ADPN Regulates Oxidative Stress-Induced Follicular Atresia in Geese by Modulating Granulosa Cell Apoptosis and Autophagy
Abstract
:1. Introduction
2. Results
2.1. Morphology of Follicles at Different Stages of Development and Histological Characteristics of Each Membrane Layer of Follicles in Geese
2.2. High Levels of Oxidative Stress in Pre-Hierarchical and Atretic Follicles
2.3. High Levels of Apoptosis in Atretic Follicles
2.4. Autophagy Is Involved in Follicular Atresia
2.5. Expression of ADPN in Goose Follicles at Different Stages
2.6. Oxidative Stress Induces Apoptosis and Autophagy in Goose GCs
2.7. ADPN Regulated Apoptosis and Autophagy in GCs Induced by Oxidative Stress in GCs
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Animals and Sample Collection
4.3. Hematoxylin and Eosin (H and E) Staining
4.4. Measurement of SOD and MDA Content in Follicular Tissue
4.5. Quantitative Real-Time PCR
4.6. Western Blot
4.7. Transmission Electron Microscopy (TEM)
4.8. Cell Culture Identification and Transfection
4.9. Cell Viability Assay
4.10. ROS Staining Assay
4.11. Immunofluorescence
4.12. Flow Cytometry
4.13. Enzyme-Linked Immunosorbent Assay (ELISA)
4.14. RNA Sequencing and Data Processing
4.15. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Renema, R.A.; Robinson, F.E.; Proudman, J.A.; Newcombe, M.; McKay, R.I. Effects of body weight and feed allocation during sexual maturation in broiler breeder hens. 2. Ovarian morphology and plasma hormone profiles. Poult. Sci. 1999, 78, 629–639. [Google Scholar] [CrossRef] [PubMed]
- Lovell, T.M.; Gladwell, R.T.; Groome, N.P.; Knight, P.G. Ovarian follicle development in the laying hen is accompanied by divergent changes in inhibin A, inhibin B, activin A and follistatin production in granulosa and theca layers. J. Endocrinol. 2003, 177, 45–55. [Google Scholar] [CrossRef] [PubMed]
- Onagbesan, O.; Bruggeman, V.; Decuypere, E. Intra-ovarian growth factors regulating ovarian function in avian species: A review. Anim. Reprod. Sci. 2009, 111, 121–140. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Liu, K. Seeing is believing: No adult oogenesis in mammals. Cell Cycle (Georget. Tex.) 2015, 14, 935–936. [Google Scholar] [CrossRef] [PubMed]
- Tilly, J.L.; Kowalski, K.I.; Johnson, A.L.; Hsueh, A.J. Involvement of apoptosis in ovarian follicular atresia and postovulatory regression. Endocrinology 1991, 129, 2799–2801. [Google Scholar] [CrossRef] [PubMed]
- Eppig, J.J. Oocyte control of ovarian follicular development and function in mammals. Reproduction 2001, 122, 829–838. [Google Scholar] [CrossRef] [PubMed]
- Chaube, S.; Shrivastav, T.; Prasad, S.; Tiwari, M.; Tripathi, A.; Pandey, A.N.; Premkumar, V. Clomiphene Citrate Induces ROS-Mediated Apoptosis in Mammalian Oocytes. Open J. Apoptosis 2014, 3, 33006. [Google Scholar] [CrossRef]
- Wang, Z.; Lu, L.; Gu, T.; Hou, L.; Du, L.; Zhang, Y.; Zhang, Y.; Xu, Q.; Chen, G. The effects of FAR1 and TGFBRAP1 on the proliferation and apoptosis of follicular granulosa cells in goose (Anser cygnoides). Gene 2021, 769, 145194. [Google Scholar] [CrossRef] [PubMed]
- Shen, M.; Cao, Y.; Jiang, Y.; Wei, Y.; Liu, H. Melatonin protects mouse granulosa cells against oxidative damage by inhibiting FOXO1-mediated autophagy: Implication of an antioxidation-independent mechanism. Redox Biol. 2018, 18, 138–157. [Google Scholar] [CrossRef] [PubMed]
