87, 1409–1439. [Google Scholar] [CrossRef]
  4. Müller, T.D.; Finan, B.; Bloom, S.R.; D’Alessio, D.; Drucker, D.J.; Flatt, P.R.; Fritsche, A.; Gribble, F.; Grill, H.J.; Habener, J.F.; et al. Glucagon-like Peptide 1 (GLP-1). Mol. Metab. 2019, 30, 72–130. [Google Scholar] [CrossRef] [PubMed]
  5. Karhunen, L.J.; Juvonen, K.R.; Huotari, A.; Purhonen, A.K.; Herzig, K.H. Effect of Protein, Fat, Carbohydrate and Fibre on Gastrointestinal Peptide Release in Humans. Regul. Pept. 2008, 149, 70–78. [Google Scholar] [CrossRef] [PubMed]
  6. Kovalainen, M.; Mönkäre, J.; Riikonen, J.; Pesonen, U.; Vlasova, M.; Salonen, J.; Lehto, V.P.; Järvinen, K.; Herzig, K.H. Novel Delivery Systems for Improving the Clinical Use of Peptides. Pharmacol. Rev. 2015, 67, 541–546. [Google Scholar] [CrossRef] [PubMed]
  7. Huotari, A.; Xu, W.; Mönkäre, J.; Kovalainen, M.; Herzig, K.H.; Lehto, V.P.; Järvinen, K. Effect of Surface Chemistry of Porous Silicon Microparticles on Glucagon-like Peptide-1 (GLP-1) Loading, Release and Biological Activity. Int. J. Pharm. 2013, 454, 67–73. [Google Scholar] [CrossRef]
  8. Harden, C.J.; Perez-Carrion, K.; Babakordi, Z.; Plummer, S.F.; Hepburn, N.; Barker, M.E.; Wright, P.C.; Evans, C.A.; Corfe, B.M. Evaluation of the Salivary Proteome as a Surrogate Tissue for Systems Biology Approaches to Understanding Appetite. J. Proteom. 2012, 75, 2916–2923. [Google Scholar] [CrossRef]
  9. Thomsen, C.; Storm, H.; Holst, J.J.; Hermansen, K. Differential Effects of Saturated and Monounsaturated Fats on Postprandial Lipemia and Glucagon-like Peptide 1 Responses in Patients with Type 2 Diabetes. Am. J. Clin. Nutr. 2003, 77, 605–611. [Google Scholar] [CrossRef]
  10. Feltrin, K.L.; Little, T.J.; Meyer, J.H.; Horowitz, M.; Smout, A.J.P.M.; Wishart, J.; Pilichiewicz, A.N.; Rades, T.; Chapman, I.M.; Feinle-Bisset, C. Effects of Intraduodenal Fatty Acids on Appetite, Antropyloroduodenal Motility, and Plasma CCK and GLP-1 in Humans Vary with Their Chain Length. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2004, 287, R524–R533. [Google Scholar] [CrossRef]
  11. Rocca, A.S.; Brubaker, P.L. Stereospecific Effects of Fatty Acids on Proglucagon-Derived Peptide Secretion in Fetal Rat Intestinal Cultures. Endocrinology 1995, 136, 5593–5599. [Google Scholar] [CrossRef] [PubMed]
  12. Kamakura, R.; Raza, G.S.; Sodum, N.; Lehto, V.-P.; Kovalainen, M.; Herzig, K.-H. Colonic Delivery of Nutrients for Sustained and Prolonged Release of Gut Peptides: A Novel Strategy for Appetite Management. Mol. Nutr. Food Res. 2022, 66, e2200192. [Google Scholar] [CrossRef] [PubMed]
  13. Christiansen, E.; Watterson, K.R.; Stocker, C.J.; Sokol, E.; Jenkins, L.; Simon, K.; Grundmann, M.; Petersen, R.K.; Wargent, E.T.; Hudson, B.D.; et al. Activity of Dietary Fatty Acids on FFA1 and FFA4 and Characterisation of Pinolenic Acid as a Dual FFA1/FFA4 Agonist with Potential Effect against Metabolic Diseases. Br. J. Nutr. 2015, 113, 1677–1688. [Google Scholar] [CrossRef]
