Pexidartinib and Immune Checkpoint Inhibitors Combine to Activate Tumor Immunity in a Murine Colorectal Cancer Model by Depleting M2 Macrophages Differentiated by Cancer-Associated Fibroblasts
Abstract
1. Introduction
2. Results
2.1. Monocyte Differentiation into M2 Macrophages Induced by CAFs Derived from CRC Cells
2.2. CAF Abundance Correlates with the Abundance of M2 Macrophages in the Human CRC Microenvironment
2.3. CAFs Increase M2 Macrophage Abundance in an Orthotopic Transplant Mouse Model of CRC
2.4. Combination Therapy with PLX3397 and Anti-PD-1 Antibody Further Promotes CD8-Positive T Cell Infiltration at the Tumor Site and Reduces Tumor Volume
2.5. Immune Pathways Are Activated in Transplanted Tumors When Anti-PD-1 Antibodies Are Combined with PLX3397
3. Discussion
4. Materials and Methods
4.1. Human CRC Samples
4.2. CAF and M2 Macrophage Immunohistology
4.3. Quantitative RT-PCR
4.4. Cell Lines
4.5. Cell Culture and CAF Preparation
4.6. Co-Cultures
4.7. Animals
4.8. Murine CRC Model Immunohistochemistry
4.9. PLX3397 Treatment
4.10. RNA Sequencing and Gene Set Enrichment Analysis (GSEA)
4.11. Reagents
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas, N. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012, 487, 330–337. [Google Scholar] [CrossRef]
- Le, D.T.; Uram, J.N.; Wang, H.; Bartlett, B.R.; Kemberling, H.; Eyring, A.D.; Skora, A.D.; Luber, B.S.; Azad, N.S.; Laheru, D.; et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. N. Engl. J. Med. 2015, 372, 2509–2520. [Google Scholar] [CrossRef] [PubMed]
- Lin, K.X.; Istl, A.C.; Quan, D.; Skaro, A.; Tang, E.; Zheng, X.F. PD-1 and PD-L1 inhibitors in cold colorectal cancer: Challenges and strategies. Cancer Immunol. Immun. 2023, 72, 3875–3893. [Google Scholar] [CrossRef]
- Yorita, N.; Yuge, R.; Takigawa, H.; Ono, A.; Kuwai, T.; Kuraoka, K.; Kitadai, Y.; Tanaka, S.; Chayama, K. Stromal reaction inhibitor and immune-checkpoint inhibitor combination therapy attenuates excluded-type colorectal cancer in a mouse model. Cancer Lett. 2021, 498, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Krneta, T.; Gillgrass, A.; Poznanski, S.; Chew, M.; Lee, A.J.; Kolb, M.; Ashkar, A.A. M2-polarized and tumor-associated macrophages alter NK cell phenotype and function in a contact-dependent manner. J. Leukoc. Biol. 2017, 101, 285–295. [Google Scholar] [CrossRef] [PubMed]
- Inoue, T.; Adachi, K.; Kawana, K.; Taguchi, A.; Nagamatsu, T.; Fujimoto, A.; Tomio, K.; Yamashita, A.; Eguchi, S.; Nishida, H.; et al. Cancer-associated fibroblast suppresses killing activity of natural killer cells through downregulation of poliovirus receptor (PVR/CD155), a ligand of activating NK receptor. Int. J. Oncol. 2016, 49, 1297–1304. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Qi, F.; Zhao, F.; Li, G.; Shao, S.; Zhang, X.; Yuan, L.; Feng, Y. Cancer-associated fibroblasts enhance tumor-associated macrophages enrichment and suppress NK cells function in colorectal cancer. Cell Death Dis. 2019, 10, 273. [Google Scholar] [CrossRef] [PubMed]
- Cho, H.; Seo, Y.; Loke, K.M.; Kim, S.W.; Oh, S.M.; Kim, J.H.; Soh, J.; Kim, H.S.; Lee, H.; Kim, J.; et al. Cancer-Stimulated CAFs Enhance Monocyte Differentiation and Protumoral TAM Activation via IL6 and GM-CSF Secretion. Clin. Cancer Res. 2018, 24, 5407–5421. [Google Scholar] [CrossRef]