- Lou, Y.; Yu, W.; Han, L.; Yang, S.; Wang, Y.; Ren, T.; Yu, J.; Zhao, A. ROS activates autophagy in follicular granulosa cells via mTOR pathway to regulate broodiness in goose. Anim. Reprod. Sci. 2017, 185, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Al-Gubory, K.H.; Fowler, P.A.; Garrel, C. The roles of cellular reactive oxygen species, oxidative stress and antioxidants in pregnancy outcomes. Int. J. Biochem. Cell Biol. 2010, 42, 1634–1650. [Google Scholar] [CrossRef] [PubMed]
- Kannan, K.; Jain, S.K. Oxidative stress and apoptosis. Pathophysiol. Off. J. Int. Soc. Pathophysiol. 2000, 7, 153–163. [Google Scholar] [CrossRef]
- Yamamoto, H.; Zhang, S.; Mizushima, N. Autophagy genes in biology and disease. Nat. Rev. Genet. 2023, 24, 382–400. [Google Scholar] [CrossRef] [PubMed]
- Kang, B.; Wang, X.; Xu, Q.; Wu, Y.; Si, X.; Jiang, D. Effect of 3-nitropropionic acid inducing oxidative stress and apoptosis of granulosa cells in geese. Biosci. Rep. 2018, 38, BSR20180274. [Google Scholar] [CrossRef] [PubMed]
- Hou, L.; Gu, T.; Weng, K.; Zhang, Y.; Zhang, Y.; Chen, G.; Xu, Q. Effects of Oxidative Stress on the Autophagy and Apoptosis of Granulosa Cells in Broody Geese. Int. J. Mol. Sci. 2023, 24, 2154. [Google Scholar] [CrossRef] [PubMed]
- Díez, J.J.; Iglesias, P. The role of the novel adipocyte-derived hormone adiponectin in human disease. Eur. J. Endocrinol. 2003, 148, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Chappaz, E.; Albornoz, M.S.; Campos, D.; Che, L.; Palin, M.F.; Murphy, B.D.; Bordignon, V. Adiponectin enhances in vitro development of swine embryos. Domest. Anim. Endocrinol. 2008, 35, 198–207. [Google Scholar] [CrossRef] [PubMed]
- Richards, J.S.; Liu, Z.; Kawai, T.; Tabata, K.; Watanabe, H.; Suresh, D.; Kuo, F.T.; Pisarska, M.D.; Shimada, M. Adiponectin and its receptors modulate granulosa cell and cumulus cell functions, fertility, and early embryo development in the mouse and human. Fertil. Steril. 2012, 98, 471–479.e471. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Ma, X.J.; Wu, X.; Si, S.J.; Li, C.; Yang, P.K.; Li, G.X.; Liu, X.J.; Tian, Y.D.; Kang, X.T. Adiponectin modulates steroid hormone secretion, granulosa cell proliferation and apoptosis via binding its receptors during hens’ high laying period. Poult. Sci. 2021, 100, 101197. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Guo, H.; Li, X.; Yue, L.; Liu, H.; Zhao, L.; Bai, H.; Liu, X.; Wu, X.; Qu, Y. Adiponectin Attenuates Oxygen-Glucose Deprivation-Induced Mitochondrial Oxidative Injury and Apoptosis in Hippocampal HT22 Cells via the JAK2/STAT3 Pathway. Cell Transplant. 2018, 27, 1731–1743. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Cui, W.; Ding, W.; Gu, Y.; Wang, Z.; Fan, W. Globular Adiponectin Attenuated H2O2-Induced Apoptosis in Rat Chondrocytes by Inducing Autophagy Through the AMPK/ mTOR Pathway. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2017, 43, 367–382. [Google Scholar] [CrossRef] [PubMed]