  14. Diakogiannaki, E.; Pais, R.; Tolhurst, G.; Parker, H.E.; Horscroft, J.; Rauscher, B.; Zietek, T.; Daniel, H.; Gribble, F.M.; Reimann, F. Oligopeptides Stimulate Glucagon-like Peptide-1 Secretion in Mice through Proton-Coupled Uptake and the Calcium-Sensing Receptor. Diabetologia 2013, 56, 2688–2696. [Google Scholar] [CrossRef] [PubMed]
  15. Oya, M.; Kitaguchi, T.; Pais, R.; Reimann, F.; Gribble, F.; Tsuboi, T. The G Protein-Coupled Receptor Family C Group 6 Subtype A (GPRC6A) Receptor Is Involved in Amino Acid-Induced Glucagon-like Peptide-1 Secretion from GLUTag Cells. J. Biol. Chem. 2013, 288, 4513. [Google Scholar] [CrossRef] [PubMed]
  16. Santos-Hernández, M.; Vivanco-Maroto, S.M.; Miralles, B.; Recio, I. Food Peptides as Inducers of CCK and GLP-1 Secretion and GPCRs Involved in Enteroendocrine Cell Signalling. Food Chem. 2023, 402, 134225. [Google Scholar] [CrossRef] [PubMed]
  17. Kaelberer, M.M.; Buchanan, K.L.; Klein, M.E.; Barth, B.B.; Montoya, M.M.; Shen, X.; Bohórquez, D.V. A Gut-Brain Neural Circuit for Nutrient Sensory Transduction. Science 2018, 361, eaat5236. [Google Scholar] [CrossRef]
  18. Secher, A.; Jelsing, J.; Baquero, A.F.; Hecksher-Sørensen, J.; Cowley, M.A.; Dalbøge, L.S.; Hansen, G.; Grove, K.L.; Pyke, C.; Raun, K.; et al. The Arcuate Nucleus Mediates GLP-1 Receptor Agonist Liraglutide-Dependent Weight Loss. J. Clin. Investig. 2014, 124, 4473–4488. [Google Scholar] [CrossRef]
  19. Andersen, A.; Lund, A.; Knop, F.K.; Vilsbøll, T. Glucagon-like Peptide 1 in Health and Disease. Nat. Rev. Endocrinol. 2018, 14, 390–403. [Google Scholar] [CrossRef]
  20. Zhang, F.; Tang, X.; Cao, H.; Qingguo, L.; Li, N.; Liu, Y.; Zhang, X.; Zhang, Y.; Cao, M.; Wan, J.; et al. Impaired Secretion of Total Glucagon-like Peptide-1 in People with Impaired Fasting Glucose Combined Impaired Glucose Tolerance. Int. J. Med. Sci. 2012, 9, 574–581. [Google Scholar] [CrossRef]
  21. Larsen, M.P.; Torekov, S.S. Glucagon-Like Peptide 1: A Predictor of Type 2 Diabetes? J. Diabetes Res. 2017, 2017, 7583506. [Google Scholar] [CrossRef] [PubMed]
  22. Nauck, M.A.; Vardarli, I.; Deacon, C.F.; Holst, J.J.; Meier, J.J. Secretion of Glucagon-like Peptide-1 (GLP-1) in Type 2 Diabetes: What Is up, What Is Down? Diabetologia 2011, 54, 10–18. [Google Scholar] [CrossRef] [PubMed]
  23. Faerch, K.; Torekov, S.S.; Vistisen, D.; Johansen, N.B.; Witte, D.R.; Jonsson, A.; Pedersen, O.; Hansen, T.; Lauritzen, T.; Sandbaek, A.; et al. GLP-1 Response to Oral Glucose Is Reduced in Prediabetes, Screen-Detected Type 2 Diabetes, and Obesity and Influenced by Sex: The ADDITION-PRO Study. Diabetes 2015, 64, 2513–2525. [Google Scholar] [CrossRef] [PubMed]
  24. Muscelli, E.; Mari, A.; Casolaro, A.; Camastra, S.; Seghieri, G.; Gastaldelli, A.; Holst, J.J.; Ferrannini, E. Separate Impact of Obesity and Glucose Tolerance on the Incretin Effect in Normal Subjects and Type 2 Diabetic Patients. Diabetes 2008, 57, 1340–1348. [Google Scholar] [CrossRef] [PubMed]
