PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis
Abstract
1. Introduction
2. Results
2.1. Extraction and Identification of CS-EVs
2.2. Identification and Functional Enrichment Analysis of miRNAs in CS-EVs
2.3. CS-EVs Could Be Taken Up by Cholangiocarcinoma Cells
2.4. csi-miR-96-5p Directly Targeted PTEN
2.5. Effect of csi-miR-96-5p/PTEN Axis on Cholangiocarcinoma
2.6. The Ferroptosis Mechanism of csi-miR-96-5p/PTEN Axis
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. CS-EV Extraction and Identification
4.3. High-Throughput Sequencing and Functional Enrichment Analysis of miRNAs in CS-EVs
4.4. Cell Culture and Transfection
4.5. Dual Luciferase Assay
4.6. Quantitative Analysis of mRNAs and miRNAs by qPCR
4.7. Western Blot
4.8. Construction of Erastin-Induced Ferroptosis CCA Cell Model
4.9. Cell Proliferation Assay by CCK-8
4.10. Cell Proliferation Assay by Subcutaneous Tumor Model
4.11. Cell Migration Assay by Transwell
4.12. MDA, Fe2+ and GSH Assay
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jiang, T.Y.; Shi, Y.Y.; Cui, X.W.; Pan, Y.F.; Lin, Y.K.; Feng, X.F.; Ding, Z.W.; Yang, C.; Tan, Y.X.; Dong, L.W.; et al. PTEN Deficiency Facilitates Exosome Secretion and Metastasis in Cholangiocarcinoma by Impairing TFEB-mediated Lysosome Biogenesis. Gastroenterology 2023, 164, 424–438. [Google Scholar] [CrossRef] [PubMed]
- Vidotto, T.; Melo, C.M.; Lautert-Dutra, W.; Chaves, L.P.; Reis, R.B.; Squire, J.A. Pan-cancer genomic analysis shows hemizygous PTEN loss tumors are associated with immune evasion and poor outcome. Sci. Rep. 2023, 13, 5049. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Garcia, V.; Tawil, Y.; Wise, H.M.; Leslie, N.R. Mechanisms of PTEN loss in cancer: It’s all about diversity. Semin. Cancer Biol. 2019, 59, 66–79. [Google Scholar] [CrossRef] [PubMed]
- Glaviano, A.; Foo, A.; Lam, H.Y.; Yap, K.; Jacot, W.; Jones, R.H.; Eng, H.; Nair, M.G.; Makvandi, P.; Geoerger, B.; et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol. Cancer 2023, 22, 138. [Google Scholar] [CrossRef] [PubMed]
- Kimbrough-Allah, M.N.; Millena, A.C.; Khan, S.A. Differential role of PTEN in transforming growth factor beta (TGF-beta) effects on proliferation and migration in prostate cancer cells. Prostate 2018, 78, 377–389. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Huang, C.; Guan, K. Mechanistic and therapeutic perspectives of miRNA-PTEN signaling axis in cancer therapy resistance. Biochem. Pharmacol. 2024, 226, 116406. [Google Scholar] [CrossRef]
- Wu, H.H.; Leng, S.; Sergi, C.; Leng, R. How MicroRNAs Command the Battle against Cancer. Int. J. Mol. Sci. 2024, 25, 5865. [Google Scholar] [CrossRef]
- Park, S.E.; Kim, W.; Hong, J.Y.; Kang, D.; Park, S.; Suh, J.; You, D.; Park, Y.Y.; Suh, N.; Hwang, J.J.; et al. miR-96-5p targets PTEN to mediate sunitinib resistance in clear cell renal cell carcinoma. Sci. Rep. 2022, 12, 3537. [Google Scholar] [CrossRef]
- Vahabi, M.; Pulito, C.; Sacconi, A.; Donzelli, S.; D’Andrea, M.; Manciocco, V.; Pellini, R.; Paci, P.; Sanguineti, G.; Strigari, L.; et al. miR-96-5p targets PTEN expression affecting radio-chemosensitivity of HNSCC cells. J. Exp. Clin. Cancer Res. 2019, 38, 141. [Google Scholar] [CrossRef]
- Choi, D.; Lim, J.H.; Lee, K.T.; Lee, J.K.; Choi, S.H.; Heo, J.S.; Jang, K.T.; Lee, N.Y.; Kim, S.; Hong, S.T. Cholangiocarcinoma and Clonorchis sinensis infection: A case-control study in Korea. J. Hepatol. 2006, 44, 1066–1073. [Google Scholar] [CrossRef]