- Pierre, P.; Froment, P.; Nègre, D.; Ramé, C.; Barateau, V.; Chabrolle, C.; Lecomte, P.; Dupont, J. Role of adiponectin receptors, AdipoR1 and AdipoR2, in the steroidogenesis of the human granulosa tumor cell line, KGN. Hum. Reprod. 2009, 24, 2890–2901. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Rudd, M.D.; Hernandez-Gonzalez, I.; Gonzalez-Robayna, I.; Fan, H.Y.; Zeleznik, A.J.; Richards, J.S. FSH and FOXO1 regulate genes in the sterol/steroid and lipid biosynthetic pathways in granulosa cells. Mol. Endocrinol. 2009, 23, 649–661. [Google Scholar] [CrossRef] [PubMed]
- Meng, B.; Cao, Z.; Gai, Y.; Liu, M.; Gao, M.; Chen, M.; Ning, Z.; Luan, X. Effects of recombinant goose adiponectin on steroid hormone secretion in Huoyan geese ovarian granulosa cells. Anim. Reprod. Sci. 2019, 205, 34–43. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Mu, L.; Li, L.; Liang, J.; Zhang, S.; Jia, L.; Yang, X.; Dai, Y.; Zhang, J.; Wang, Y.; et al. Imaging and tracing the pattern of adult ovarian angiogenesis implies a strategy against female reproductive aging. Sci. Adv. 2022, 8, eabi8683. [Google Scholar] [CrossRef] [PubMed]
- Gump, J.M.; Thorburn, A. Autophagy and apoptosis: What is the connection? Trends Cell Biol. 2011, 21, 387–392. [Google Scholar] [CrossRef] [PubMed]
- Shen, M.; Lin, F.; Zhang, J.; Tang, Y.; Chen, W.K.; Liu, H. Involvement of the up-regulated FoxO1 expression in follicular granulosa cell apoptosis induced by oxidative stress. J. Biol. Chem. 2012, 287, 25727–25740. [Google Scholar] [CrossRef] [PubMed]
- Matsuda-Minehata, F.; Inoue, N.; Goto, Y.; Manabe, N. The regulation of ovarian granulosa cell death by pro- and anti-apoptotic molecules. J. Reprod. Dev. 2006, 52, 695–705. [Google Scholar] [CrossRef] [PubMed]
- Manabe, N.; Kimura, Y.; Uchio, K.; Tajima, C.; Matsushita, H.; Nakayama, M.; Sugimoto, M.; Miyamoto, H. Regulatory Mechanisms of Granulosa Cell Apoptosis in Ovarian Follicle Atresia. In Animal Cell Technology: Challenges for the 21st Century: Proceedings of the Joint International Meeting of the Japanese Association for Animal Cell Technology (JAACT) and the European Society for Animal Cell Technology (ESACT) 1998, Kyoto, Japan; Ikura, K., Nagao, M., Masuda, S., Sasaki, R., Eds.; Springer: Dordrecht, The Netherlands, 2002; pp. 343–347. [Google Scholar] [CrossRef]
- Han, S.; Wang, J.; Cui, C.; Yu, C.; Zhang, Y.; Li, D.; Ma, M.; Du, H.; Jiang, X.; Zhu, Q.; et al. Fibromodulin is involved in autophagy and apoptosis of granulosa cells affecting the follicular atresia in chicken. Poult. Sci. 2022, 101, 101524. [Google Scholar] [CrossRef]
- Zhang, J.Q.; Ren, Q.L.; Chen, J.F.; Gao, B.W.; Wang, X.W.; Zhang, Z.J.; Wang, J.; Xu, Z.J.; Xing, B.S. Autophagy Contributes to Oxidative Stress-Induced Apoptosis in Porcine Granulosa Cells. Reprod. Sci. 2021, 28, 2147–2160. [Google Scholar] [CrossRef]
- Glick, D.; Barth, S.; Macleod, K.F. Autophagy: Cellular and molecular mechanisms. J. Pathol. 2010, 221, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Bjørkøy, G.; Lamark, T.; Brech, A.; Outzen, H.; Perander, M.; Overvatn, A.; Stenmark, H.; Johansen, T. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005, 171, 603–614. [Google Scholar] [CrossRef] [PubMed]
- Shao, T.; Ke, H.; Liu, R.; Xu, L.; Han, S.; Zhang, X.; Dang, Y.; Jiao, X.; Li, W.; Chen, Z.J.; et al. Autophagy regulates differentiation of ovarian granulosa cells through degradation of WT1. Autophagy 2022, 18, 1864–1878. [Google Scholar] [CrossRef] [PubMed]