  25. Wölnerhanssen, B.K.; Cajacob, L.; Keller, N.; Doody, A.; Rehfeld, J.F.; Drewe, J.; Peterli, R.; Beglinger, C.; Meyer-Gerspach, A.C. Gut Hormone Secretion, Gastric Emptying, and Glycemic Responses to Erythritol and Xylitol in Lean and Obese Subjects. Am. J. Physiol. Endocrinol. Metab. 2016, 310, E1053–E1061. [Google Scholar] [CrossRef] [PubMed]
  26. Knop, F.K.; Aaboe, K.; Vilsbøll, T.; Vølund, A.; Holst, J.J.; Krarup, T.; Madsbad, S. Impaired Incretin Effect and Fasting Hyperglucagonaemia Characterizing Type 2 Diabetic Subjects Are Early Signs of Dysmetabolism in Obesity. Diabetes. Obes. Metab. 2012, 14, 500–510. [Google Scholar] [CrossRef] [PubMed]
  27. Calanna, S.; Christensen, M.; Holst, J.J.; Laferrère, B.; Gluud, L.L.; Vilsbøll, T.; Knop, F.K. Secretion of Glucagon-like Peptide-1 in Patients with Type 2 Diabetes Mellitus: Systematic Review and Meta-Analyses of Clinical Studies. Diabetologia 2013, 56, 965–972. [Google Scholar] [CrossRef]
  28. Chong, S.C.; Sukor, N.; Robert, S.A.; Ng, K.F.; Kamaruddin, N.A. Fasting and Stimulated Glucagon-like Peptide-1 Exhibit a Compensatory Adaptive Response in Diabetes and Pre-Diabetes States: A Multi-Ethnic Comparative Study. Front. Endocrinol. 2022, 13, 961432. [Google Scholar] [CrossRef]
  29. Larraufie, P.; Roberts, G.P.; McGavigan, A.K.; Kay, R.G.; Li, J.; Leiter, A.; Melvin, A.; Biggs, E.K.; Ravn, P.; Davy, K.; et al. Important Role of the GLP-1 Axis for Glucose Homeostasis after Bariatric Surgery. Cell Rep. 2019, 26, 1399. [Google Scholar] [CrossRef]
  30. Roberts, G.P.; Kay, R.G.; Howard, J.; Hardwick, R.H.; Reimann, F.; Gribble, F.M. Gastrectomy with Roux-En-Y Reconstruction as a Lean Model of Bariatric Surgery. Surg. Obes. Relat. Dis. 2018, 14, 562–568. [Google Scholar] [CrossRef]
  31. Le Roux, C.W.; Aylwin, S.J.B.; Batterham, R.L.; Borg, C.M.; Coyle, F.; Prasad, V.; Shurey, S.; Ghatei, M.A.; Patel, A.G.; Bloom, S.R. Gut Hormone Profiles Following Bariatric Surgery Favor an Anorectic State, Facilitate Weight Loss, and Improve Metabolic Parameters. Ann. Surg. 2006, 243, 108–114. [Google Scholar] [CrossRef] [PubMed]
  32. Fourmy, D. Hybrid Peptides in the Landscape of Drug Discovery. Peptides 2017, 90, A1–A2. [Google Scholar] [CrossRef]
  33. Pan, C.Q.; Buxton, J.M.; Yung, S.L.; Tom, I.; Yang, L.; Chen, H.; MacDougall, M.; Bell, A.; Claus, T.H.; Clairmont, K.B.; et al. Design of a Long Acting Peptide Functioning as Both a Glucagon-like Peptide-1 Receptor Agonist and a Glucagon Receptor Antagonist. J. Biol. Chem. 2006, 281, 12506–12515. [Google Scholar] [CrossRef] [PubMed]
  34. Pocai, A.; Carrington, P.E.; Adams, J.R.; Wright, M.; Eiermann, G.; Zhu, L.; Du, X.; Petrov, A.; Lassman, M.E.; Jiang, G.; et al. Glucagon-Like Peptide 1/Glucagon Receptor Dual Agonism Reverses Obesity in Mice. Diabetes 2009, 58, 2258–2266. [Google Scholar] [CrossRef] [PubMed]