- Bouvard, V.; Baan, R.; Straif, K.; Grosse, Y.; Secretan, B.; El Ghissassi, F.; Benbrahim-Tallaa, L.; Guha, N.; Freeman, C.; Galichet, L.; et al. A review of human carcinogens—Part B: Biological agents. Lancet Oncol. 2009, 10, 321–322. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Zhang, Y.; Lin, Z.; Deng, X.; Ren, X.; Huang, M.; Li, S.; Zhou, Q.; Fang, F.; Yang, Q.; et al. FASN-mediated fatty acid biosynthesis remodels immune environment in Clonorchis sinensis infection-related intrahepatic cholangiocarcinoma. J. Hepatol. 2024, 81, 265–277. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.; Shi, D.; Wang, N.; Ren, L.; Liu, N.; Hu, F.; Meng, W.; Hong, S.J.; Bai, X. Clonorchis sinensis legumain promotes migration and invasion of cholangiocarcinoma cells via regulating tumor-related molecules. Parasites Vectors 2023, 16, 71. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Lei, H.; Tian, Y.; Shang, M.; Wu, Y.; Li, Y.; Zhao, L.; Shi, M.; Tang, X.; Chen, T.; et al. Clonorchis sinensis granulin: Identification, immunolocalization, and function in promoting the metastasis of cholangiocarcinoma and hepatocellular carcinoma. Parasites Vectors 2017, 10, 262. [Google Scholar] [CrossRef] [PubMed]
- Pak, J.H.; Kim, I.K.; Kim, S.M.; Maeng, S.; Song, K.J.; Na, B.K.; Kim, T.S. Induction of cancer-related microRNA expression profiling using excretory-secretory products of Clonorchis sinensis. Parasitol. Res. 2014, 113, 4447–4455. [Google Scholar] [CrossRef]
- Chaiyadet, S.; Sotillo, J.; Smout, M.; Cantacessi, C.; Jones, M.K.; Johnson, M.S.; Turnbull, L.; Whitchurch, C.B.; Potriquet, J.; Laohaviroj, M.; et al. Carcinogenic Liver Fluke Secretes Extracellular Vesicles That Promote Cholangiocytes to Adopt a Tumorigenic Phenotype. J. Infect. Dis. 2015, 212, 1636–1645. [Google Scholar] [CrossRef]
- Yan, C.; Zhou, Q.Y.; Wu, J.; Xu, N.; Du, Y.; Li, J.; Liu, J.X.; Koda, S.; Zhang, B.B.; Yu, Q.; et al. Csi-let-7a-5p delivered by extracellular vesicles from a liver fluke activates M1-like macrophages and exacerbates biliary injuries. Proc. Natl. Acad. Sci. USA 2021, 118, e2102206118. [Google Scholar] [CrossRef]
- Zhang, X.; Duan, S.; Li, X.; Ding, J.; Zuo, L.; Sun, B.; Zhang, X.; Jiang, X.; Gao, Y.; Hu, X.; et al. Differences in the secretory exosomes of Clonorchis sinensis adults at different incubation times. Acta Trop. 2022, 234, 106604. [Google Scholar] [CrossRef]
- Ovchinnikov, V.Y.; Kashina, E.V.; Mordvinov, V.A.; Fromm, B. EV-transported microRNAs of Schistosoma mansoni and Fasciola hepatica: Potential targets in definitive hosts. Infect. Genet. Evol. 2020, 85, 104528. [Google Scholar] [CrossRef]
- Fromm, B.; Ovchinnikov, V.; Hoye, E.; Bernal, D.; Hackenberg, M.; Marcilla, A. On the presence and immunoregulatory functions of extracellular microRNAs in the trematode Fasciola hepatica. Parasite Immunol. 2017, 39, e12399. [Google Scholar] [CrossRef]
- Yothaisong, S.; Thanee, M.; Namwat, N.; Yongvanit, P.; Boonmars, T.; Puapairoj, A.; Loilome, W. Opisthorchis viverrini infection activates the PI3K/AKT/PTEN and Wnt/beta-catenin signaling pathways in a Cholangiocarcinogenesis model. Asian Pac. J. Cancer Prev. 2014, 15, 10463–10468. [Google Scholar] [CrossRef] [PubMed]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021, 31, 107–125. [Google Scholar] [CrossRef] [PubMed]