- Kusminski, C.M.; McTernan, P.G.; Schraw, T.; Kos, K.; O’Hare, J.P.; Ahima, R.; Kumar, S.; Scherer, P.E. Adiponectin complexes in human cerebrospinal fluid: Distinct complex distribution from serum. Diabetologia 2007, 50, 634–642. [Google Scholar] [CrossRef] [PubMed]
- Fruebis, J.; Tsao, T.S.; Javorschi, S.; Ebbets-Reed, D.; Erickson, M.R.; Yen, F.T.; Bihain, B.E.; Lodish, H.F. Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc. Natl. Acad. Sci. USA 2001, 98, 2005–2010. [Google Scholar] [CrossRef] [PubMed]
- Nikanfar, S.; Oghbaei, H.; Rastgar Rezaei, Y.; Zarezadeh, R.; Jafari-Gharabaghlou, D.; Nejabati, H.R.; Bahrami, Z.; Bleisinger, N.; Samadi, N.; Fattahi, A.; et al. Role of adipokines in the ovarian function: Oogenesis and steroidogenesis. J. Steroid Biochem. Mol. Biol. 2021, 209, 105852. [Google Scholar] [CrossRef] [PubMed]
- Choubey, M.; Ranjan, A.; Bora, P.S.; Baltazar, F.; Krishna, A. Direct actions of adiponectin on changes in reproductive, metabolic, and anti-oxidative enzymes status in the testis of adult mice. Gen. Comp. Endocrinol. 2019, 279, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Luti, S.; Fiaschi, T.; Magherini, F.; Modesti, P.A.; Piomboni, P.; Semplici, B.; Morgante, G.; Amoresano, A.; Illiano, A.; Pinto, G.; et al. Follicular microenvironment: Oxidative stress and adiponectin correlated with steroids hormones in women undergoing in vitro fertilization. Mol. Reprod. Dev. 2021, 88, 175–184. [Google Scholar] [CrossRef] [PubMed]
- Choubey, M.; Ranjan, A.; Bora, P.S.; Baltazar, F.; Martin, L.J.; Krishna, A. Role of adiponectin as a modulator of testicular function during aging in mice. Biochim. Biophys. Acta. Mol. Basis Dis. 2019, 1865, 413–427. [Google Scholar] [CrossRef] [PubMed]
- Kiezun, M.; Smolinska, N.; Maleszka, A.; Dobrzyn, K.; Szeszko, K.; Kaminski, T. Adiponectin expression in the porcine pituitary during the estrous cycle and its effect on LH and FSH secretion. Am. J. Physiology. Endocrinol. Metab. 2014, 307, E1038–E1046. [Google Scholar] [CrossRef]
- Maillard, V.; Uzbekova, S.; Guignot, F.; Perreau, C.; Ramé, C.; Coyral-Castel, S.; Dupont, J. Effect of adiponectin on bovine granulosa cell steroidogenesis, oocyte maturation and embryo development. Reprod. Biol. Endocrinol. 2010, 8, 23. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Palanivel, R.; Rai, E.; Park, M.; Gabor, T.V.; Scheid, M.P.; Xu, A.; Sweeney, G. Adiponectin stimulates autophagy and reduces oxidative stress to enhance insulin sensitivity during high-fat diet feeding in mice. Diabetes 2015, 64, 36–48. [Google Scholar] [CrossRef] [PubMed]
- Oh, H.J.; Lee, S.; Park, P.H. ER stress contributes to autophagy induction by adiponectin in macrophages: Implication in cell survival and suppression of inflammatory response. Cytokine 2020, 127, 154959. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.J.; Kim, E.H.; Pun, N.T.; Chang, J.H.; Kim, J.A.; Jeong, J.H.; Choi, D.Y.; Kim, S.H.; Park, P.H. Globular Adiponectin Inhibits Lipopolysaccharide-Primed Inflammasomes Activation in Macrophages via Autophagy Induction: The Critical Role of AMPK Signaling. Int. J. Mol. Sci. 2017, 18, 1275. [Google Scholar] [CrossRef] [PubMed]