- Li, X.; Bu, W.; Meng, L.; Liu, X.; Wang, S.; Jiang, L.; Ren, M.; Fan, Y.; Sun, H. CXCL12/CXCR4 pathway orchestrates CSC-like properties by CAF recruited tumor associated macrophage in OSCC. Exp. Cell Res. 2019, 378, 131–138. [Google Scholar] [CrossRef]
- Gok Yavuz, B.; Gunaydin, G.; Gedik, M.E.; Kosemehmetoglu, K.; Karakoc, D.; Ozgur, F.; Guc, D. Cancer associated fibroblasts sculpt tumour microenvironment by recruiting monocytes and inducing immunosuppressive PD-1(+) TAMs. Sci. Rep. 2019, 9, 3172. [Google Scholar] [CrossRef] [PubMed]
- Wynn, T.A.; Chawla, A.; Pollard, J.W. Macrophage biology in development, homeostasis and disease. Nature 2013, 496, 445–455. [Google Scholar] [CrossRef] [PubMed]
- Orecchioni, M.; Ghosheh, Y.; Pramod, A.B.; Ley, K. Macrophage Polarization: Different Gene Signatures in M1(LPS+) vs. Classically and M2(LPS-) vs. Alternatively Activated Macrophages. Front. Immunol. 2019, 10, 1084. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, A.; Marchesi, F.; Malesci, A.; Laghi, L.; Allavena, P. Tumour-associated macrophages as treatment targets in oncology. Nat. Rev. Clin. Oncol. 2017, 14, 399–416. [Google Scholar] [CrossRef] [PubMed]
- Murray, P.J.; Wynn, T.A. Protective and pathogenic functions of macrophage subsets. Nat. Rev. Immunol. 2011, 11, 723–737. [Google Scholar] [CrossRef]
- Sica, A.; Mantovani, A. Macrophage plasticity and polarization: In vivo veritas. J. Clin. Investig. 2012, 122, 787–795. [Google Scholar] [CrossRef] [PubMed]
- Noy, R.; Pollard, J.W. Tumor-associated macrophages: From mechanisms to therapy. Immunity 2014, 41, 49–61. [Google Scholar] [CrossRef] [PubMed]
- Hume, D.A.; MacDonald, K.P. Therapeutic applications of macrophage colony-stimulating factor-1 (CSF-1) and antagonists of CSF-1 receptor (CSF-1R) signaling. Blood 2012, 119, 1810–1820. [Google Scholar] [CrossRef]
- Chitu, V.; Stanley, E.R. Colony-stimulating factor-1 in immunity and inflammation. Curr. Opin. Immunol. 2006, 18, 39–48. [Google Scholar] [CrossRef]
- Stanley, E.R.; Chitu, V. CSF-1 receptor signaling in myeloid cells. Cold Spring Harb. Perspect. Biol. 2014, 6, a021857. [Google Scholar] [CrossRef]
- Peranzoni, E.; Lemoine, J.; Vimeux, L.; Feuillet, V.; Barrin, S.; Kantari-Mimoun, C.; Bercovici, N.; Guerin, M.; Biton, J.; Ouakrim, H.; et al. Macrophages impede CD8 T cells from reaching tumor cells and limit the efficacy of anti-PD-1 treatment. Proc. Natl. Acad. Sci. USA 2018, 115, E4041–E4050. [Google Scholar] [CrossRef]
- Patwardhan, P.P.; Surriga, O.; Beckman, M.J.; de Stanchina, E.; Dematteo, R.P.; Tap, W.D.; Schwartz, G.K. Sustained inhibition of receptor tyrosine kinases and macrophage depletion by PLX3397 and rapamycin as a potential new approach for the treatment of MPNSTs. Clin. Cancer Res. 2014, 20, 3146–3158. [Google Scholar] [CrossRef]
- Anderson, K.G.; Stromnes, I.M.; Greenberg, P.D. Obstacles Posed by the Tumor Microenvironment to T cell Activity: A Case for Synergistic Therapies. Cancer Cell 2017, 31, 311–325. [Google Scholar] [CrossRef]
- Chen, D.S.; Mellman, I. Elements of cancer immunity and the cancer-immune set point. Nature 2017, 541, 321–330. [Google Scholar] [CrossRef]
- Babazadeh, S.; Nassiri, S.M.; Siavashi, V.; Sahlabadi, M.; Hajinasrollah, M.; Zamani-Ahmadmahmudi, M. Macrophage polarization by MSC-derived CXCL12 determines tumor growth. Cell Mol. Biol. Lett. 2021, 26, 30. [Google Scholar] [CrossRef]