  35. Day, J.W.; Ottaway, N.; Patterson, J.T.; Gelfanov, V.; Smiley, D.; Gidda, J.; Findeisen, H.; Bruemmer, D.; Drucker, D.J.; Chaudhary, N.; et al. A New Glucagon and GLP-1 Co-Agonist Eliminates Obesity in Rodents. Nat. Chem. Biol. 2009, 5, 749–757. [Google Scholar] [CrossRef]
  36. Bossart, M.; Wagner, M.; Elvert, R.; Evers, A.; Hübschle, T.; Kloeckener, T.; Lorenz, K.; Moessinger, C.; Eriksson, O.; Velikyan, I.; et al. Effects on Weight Loss and Glycemic Control with SAR441255, a Potent Unimolecular Peptide GLP-1/GIP/GCG Receptor Triagonist. Cell Metab. 2022, 34, 59–74.e10. [Google Scholar] [CrossRef]
  37. Bailey, C.J. Glucose-Lowering Therapies in Type 2 Diabetes: Opportunities and Challenges for Peptides. Peptides 2018, 100, 9–17. [Google Scholar] [CrossRef]
  38. Herzig, K.H. Peptides Combined—Physiology Revisited! Peptides 2018, 110, A1–A2. [Google Scholar] [CrossRef]
  39. Kamakura, R.; Raza, G.S.; Prasannan, A.; Walkowiak, J.; Herzig, K.H. Dipeptidyl Peptidase-4 and GLP-1 Interplay in STC-1 and GLUTag Cell Lines. Peptides 2020, 134, 170419. [Google Scholar] [CrossRef]
  40. Acar, I.; Cetinkaya, A.; Lay, I.; Ileri-Gurel, E. The Role of Calcium Sensing Receptors in GLP-1 and PYY Secretion after Acute Intraduodenal Administration of L-Tryptophan in Rats. Nutr. Neurosci. 2020, 23, 481–489. [Google Scholar] [CrossRef]
  41. Alamshah, A.; Spreckley, E.; Norton, M.; Kinsey-Jones, J.S.; Amin, A.; Ramgulam, A.; Cao, Y.; Johnson, R.; Saleh, K.; Akalestou, E.; et al. L-Phenylalanine Modulates Gut Hormone Release and Glucose Tolerance, and Suppresses Food Intake through the Calcium-Sensing Receptor in Rodents. Int. J. Obes. 2017, 41, 1693–1701. [Google Scholar] [CrossRef]
  42. Yamamoto, Y.; Narumi, K.; Yamagishi, N.; Nishi, T.; Ito, T.; Iseki, K.; Kobayashi, M.; Kanai, Y. Oral Administration of Linoleic Acid Immediately before Glucose Load Ameliorates Postprandial Hyperglycemia. Front. Pharmacol. 2023, 14, 1197743. [Google Scholar] [CrossRef]
  43. Adachi, T.; Tanaka, T.; Takemoto, K.; Koshimizu, T.A.; Hirasawa, A.; Tsujimoto, G. Free Fatty Acids Administered into the Colon Promote the Secretion of Glucagon-like Peptide-1 and Insulin. Biochem. Biophys. Res. Commun. 2006, 340, 332–337. [Google Scholar] [CrossRef] [PubMed]
  44. Xiong, Y.; Swaminath, G.; Cao, Q.; Yang, L.; Guo, Q.; Salomonis, H.; Lu, J.; Houze, J.B.; Dransfield, P.J.; Wang, Y.; et al. Activation of FFA1 Mediates GLP-1 Secretion in Mice. Evidence for Allosterism at FFA1. Mol. Cell. Endocrinol. 2013, 369, 119–129. [Google Scholar] [CrossRef] [PubMed]
  45. Wang, H.; Murthy, K.S.; Grider, J.R. Expression Patterns of L-Amino Acid Receptors in the Murine STC-1 Enteroendocrine Cell Line. Cell Tissue Res. 2019, 378, 471–483. [Google Scholar] [CrossRef] [PubMed]