- Ahlstrom, P.; Rai, E.; Chakma, S.; Cho, H.H.; Rengasamy, P.; Sweeney, G. Adiponectin improves insulin sensitivity via activation of autophagic flux. J. Mol. Endocrinol. 2017, 59, 339–350. [Google Scholar] [CrossRef]
- Nepal, S.; Kim, M.J.; Lee, E.S.; Kim, J.A.; Choi, D.Y.; Sohn, D.H.; Lee, S.H.; Song, K.; Kim, S.H.; Jeong, G.S.; et al. Modulation of Atg5 expression by globular adiponectin contributes to autophagy flux and suppression of ethanol-induced cell death in liver cells. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2014, 68, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Yoon, M.J.; Lee, G.Y.; Chung, J.J.; Ahn, Y.H.; Hong, S.H.; Kim, J.B. Adiponectin increases fatty acid oxidation in skeletal muscle cells by sequential activation of AMP-activated protein kinase, p38 mitogen-activated protein kinase, and peroxisome proliferator-activated receptor alpha. Diabetes 2006, 55, 2562–2570. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Choubey, M.; Bora, P.; Krishna, A. Adiponectin and Chemerin: Contrary Adipokines in Regulating Reproduction and Metabolic Disorders. Reprod. Sci. 2018, 25, 1462–1473. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Cao, Y.; Ren, Y.; Zhao, Y.; Wu, X.; Si, S.; Li, J.; Li, Q.; Zhang, N.; Li, D.; et al. The adiponectin receptor agonist, AdipoRon, promotes reproductive hormone secretion and gonadal development via the hypothalamic-pituitary-gonadal axis in chickens. Poult. Sci. 2023, 102, 102319. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.J.; Lin, X.; Zhong, J.Y.; Li, S.; He, J.Y.; Ni, Y.Q.; Zhan, J.K.; Liu, Y.S. Adiponectin attenuates the premature senescence of vascular smooth muscle cells induced by high glucose through mTOR signaling pathway. Aging Med. 2020, 3, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.E.; Nho, Y.H.; Yun, S.K.; Park, S.M.; Kang, S.; Yeo, H. Caviar Extract and Its Constituent DHA Inhibits UVB-Irradiated Skin Aging by Inducing Adiponectin Production. Int. J. Mol. Sci. 2020, 21, 3383. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Sun, H.; Davis, J.S.; Wang, X.; Huo, L.; Sun, N.; Huang, Q.; Lv, X.; Wang, C.; He, C.; et al. FHL2 deficiency impairs follicular development and fertility by attenuating EGF/EGFR/YAP signaling in ovarian granulosa cells. Cell Death Dis. 2023, 14, 239. [Google Scholar] [CrossRef]
- Dogan, I.; Cumaoglu, A.; Aricioglu, A.; Ekmekci, A. Inhibition of ErbB2 by herceptin reduces viability and survival, induces apoptosis and oxidative stress in Calu-3 cell line. Mol. Cell. Biochem. 2011, 347, 41–51. [Google Scholar] [CrossRef] [PubMed]
- Belmonte, F.; Das, S.; Sysa-Shah, P.; Sivakumaran, V.; Stanley, B.; Guo, X.; Paolocci, N.; Aon, M.A.; Nagane, M.; Kuppusamy, P.; et al. ErbB2 overexpression upregulates antioxidant enzymes, reduces basal levels of reactive oxygen species, and protects against doxorubicin cardiotoxicity. Am. J. Physiology. Heart Circ. Physiol. 2015, 309, H1271–H1280. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Feng, H.; Zhang, Y.; Zhang, J.V.; Wang, X.; Liu, D.; Wang, T.; Li, R.H.W.; Ng, E.H.Y.; Yeung, W.S.B.; et al. Current Understandings of Core Pathways for the Activation of Mammalian Primordial Follicles. Cells 2021, 10, 1491. [Google Scholar] [CrossRef] [PubMed]