- Gong, D.; Chen, M.; Wang, Y.; Shi, J.; Hou, Y. Role of ferroptosis on tumor progression and immunotherapy. Cell Death Discov. 2022, 8, 427. [Google Scholar] [CrossRef] [PubMed]
- Koppula, P.; Zhuang, L.; Gan, B. Cystine transporter SLC7A11/xCT in cancer: Ferroptosis, nutrient dependency, and cancer therapy. Protein Cell 2021, 12, 599–620. [Google Scholar] [CrossRef]
- Koppula, P.; Zhang, Y.; Zhuang, L.; Gan, B. Amino acid transporter SLC7A11/xCT at the crossroads of regulating redox homeostasis and nutrient dependency of cancer. Cancer Commun. 2018, 38, 12. [Google Scholar] [CrossRef]
- Rochette, L.; Dogon, G.; Rigal, E.; Zeller, M.; Cottin, Y.; Vergely, C. Lipid Peroxidation and Iron Metabolism: Two Corner Stones in the Homeostasis Control of Ferroptosis. Int. J. Mol. Sci. 2022, 24, 449. [Google Scholar] [CrossRef]
- Capelletti, M.M.; Manceau, H.; Puy, H.; Peoc’H, K. Ferroptosis in Liver Diseases: An Overview. Int. J. Mol. Sci. 2020, 21, 4908. [Google Scholar] [CrossRef]
- Cahuzac, K.M.; Lubin, A.; Bosch, K.; Stokes, N.; Shoenfeld, S.M.; Zhou, R.; Lemon, H.; Asara, J.; Parsons, R.E. AKT activation because of PTEN loss upregulates xCT via GSK3beta/NRF2, leading to inhibition of ferroptosis in PTEN-mutant tumor cells. Cell Rep. 2023, 42, 112536. [Google Scholar] [CrossRef]
- Li, S.Q.; Xu, W.T.; Yin, Y.X.; Wei, H.T.; Li, K.Z.; Xie, M.Z.; Lv, F.; Xie, L.Y.; Hu, B.L. SNHG4-mediated PTEN destabilization confers oxaliplatin resistance in colorectal cancer cells by inhibiting ferroptosis. Apoptosis 2024, 29, 835–848. [Google Scholar] [CrossRef]
- Ilyas, S.I.; Gores, G.J. Pathogenesis, diagnosis, and management of cholangiocarcinoma. Gastroenterology 2013, 145, 1215–1229. [Google Scholar] [CrossRef] [PubMed]
- Qian, M.B.; Chen, Y.D.; Liang, S.; Yang, G.J.; Zhou, X.N. The global epidemiology of clonorchiasis and its relation with cholangiocarcinoma. Infect. Dis. Poverty 2012, 1, 4. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.R.; Chen, M.; Pandolfi, P.P. The functions and regulation of the PTEN tumour suppressor: New modes and prospects. Nat. Rev. Mol. Cell Biol. 2018, 19, 547–562. [Google Scholar] [CrossRef] [PubMed]
- Yi, J.; Zhu, J.; Wu, J.; Thompson, C.B.; Jiang, X. Oncogenic activation of PI3K-AKT-mTOR signaling suppresses ferroptosis via SREBP-mediated lipogenesis. Proc. Natl. Acad. Sci. USA 2020, 117, 31189–31197. [Google Scholar] [CrossRef] [PubMed]
- Mao, X.; Xu, J.; Xiao, M.; Liang, C.; Hua, J.; Liu, J.; Wang, W.; Yu, X.; Meng, Q.; Shi, S. ARID3A enhances chemoresistance of pancreatic cancer via inhibiting PTEN-induced ferroptosis. Redox Biol. 2024, 73, 103200. [Google Scholar] [CrossRef]
- Xue, X.; Dai, T.; Che n, J.; Xu, Y.; Yang, Z.; Huang, J.; Xu, W.; Li, S.; Meng, Q. PPARgamma activation suppresses chondrocyte ferroptosis through mitophagy in osteoarthritis. J. Orthop. Surg. Res. 2023, 18, 620. [Google Scholar] [CrossRef]
- Qiu, Y.; Wang, C.; Wang, J.; Lv, Q.; Sun, L.; Yang, Y.; Liu, M.; Liu, X.; Li, C.; Tang, B. Revealing the dynamic whole transcriptome landscape of Clonorchis sinensis: Insights into the regulatory roles of noncoding RNAs and microtubule-related genes in development. PLoS Neglect. Trop. Dis. 2024, 18, e0012311. [Google Scholar] [CrossRef]
- Zhu, L.; Liu, J.; Dao, J.; Lu, K.; Li, H.; Gu, H.; Liu, J.; Feng, X.; Cheng, G. Molecular characterization of S. japonicum exosome-like vesicles reveals their regulatory roles in parasite-host interactions. Sci. Rep. 2016, 6, 25885. [Google Scholar] [CrossRef]