- Arabpour, M.; Saghazadeh, A.; Rezaei, N. Anti-inflammatory and M2 macrophage polarization-promoting effect of mesenchymal stem cell-derived exosomes. Int. Immunopharmacol. 2021, 97, 107823. [Google Scholar] [CrossRef]
- Shinagawa, K.; Kitadai, Y.; Tanaka, M.; Sumida, T.; Kodama, M.; Higashi, Y.; Tanaka, S.; Yasui, W.; Chayama, K. Mesenchymal stem cells enhance growth and metastasis of colon cancer. Int. J. Cancer 2010, 127, 2323–2333. [Google Scholar] [CrossRef]
- Gunaydin, G. CAFs Interacting with TAMs in Tumor Microenvironment to Enhance Tumorigenesis and Immune Evasion. Front. Oncol. 2021, 11, 668349. [Google Scholar] [CrossRef] [PubMed]
- Franklin, R.A.; Liao, W.; Sarkar, A.; Kim, M.V.; Bivona, M.R.; Liu, K.; Pamer, E.G.; Li, M.O. The cellular and molecular origin of tumor-associated macrophages. Science 2014, 344, 921–925. [Google Scholar] [CrossRef]
- Mota, J.M.; Leite, C.A.; Souza, L.E.; Melo, P.H.; Nascimento, D.C.; de-Deus-Wagatsuma, V.M.; Temporal, J.; Figueiredo, F.; Noushmehr, H.; Alves-Filho, J.C.; et al. Post-Sepsis State Induces Tumor-Associated Macrophage Accumulation through CXCR4/CXCL12 and Favors Tumor Progression in Mice. Cancer Immunol. Res. 2016, 4, 312–322. [Google Scholar] [CrossRef]
- Linde, N.; Lederle, W.; Depner, S.; van Rooijen, N.; Gutschalk, C.M.; Mueller, M.M. Vascular endothelial growth factor-induced skin carcinogenesis depends on recruitment and alternative activation of macrophages. J. Pathol. 2012, 227, 17–28. [Google Scholar] [CrossRef]
- Nandi, B.; Shapiro, M.; Samur, M.K.; Pai, C.; Frank, N.Y.; Yoon, C.; Prabhala, R.H.; Munshi, N.C.; Gold, J.S. Stromal CCR6 drives tumor growth in a murine transplantable colon cancer through recruitment of tumor-promoting macrophages. Oncoimmunology 2016, 5, e1189052. [Google Scholar] [CrossRef]
- Comito, G.; Giannoni, E.; Segura, C.P.; Barcellos-de-Souza, P.; Raspollini, M.R.; Baroni, G.; Lanciotti, M.; Serni, S.; Chiarugi, P. Cancer-associated fibroblasts and M2-polarized macrophages synergize during prostate carcinoma progression. Oncogene 2014, 33, 2423–2431. [Google Scholar] [CrossRef]
- Ando, N.; Hara, M.; Shiga, K.; Yanagita, T.; Takasu, K.; Nakai, N.; Maeda, Y.; Hirokawa, T.; Takahashi, H.; Ishiguro, H.; et al. Eicosapentaenoic acid suppresses angiogenesis via reducing secretion of IL-6 and VEGF from colon cancer-associated fibroblasts. Oncol. Rep. 2019, 42, 339–349. [Google Scholar] [CrossRef]
- Damm, S.; Koefinger, P.; Stefan, M.; Wels, C.; Mehes, G.; Richtig, E.; Kerl, H.; Otte, M.; Schaider, H. HGF-promoted motility in primary human melanocytes depends on CD44v6 regulated via NF-kappa B, Egr-1, and C/EBP-beta. J. Investig. Dermatol. 2010, 130, 1893–1903. [Google Scholar] [CrossRef]
- Wang, Y.; Lan, W.; Xu, M.; Song, J.; Mao, J.; Li, C.; Du, X.; Jiang, Y.; Li, E.; Zhang, R.; et al. Cancer-associated fibroblast-derived SDF-1 induces epithelial-mesenchymal transition of lung adenocarcinoma via CXCR4/beta-catenin/PPARdelta signalling. Cell Death Dis. 2021, 12, 214. [Google Scholar] [CrossRef]
- Ngan, C.Y.; Yamamoto, H.; Seshimo, I.; Tsujino, T.; Man-i, M.; Ikeda, J.I.; Konishi, K.; Takemasa, I.; Ikeda, M.; Sekimoto, M.; et al. Quantitative evaluation of vimentin expression in tumour stroma of colorectal cancer. Br. J. Cancer 2007, 96, 986–992. [Google Scholar] [CrossRef]