- Kulus, J.; Kulus, M.; Kranc, W.; Jopek, K.; Zdun, M.; Józkowiak, M.; Jaśkowski, J.M.; Piotrowska-Kempisty, H.; Bukowska, D.; Antosik, P.; et al. Transcriptomic Profile of New Gene Markers Encoding Proteins Responsible for Structure of Porcine Ovarian Granulosa Cells. Biology 2021, 10, 1214. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.F.; Liu, Y.; Gong, S.N.; Zi, X.D.; Tan, Y.G. Effects of vascular endothelial growth factor (VEGF) on the viability, apoptosis and steroidogenesis of yak (Bos grunniens) granulosa cells. Theriogenology 2023, 207, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Luo, G.; Wang, R.; Zhou, H.; Liu, X. ALDOA protects cardiomyocytes against H/R-induced apoptosis and oxidative stress by regulating the VEGF/Notch 1/Jagged 1 pathway. Mol. Cell. Biochem. 2021, 476, 775–783. [Google Scholar] [CrossRef] [PubMed]
- Abolhassani, A.; Riazi, G.H.; Azizi, E.; Amanpour, S.; Muhammadnejad, S.; Haddadi, M.; Zekri, A.; Shirkoohi, R. FGF10: Type III Epithelial Mesenchymal Transition and Invasion in Breast Cancer Cell Lines. J. Cancer 2014, 5, 537–547. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.Y.; Ho, Y.J.; Chou, H.C.; Liao, E.C.; Tsai, Y.T.; Wei, Y.S.; Lin, L.H.; Lin, M.W.; Wang, Y.S.; Ko, M.L.; et al. TGF-β1 signaling protects retinal ganglion cells from oxidative stress via modulation of the HO-1/Nrf2 pathway. Chem.-Biol. Interact. 2020, 331, 109249. [Google Scholar] [CrossRef] [PubMed]
- Kurakazu, I.; Akasaki, Y.; Tsushima, H.; Sueishi, T.; Toya, M.; Kuwahara, M.; Uchida, T.; Lotz, M.K.; Nakashima, Y. TGFβ1 signaling protects chondrocytes against oxidative stress via FOXO1-autophagy axis. Osteoarthr. Cartil. 2021, 29, 1600–1613. [Google Scholar] [CrossRef] [PubMed]
- Fu, M.Y.; He, Y.J.; Lv, X.; Liu, Z.H.; Shen, Y.; Ye, G.R.; Deng, Y.M.; Shu, J.C. Transforming growth factor-β1 reduces apoptosis via autophagy activation in hepatic stellate cells. Mol. Med. Rep. 2014, 10, 1282–1288. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Liu, H.; Jiang, L.; Rui, B.; Mei, J.; Xiao, H. miR-26 Induces Apoptosis and Inhibits Autophagy in Non-small Cell Lung Cancer Cells by Suppressing TGF-β1-JNK Signaling Pathway. Front. Pharmacol. 2018, 9, 1509. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Tang, H.; Yuan, X.; Ran, Q.; Wang, X.; Song, Q.; Zhang, L.; Qiu, Y.; Wang, X. TGF-β3 Promotes MUC5AC Hyper-Expression by Modulating Autophagy Pathway in Airway Epithelium. EBioMedicine 2018, 33, 242–252. [Google Scholar] [CrossRef] [PubMed]
- Del Castillo, G.; Murillo, M.M.; Alvarez-Barrientos, A.; Bertran, E.; Fernández, M.; Sánchez, A.; Fabregat, I. Autocrine production of TGF-beta confers resistance to apoptosis after an epithelial-mesenchymal transition process in hepatocytes: Role of EGF receptor ligands. Exp. Cell Res. 2006, 312, 2860–2871. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Zhang, Y.; Zhang, Z.; Jin, Y. The protection of MSCs from apoptosis in nerve regeneration by TGFβ1 through reducing inflammation and promoting VEGF-dependent angiogenesis. Biomaterials 2012, 33, 4277–4287. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.L.; Yu, T.; Yan, Q.C.; Wang, W.; Meng, N.; Li, X.J.; Luo, Y.H. AGEs Promote Oxidative Stress and Induce Apoptosis in Retinal Pigmented Epithelium Cells RAGE-dependently. J. Mol. Neurosci. MN 2015, 56, 449–460. [Google Scholar] [CrossRef] [PubMed]