  46. Fitzgerald, P.C.E.; Manoliu, B.; Herbillon, B.; Steinert, R.E.; Horowitz, M.; Feinle-Bisset, C. Effects of L-Phenylalanine on Energy Intake and Glycaemia-Impacts on Appetite Perceptions, Gastrointestinal Hormones and Gastric Emptying in Healthy Males. Nutrients 2020, 12, 1788. [Google Scholar] [CrossRef]
  47. Amin, A.; Frampton, J.; Liu, Z.; Franco-Becker, G.; Norton, M.; Alaa, A.; Li, J.V.; Murphy, K.G. Differential effects of L- and D-phenylalanine on pancreatic and gastrointestinal hormone release in humans: A randomized crossover study. Diabetes Obes. Metab. 2021, 23, 147–157. [Google Scholar] [CrossRef]
  48. Tocmo, R.; Liang, D.; Lin, Y.; Huang, D. Chemical and Biochemical Mechanisms Underlying the Cardioprotective Roles of Dietary Organopolysulfides. Front. Nutr. 2015, 2, 1. [Google Scholar] [CrossRef]
  49. Osuga, Y.; Harada, K.; Tsuboi, T. Identification of a Regulatory Pathway of L-Phenylalanine-Induced GLP-1 Secretion in the Enteroendocrine L Cells. Biochem. Biophys. Res. Commun. 2022, 588, 118–124. [Google Scholar] [CrossRef]
  50. Modvig, I.M.; Kuhre, R.E.; Jepsen, S.L.; Xu, S.F.S.; Engelstoft, M.S.; Egerod, K.L.; Schwartz, T.W.; Ørskov, C.; Rosenkilde, M.M.; Holst, J.J. Amino Acids Differ in Their Capacity to Stimulate GLP-1 Release from the Perfused Rat Small Intestine and Stimulate Secretion by Different Sensing Mechanisms. Am. J. Physiol. Endocrinol. Metab. 2021, 320, E874–E885. [Google Scholar] [CrossRef]
  51. Steinert, R.E.; Ullrich, S.S.; Geary, N.; Asarian, L.; Bueter, M.; Horowitz, M.; Feinle-Bisset, C. Comparative Effects of Intraduodenal Amino Acid Infusions on Food Intake and Gut Hormone Release in Healthy Males. Physiol. Rep. 2017, 5, e13492. [Google Scholar] [CrossRef] [PubMed]
  52. Meyer-Gerspach, A.C.; Häfliger, S.; Meili, J.; Doody, A.; Rehfeld, J.F.; Drewe, J.; Beglinger, C.; Wölnerhanssen, B. Effect of L-Tryptophan and L-Leucine on Gut Hormone Secretion, Appetite Feelings and Gastric Emptying Rates in Lean and Non-Diabetic Obese Participants: A Randomized, Double-Blind, Parallel-Group Trial. PLoS ONE 2016, 11, e0166758. [Google Scholar] [CrossRef]
  53. Rigamonti, A.E.; Tamini, S.; Cicolini, S.; De Col, A.; Caroli, D.; Mai, S.; Rondinelli, E.; Saezza, A.; Cella, S.G.; Sartorio, A. Evaluation of an Amino Acid Mix on the Secretion of Gastrointestinal Peptides, Glucometabolic Homeostasis, and Appetite in Obese Adolescents Administered with a Fixed-Dose or Ad Libitum Meal. J. Clin. Med. 2020, 9, 3054. [Google Scholar] [CrossRef] [PubMed]
  54. Elovaris, R.A.; Hutchison, A.T.; Lange, K.; Horowitz, M.; Feinle-Bisset, C.; Luscombe-Marsh, N.D. Plasma Free Amino Acid Responses to Whey Protein and Their Relationships with Gastric Emptying, Blood Glucose- and Appetite-Regulatory Hormones and Energy Intake in Lean Healthy Men. Nutrients 2019, 11, 2465. [Google Scholar] [CrossRef] [PubMed]