- Naito, T.; Yuge, R.; Kitadai, Y.; Takigawa, H.; Higashi, Y.; Kuwai, T.; Kuraoka, K.; Tanaka, S.; Chayama, K. Mesenchymal stem cells induce tumor stroma formation and epithelial-mesenchymal transition through SPARC expression in colorectal cancer. Oncol. Rep. 2021, 45, 104. [Google Scholar] [CrossRef]
- Takigawa, H.; Kitadai, Y.; Shinagawa, K.; Yuge, R.; Higashi, Y.; Tanaka, S.; Yasui, W.; Chayama, K. Mesenchymal Stem Cells Induce Epithelial to Mesenchymal Transition in Colon Cancer Cells through Direct Cell-to-Cell Contact. Neoplasia 2017, 19, 429–438. [Google Scholar] [CrossRef]
- Mok, S.; Koya, R.C.; Tsui, C.; Xu, J.; Robert, L.; Wu, L.; Graeber, T.; West, B.L.; Bollag, G.; Ribas, A. Inhibition of CSF-1 receptor improves the antitumor efficacy of adoptive cell transfer immunotherapy. Cancer Res. 2014, 74, 153–161. [Google Scholar] [CrossRef]
- Strachan, D.C.; Ruffell, B.; Oei, Y.; Bissell, M.J.; Coussens, L.M.; Pryer, N.; Daniel, D. CSF1R inhibition delays cervical and mammary tumor growth in murine models by attenuating the turnover of tumor-associated macrophages and enhancing infiltration by CD8(+) T cells. Oncoimmunology 2013, 2, e26968. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Knolhoff, B.L.; Meyer, M.A.; Nywening, T.M.; West, B.L.; Luo, J.; Wang-Gillam, A.; Goedegebuure, S.P.; Linehan, D.C.; DeNardo, D.G. CSF1/CSF1R blockade reprograms tumor-infiltrating macrophages and improves response to T-cell checkpoint immunotherapy in pancreatic cancer models. Cancer Res. 2014, 74, 5057–5069. [Google Scholar] [CrossRef] [PubMed]
- Ries, C.H.; Cannarile, M.A.; Hoves, S.; Benz, J.; Wartha, K.; Runza, V.; Rey-Giraud, F.; Pradel, L.P.; Feuerhake, F.; Klaman, I.; et al. Targeting tumor-associated macrophages with anti-CSF-1R antibody reveals a strategy for cancer therapy. Cancer Cell 2014, 25, 846–859. [Google Scholar] [CrossRef] [PubMed]
- Ng, T.H.; Britton, G.J.; Hill, E.V.; Verhagen, J.; Burton, B.R.; Wraith, D.C. Regulation of adaptive immunity; the role of interleukin-10. Front. Immunol. 2013, 4, 129. [Google Scholar] [CrossRef]
- Savage, N.D.; de Boer, T.; Walburg, K.V.; Joosten, S.A.; van Meijgaarden, K.; Geluk, A.; Ottenhoff, T.H. Human anti-inflammatory macrophages induce Foxp3+ GITR+ CD25+ regulatory T cells, which suppress via membrane-bound TGFbeta-1. J. Immunol. 2008, 181, 2220–2226. [Google Scholar] [CrossRef] [PubMed]
- Prima, V.; Kaliberova, L.N.; Kaliberov, S.; Curiel, D.T.; Kusmartsev, S. COX2/mPGES1/PGE2 pathway regulates PD-L1 expression in tumor-associated macrophages and myeloid-derived suppressor cells. Proc. Natl. Acad. Sci. USA 2017, 114, 1117–1122. [Google Scholar] [CrossRef] [PubMed]
- Doedens, A.L.; Stockmann, C.; Rubinstein, M.P.; Liao, D.; Zhang, N.; DeNardo, D.G.; Coussens, L.M.; Karin, M.; Goldrath, A.W.; Johnson, R.S. Macrophage expression of hypoxia-inducible factor-1 alpha suppresses T-cell function and promotes tumor progression. Cancer Res. 2010, 70, 7465–7475. [Google Scholar] [CrossRef] [PubMed]
- Belai, E.B.; de Oliveira, C.E.; Gasparoto, T.H.; Ramos, R.N.; Torres, S.A.; Garlet, G.P.; Cavassani, K.A.; Silva, J.S.; Campanelli, A.P. PD-1 blockage delays murine squamous cell carcinoma development. Carcinogenesis 2014, 35, 424–431. [Google Scholar] [CrossRef] [PubMed]