- Waghela, B.N.; Vaidya, F.U.; Ranjan, K.; Chhipa, A.S.; Tiwari, B.S.; Pathak, C. AGE-RAGE synergy influences programmed cell death signaling to promote cancer. Mol. Cell. Biochem. 2021, 476, 585–598. [Google Scholar] [CrossRef] [PubMed]
- Hagiwara, S.; Sourris, K.; Ziemann, M.; Tieqiao, W.; Mohan, M.; McClelland, A.D.; Brennan, E.; Forbes, J.; Coughlan, M.; Harcourt, B.; et al. RAGE Deletion Confers Renoprotection by Reducing Responsiveness to Transforming Growth Factor-β and Increasing Resistance to Apoptosis. Diabetes 2018, 67, 960–973. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, A.B.; Evans, A.J.; Perry, M.M.; Davidson, M.H. A method for separating the granulosa cells, the basal lamina and the theca of the preovulatory ovarian follicle of the domestic fowl (Gallus domesticus). J. Reprod. Fertil. 1977, 50, 179–181. [Google Scholar] [CrossRef] [PubMed]
- Kang, B.; Jiang, D.; He, H.; Ma, R.; Chen, Z.; Yi, Z. Effect of Oaz1 overexpression on goose ovarian granulosa cells. Amino Acids 2017, 49, 1123–1132. [Google Scholar] [CrossRef] [PubMed]
Genes | Sequences (5′→3′) | Accession No. | Size (bp) |
---|---|---|---|
ADPN | FP: AACGAGCAGAACCACTAC RP: CGCCTTGTCCTTCTTGTA | KP993199 | 132 |
AdipoR1 | FP: AAGTTGGATTATTCAGGAA RP: AATGGAGAGGTAGATGAG | KP993200 | 108 |
AdipoR2 | FP: ATACTGAACAAGGCCACTATTT RP: CACCTGAATGCCTTACTCTC | KP993201 | 123 |
p53 | FP: AGGAGGAGAACTTCCGCAAGAGG RP: CGTCGTTGATCTCCTTCAGCATCTC | XM_038171819.1 | 97 |
Caspase-3 | FP: AGTGGACCAGATGAAATGAC RP: AGACTGAATAAACCAGGAGC | XM_013179825 | 126 |
Bax | FP: CTTCTCGGGTTTCTTGAGG RP: AACGCAGCAGGTGTAGGA | KY788660 | 200 |
Bcl-2 | FP: TGACCGAGTACCTGAACCG RP: GCTCCCACCAGAACCAAA | XM_013187395 | 154 |
ATG5 | FP: GATGAAATAACTGAAAGGGAAGC RP: TGAAGATCAAAGAGCAAACCAA | NM_001006409.1 | 124 |
ATG7 | FP: CGACCAGTATGAACGAGA RP: CTGATGTAATAAAGTTAGACCC | XM_048046141 | 100 |
Beclin1 | FP: GCACGCCCTCGCTAACA RP: GCAGTCCAAGAAAGCCACC | XM_048051864 | 184 |
p62 | FP: GGTGGTGGGTGCTAGATTCAAGTG RP: TGTGCTCCTTGTGGATGCCTTTAC | XM_048057319.1 | 89 |
LC3B | FP: TGCTAACCAAGCCTTCTTCCTC RP: TCCTGCGAGGCATAAACCAT | NM_001364358 | 129 |
β-actin | FP: ATTGTCCACCGCAAATGCTTC RP: AAATAAAGCCATGCCAATCTCGTC | M26111 | 113 |
Name | Sequences (5′-3′) |
---|---|
siRNA-ADPN | FP: GGGACAACAACGGUGUCUATT RP: UAGACACCGUUGUUGUCCCTT |
siRNA-NC | FP: UUCUCCGAACGUGUCACGUTT RP: ACGUGACACGUUCGGAGAATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, Y.; Qiu, Y.; Wang, Q.; Gao, M.; Cao, Z.; Luan, X. ADPN Regulates Oxidative Stress-Induced Follicular Atresia in Geese by Modulating Granulosa Cell Apoptosis and Autophagy. Int. J. Mol. Sci. 2024, 25, 5400. https://doi.org/10.3390/ijms25105400
Zheng Y, Qiu Y, Wang Q, Gao M, Cao Z, Luan X. ADPN Regulates Oxidative Stress-Induced Follicular Atresia in Geese by Modulating Granulosa Cell Apoptosis and Autophagy. International Journal of Molecular Sciences. 2024; 25(10):5400. https://doi.org/10.3390/ijms25105400
Chicago/Turabian StyleZheng, Yan, Yunqiao Qiu, Qianhui Wang, Ming Gao, Zhongzan Cao, and Xinhong Luan. 2024. "ADPN Regulates Oxidative Stress-Induced Follicular Atresia in Geese by Modulating Granulosa Cell Apoptosis and Autophagy" International Journal of Molecular Sciences 25, no. 10: 5400. https://doi.org/10.3390/ijms25105400