- Wang, D.; Jiang, P.; Wu, X.; Zhang, Y.; Wang, C.; Li, M.; Liu, M.; Yin, J.; Zhu, G. Requirement of microtubules for secretion of a micronemal protein CpTSP4 in the invasive stage of the apicomplexan Cryptosporidium parvum. mBio 2024, 15, e0315823. [Google Scholar] [CrossRef]
- Sae-Fung, A.; Mutirangura, A.; Jitkaew, S. Identification and validation of a novel ferroptosis-related gene signature for prognosis and potential therapeutic target prediction in cholangiocarcinoma. Front. Immunol. 2022, 13, 1051273. [Google Scholar] [CrossRef]
No. | miRNAs | Average TPM | Sequences (5′-3′) |
---|---|---|---|
1 | csi-let-7-5p | 81,142 | TGGAAGACTTGTGATTTAGTTG |
2 | csi-miR-61-5p | 47,397 | TGACTAGAAAGAGCACTCACATCC |
3 | bantam | 42,816 | TGAGATCGCGATTAAAGCTGGT |
4 | csi-miR-125a-5p | 41,060 | TCCCTGAGACCCTTTGATTGCC |
5 | csi-miR-71a-5p | 36,373 | TGAAAGACATGGGTAATGAGT |
6 | csi-miR-755 | 32,329 | TGAGATTCAACTACTTCAACT |
7 | csi-miR-36a | 23,914 | GTCACCGGGTAGACATTCATTCAC |
8 | csi-miR-2162-3p | 16,138 | TATTATGCAACGTTTCACTCT |
9 | csi-miR-31-5p | 15,469 | TGGCAAGATTATGGCGAAGCTGA |
10 | csi-miR-96-5p | 15,254 | CTTGGCACTTTGGAATTGTCAC |
11 | csi-miR-281-3p | 14,198 | TGTCATGGAGTTGCTCTCTATA |
12 | csi-miR-46 | 14,185 | ATGTCATGGAGTTGCTCTCTACA |
13 | csi-miR-3479 | 9856 | GTATTGCACTTTCCTTCGCCTTA |
14 | csi-miR-125a | 9820 | TCCCTGAGACCCTTTGATTGCC |
15 | csi-miR-745-3p | 8857 | TGCTGCCTGATAAGAGCTGTG |
16 | csi-miR-7-5p | 7942 | TGGAAGACTTGTGATTTAGTTG |
17 | csi-miR-219-5p | 7372 | TGATTGTCCATTCGCATTTCTT |
18 | csi-miR-10-5p | 5984 | AACCCTGTAGACCCGAGTTTGG |
19 | csi-miR-1 | 5610 | TGGAATGTTGTGAAGTATGTGC |
20 | csi-miR-36a-3p | 4737 | TCACCGGGTAGACATTCCTTGC |
21 | csi-miR-71b-5p | 3313 | TGAAAGACTTGAGTAGTGAGACG |
22 | csi-miR-2a-3p | 1675 | AATCACAGCCCTGCTTGGAACC |
23 | csi-miR-190 | 1279 | CAGTGACCAGACATATCCCT |
24 | csi-miR-9 | 1149 | CTTGGCACTTTGGAATTGTCAC |
25 | csi-miR-277 | 1060 | TAAATGCATTATCTGGTATGAT |
26 | csi-miR-61-5p | 948 | TGTGGGTCTCTTTCTTGTCCAT |
27 | csi-miR-307 | 646 | TCACAACCTACTTGATTGAGG |
28 | csi-miR-125c-5p | 361 | TCCCTGAGACCTTAGAGTTGTC |
29 | csi-miR-8-3p | 218 | TAATACTGTTAGGTAAAGATGCC |
30 | csi-miR-36b-3p | 213 | CCACCGGGTAGACATTCATCCGC |
31 | csi-miR-2e-3p | 159 | TATCACAGTCCAAGCTTTGGT |
32 | csi-miR-10-3p | 81 | AAATTCGAGTCTATAAGGAAAAA |
33 | csi-miR-190-5p | 81 | TGATATGTATGGGTTACTTGGTG |
34 | csi-miR-2b | 41 | TATCACAGCCCTGCTTGGGACACA |
35 | csi-miR-87 | 27 | GTGAGCAAAGTTTCAGGTGT |
36 | csi-miR-124 | 14 | TTAAGGCACGCGGTGAATGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, L.; Li, M.; Yin, J. PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis. Int. J. Mol. Sci. 2024, 25, 10350. https://doi.org/10.3390/ijms251910350
Wen L, Li M, Yin J. PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis. International Journal of Molecular Sciences. 2024; 25(19):10350. https://doi.org/10.3390/ijms251910350
Chicago/Turabian StyleWen, Lijia, Meng Li, and Jigang Yin. 2024. "PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis" International Journal of Molecular Sciences 25, no. 19: 10350. https://doi.org/10.3390/ijms251910350
APA StyleWen, L., Li, M., & Yin, J. (2024). PTEN Deficiency Induced by Extracellular Vesicle miRNAs from Clonorchis sinensis Potentiates Cholangiocarcinoma Development by Inhibiting Ferroptosis. International Journal of Molecular Sciences, 25(19), 10350. https://doi.org/10.3390/ijms251910350