- Cassier, P.A.; Garin, G.; Eberst, L.; Delord, J.P.; Chabaud, S.; Terret, C.; Montane, L.; Bidaux, A.S.; Laurent, S.; Jaubert, L.; et al. MEDIPLEX: A phase 1 study of durvalumab (D) combined with pexidartinib (P) in patients (pts) with advanced pancreatic ductal adenocarcinoma (PDAC) and colorectal cancer (CRC). J. Clin. Oncol. 2019, 37, 2579. [Google Scholar] [CrossRef]
- Kadota, H.; Yuge, R.; Shimizu, D.; Miyamoto, R.; Otani, R.; Hiyama, Y.; Takigawa, H.; Hayashi, R.; Urabe, Y.; Kitadai, Y.; et al. Anti-Programmed Cell Death-1 Antibody and Dasatinib Combination Therapy Exhibits Efficacy in Metastatic Colorectal Cancer Mouse Models. Cancers 2022, 14, 6146. [Google Scholar] [CrossRef]
Number of patients | 73 | |
Age (years old) | 70.3 ± 9.5 | |
Sex | Male | 39 (53.4) |
Location | Right side colon | 26 (35.6) |
Left side colon | 47 (64.4) | |
Histological Type | tub 1/2 | 65 (89.0) |
Por/muc | 8 (11.0) | |
Stage | I/II | 39 (53.4) |
III/IV | 34 (46.6) | |
T | 1/2 | 18 (24.7) |
3/4 | 55 (75.3) | |
N | N0 | 41 (56.2) |
N1/2/3 | 32 (43.8) | |
M | 0 | 60 (82.2) |
1 | 13 (17.8) | |
Vascular invasion | 0/1 | 63 (86.3) |
2/3 | 10 (13.7) | |
Budding grade | 1 | 12 (48.0) |
2, 3 | 13 (52.0) | |
Microsatellite instability | MSS | 66 (90.4) |
MSI-high | 7 (9.6) |
Target Gene | Direction | Sequence (5′-3′) |
---|---|---|
mouse GAPDH | Forward | GCCTCGTCCCGTAGACAAAA |
Reverse | CCATTCTCGGCCTTGACTGT | |
mouse CD206 | Forward | GGAAACGGGAGAACCATCAC |
Reverse | GGCGAGCATCAAGAGTAAAG | |
mouse iNos | Forward | AGGGACAAGCCTACCCCTC |
Reverse | CTCCATCTCCCGTCAGTTGGT | |
mouse IL-1 | Forward | TCACAGCAGCACATCAACAA |
Reverse | TGTCCTCATCCTGGAAGGT | |
mouse IL-6 | Forward | GTCCTTCAGAGAGATACAGAAACT |
Reverse | AGCTTATCTGTTAGGAGACCATTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shimizu, D.; Yuge, R.; Kitadai, Y.; Ariyoshi, M.; Miyamoto, R.; Hiyama, Y.; Takigawa, H.; Urabe, Y.; Oka, S. Pexidartinib and Immune Checkpoint Inhibitors Combine to Activate Tumor Immunity in a Murine Colorectal Cancer Model by Depleting M2 Macrophages Differentiated by Cancer-Associated Fibroblasts. Int. J. Mol. Sci. 2024, 25, 7001. https://doi.org/10.3390/ijms25137001
Shimizu D, Yuge R, Kitadai Y, Ariyoshi M, Miyamoto R, Hiyama Y, Takigawa H, Urabe Y, Oka S. Pexidartinib and Immune Checkpoint Inhibitors Combine to Activate Tumor Immunity in a Murine Colorectal Cancer Model by Depleting M2 Macrophages Differentiated by Cancer-Associated Fibroblasts. International Journal of Molecular Sciences. 2024; 25(13):7001. https://doi.org/10.3390/ijms25137001
Chicago/Turabian StyleShimizu, Daisuke, Ryo Yuge, Yuki Kitadai, Misa Ariyoshi, Ryo Miyamoto, Yuichi Hiyama, Hidehiko Takigawa, Yuji Urabe, and Shiro Oka. 2024. "Pexidartinib and Immune Checkpoint Inhibitors Combine to Activate Tumor Immunity in a Murine Colorectal Cancer Model by Depleting M2 Macrophages Differentiated by Cancer-Associated Fibroblasts" International Journal of Molecular Sciences 25, no. 13: 7001. https://doi.org/10.3390/ijms25137001
APA StyleShimizu, D., Yuge, R., Kitadai, Y., Ariyoshi, M., Miyamoto, R., Hiyama, Y., Takigawa, H., Urabe, Y., & Oka, S. (2024). Pexidartinib and Immune Checkpoint Inhibitors Combine to Activate Tumor Immunity in a Murine Colorectal Cancer Model by Depleting M2 Macrophages Differentiated by Cancer-Associated Fibroblasts. International Journal of Molecular Sciences, 25(13), 7001. https://doi.org/10.3390/ijms25137001