  55. Kuhre, R.E.; Wewer Albrechtsen, N.J.; Hartmann, B.; Deacon, C.F.; Holst, J.J. Measurement of the Incretin Hormones: Glucagon-like Peptide-1 and Glucose-Dependent Insulinotropic Peptide. J. Diabetes Complicat. 2015, 29, 445–450. [Google Scholar] [CrossRef] [PubMed]
  56. Holst, J.J.; Deacon, C.F. Glucagon-like Peptide-1 Mediates the Therapeutic Actions of DPP-IV Inhibitors. Diabetologia 2005, 48, 612–615. [Google Scholar] [CrossRef] [PubMed]
  57. Hjørne, A.P.; Modvig, I.M.; Holst, J.J. The Sensory Mechanisms of Nutrient-Induced GLP-1 Secretion. Metabolites 2022, 12, 420. [Google Scholar] [CrossRef] [PubMed]
  58. McVeay, C.; Fitzgerald, P.C.E.; Ullrich, S.S.; Steinert, R.E.; Horowitz, M.; Feinle-Bisset, C. Effects of Intraduodenal Administration of Lauric Acid and L-Tryptophan, Alone and Combined, on Gut Hormones, Pyloric Pressures, and Energy Intake in Healthy Men. Am. J. Clin. Nutr. 2019, 109, 1335–1343. [Google Scholar] [CrossRef]
  59. Briscoe, C.P.; Tadayyon, M.; Andrews, J.L.; Benson, W.G.; Chambers, J.K.; Eilert, M.M.; Ellis, C.; Elshourbagy, N.A.; Goetz, A.S.; Minnick, D.T.; et al. The Orphan G Protein-Coupled Receptor GPR40 Is Activated by Medium and Long Chain Fatty Acids. J. Biol. Chem. 2003, 278, 11303–11311. [Google Scholar] [CrossRef]
  60. Watson, S.J.; Brown, A.J.H.; Holliday, N.D. Differential Signaling by Splice Variants of the Human Free Fatty Acid Receptor GPR120. Mol. Pharmacol. 2012, 81, 631–642. [Google Scholar] [CrossRef]
  61. Lizarzaburu, M.; Turcotte, S.; Du, X.; Duquette, J.; Fu, A.; Houze, J.; Li, L.; Liu, J.; Murakoshi, M.; Oda, K.; et al. Discovery and Optimization of a Novel Series of GPR142 Agonists for the Treatment of Type 2 Diabetes Mellitus. Bioorg. Med. Chem. Lett. 2012, 22, 5942–5947. [Google Scholar] [CrossRef] [PubMed]
  62. Lin, H.V.; Efanov, A.M.; Fang, X.; Beavers, L.S.; Wang, X.; Wang, J.; Gonzalez Valcarcel, I.C.; Ma, T. GPR142 Controls Tryptophan-Induced Insulin and Incretin Hormone Secretion to Improve Glucose Metabolism. PLoS ONE 2016, 11, e0157298. [Google Scholar] [CrossRef] [PubMed]
  63. Glassmeier, G.; Herzig, K.H.; Höpfner, M.; Lemmer, K.; Jansen, A.; Scherübl, H. Expression of Functional GABAA Receptors in Cholecystokinin-Secreting Gut Neuroendocrine Murine STC-1 Cells. J. Physiol. 1998, 510 Pt 3, 805–814. [Google Scholar] [CrossRef]
  64. Purhonen, A.K.; Louhivuori, L.M.; Kiehne, K.; Kerman, K.E.; Herzig, K.H. TRPA1 Channel Activation Induces Cholecystokinin Release via Extracellular Calcium. FEBS Lett. 2008, 582, 229–232. [Google Scholar] [CrossRef]
Ijms 25 01087 g001
Figure 1. Alpha linolenic acid (αLA) (12.5 µM) significantly stimulated GLP-1 secretion compared with the control. The combination of αLA (6.25 µM) and L-tryptophan (Trp) (5 mM) increased GLP-1 secretion compared with individual nutrients. In addition, the combination of αLA (6.25 µM) and Trp (5 mM) significantly increased GLP-1 secretion compared with the higher dose of αLA (12.5 µM). The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6 (* p < 0.05).
Figure 1. Alpha linolenic acid (αLA) (12.5 µM) significantly stimulated GLP-1 secretion compared with the control. The combination of αLA (6.25 µM) and L-tryptophan (Trp) (5 mM) increased GLP-1 secretion compared with individual nutrients. In addition, the combination of αLA (6.25 µM) and Trp (5 mM) significantly increased GLP-1 secretion compared with the higher dose of αLA (12.5 µM). The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6 (* p < 0.05).
Ijms 25 01087 g001
Ijms 25 01087 g002
Figure 2. αLA (12.5 µM) significantly stimulated GLP-1 secretion compared with the control. The combination of αLA 6.25 µM and L-phenylalanine (Phe) (12.5 mM) increased GLP-1 secretion compared with individual nutrients. The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6 (* p < 0.05).
Figure 2. αLA (12.5 µM) significantly stimulated GLP-1 secretion compared with the control. The combination of αLA 6.25 µM and L-phenylalanine (Phe) (12.5 mM) increased GLP-1 secretion compared with individual nutrients. The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6 (* p < 0.05).
Ijms 25 01087 g002
Ijms 25 01087 g003
Figure 3. The combination of αLA (6.25 µM) and Trp (5 mM) upregulated GPR120 mRNA expression compared with the positive control αLA. There was no significant change in GPR119 or GPR40. The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6.
Figure 3. The combination of αLA (6.25 µM) and Trp (5 mM) upregulated GPR120 mRNA expression compared with the positive control αLA. There was no significant change in GPR119 or GPR40. The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6.
Ijms 25 01087 g003
Ijms 25 01087 g004
Figure 4. Phe and Trp and their combinations with αLA showed an upregulating trend in CaSR and GPRC6A mRNA expression compared with the control. The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6.
Figure 4. Phe and Trp and their combinations with αLA showed an upregulating trend in CaSR and GPRC6A mRNA expression compared with the control. The values represent the mean ± standard error of mean (SEM), and differences were considered statistically significant when p < 0.05 and n = 6.
Ijms 25 01087 g004
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sodum, N.; Mattila, O.; Sharma, R.; Kamakura, R.; Lehto, V.-P.; Walkowiak, J.; Herzig, K.-H.; Raza, G.S. Nutrient Combinations Sensed by L-Cell Receptors Potentiate GLP-1 Secretion. Int. J. Mol. Sci. 2024, 25, 1087. https://doi.org/10.3390/ijms25021087

AMA Style

Sodum N, Mattila O, Sharma R, Kamakura R, Lehto V-P, Walkowiak J, Herzig K-H, Raza GS. Nutrient Combinations Sensed by L-Cell Receptors Potentiate GLP-1 Secretion. International Journal of Molecular Sciences. 2024; 25(2):1087. https://doi.org/10.3390/ijms25021087

Chicago/Turabian Style

Sodum, Nalini, Orvokki Mattila, Ravikant Sharma, Remi Kamakura, Vesa-Pekka Lehto, Jaroslaw Walkowiak, Karl-Heinz Herzig, and Ghulam Shere Raza. 2024. "Nutrient Combinations Sensed by L-Cell Receptors Potentiate GLP-1 Secretion" International Journal of Molecular Sciences 25, no. 2: 1087. https://doi.org/10.3390/ijms25021087

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop