Tamoxifen Activates Transcription Factor EB and Triggers Protective Autophagy in Breast Cancer Cells by Inducing Lysosomal Calcium Release: A Gateway to the Onset of Endocrine Resistance
Abstract
:1. Introduction
2. Results
2.1. TFEB and Some of Its Target Genes Are Overexpressed in MCF7-TamR Cells
2.2. Subcellular Localization of TFEB in MCF7 and MCF7-TamR Cells
2.3. Tam Induces an Increase in [Ca2+]i in MCF7 Cells
2.4. Resting Ca2+ Levels Are Larger in MCF7-TamR Cells
2.5. Pharmacological Inhibition of Lysosomal Ca2+ Channels Affects Tam-Induced Nuclear Relocation of TFEB
2.6. Silencing of TFEB, Yet Not of TFE3, Partly Sensitizes MCF7-TamR Cells to Tam
2.7. Generation and Growth Characteristics of Additional Tam-Resistant Luminal A Breast Cancer Cell Lines
2.8. Effect of Tam on the Subcellular Localization of TFEB in Parental and Tam-Resistant MDA-MB-415, T47D and ZR-75-1 Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Cell Cultures
4.3. Cell Growth and Viability Assay
4.4. Immunofluorescence
4.5. Transient and Stable Transfection of TFEB-GFP
4.6. Determination of Nuclear Localization of TFEB
4.7. Analysis of the Effects of Starvation or Tam on the Subcellular Localization of TFEB and Washout Experiments in TFEB-GFP-Expressing Breast Cancer Cell Lines
4.8. Solutions for Ca2+ Recordings
4.9. Intracellular Ca2+ Imaging
4.10. Analysis of Differential Gene Expression in MCF7 and MCF7-TamR Cells
4.11. Expression of TFEB Target Genes
4.12. Western Blotting
4.13. Confocal Microscopy
4.14. Downregulation of TFEB or TFE3
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Cancer Statistics for the Year 2020: An Overview. Int. J. Cancer 2021, 149, 778–789. [Google Scholar] [CrossRef] [PubMed]
- Harbeck, N.; Penault-Llorca, F.; Cortes, J.; Gnant, M.; Houssami, N.; Poortmans, P.; Ruddy, K.; Tsang, J.; Cardoso, F. Breast Cancer. Nat. Rev. Dis. Prim. 2019, 5, 66. [Google Scholar] [CrossRef] [PubMed]
- Höller, A.; Nguyen-Sträuli, B.D.; Frauchiger-Heuer, H.; Ring, A. Diagnostic and Prognostic Biomarkers of Luminal Breast Cancer: Where Are We Now? Breast Cancer Targets Ther. 2023, 15, 525–540. [Google Scholar] [CrossRef] [PubMed]
- Slanař, O.; Hronová, K.; Bartošová, O.; Šíma, M. Recent Advances in the Personalized Treatment of Estrogen Receptor-Positive Breast Cancer with Tamoxifen: A Focus on Pharmacogenomics. Expert Opin. Drug Metab. Toxicol. 2021, 17, 307–321. [Google Scholar] [CrossRef] [PubMed]
- de Pinho, I.S.; Abreu, C.; Gomes, I.; Casimiro, S.; Pacheco, T.R.; de Sousa, R.T.; Costa, L. Exploring New Pathways in Endocrine-Resistant Breast Cancer. Explor. Target. Anti-Tumor Ther. 2022, 3, 337–361. [Google Scholar] [CrossRef] [PubMed]
- Saatci, O.; Huynh-Dam, K.-T.; Sahin, O. Endocrine Resistance in Breast Cancer: From Molecular Mechanisms to Therapeutic Strategies. J. Mol. Med. 2021, 99, 1691–1710. [Google Scholar] [CrossRef] [PubMed]
- Chien, T.-J. A Review of the Endocrine Resistance in Hormone-Positive Breast Cancer. Am. J. Cancer Res. 2021, 11, 3813–3831. [Google Scholar]
- Shintani, T.; Klionsky, D.J. Autophagy in Health and Disease: A Double-Edged Sword. Science 2004, 306, 990–995. [Google Scholar] [CrossRef]
- Komarla, A.; Dufresne, S.; Towers, C.G. Recent Advances in the Role of Autophagy in Endocrine-Dependent Tumors. Endocr. Rev. 2023, 44, 629–646. [Google Scholar] [CrossRef]
- Actis, C.; Muzio, G.; Autelli, R. Autophagy Triggers Tamoxifen Resistance in Human Breast Cancer Cells by Preventing Drug-Induced Lysosomal Damage. Cancers 2021, 13, 1252. [Google Scholar] [CrossRef]
- Bursch, W.; Ellinger, A.; Kienzl, H.; Török, L.; Pandey, S.; Sikorska, M.; Walker, R.; Hermann, R.S. Active Cell Death Induced by the Anti-Estrogens Tamoxifen and ICI 164 384 in Human Mammary Carcinoma Cells (MCF-7) in Culture: The Role of Autophagy. Carcinogenesis 1996, 17, 1595–1607. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.-T.; Sun, G.-H.; Cha, T.-L.; Kao, C.-C.; Chang, S.-Y.; Kuo, S.-C.; Way, T.-D. CSC-3436 Switched Tamoxifen-Induced Autophagy to Apoptosis through the Inhibition of AMPK/MTOR Pathway. J. Biomed. Sci. 2016, 23, 60. [Google Scholar] [CrossRef] [PubMed]
- Soldati, C.; Lopez-Fabuel, I.; Wanderlingh, L.G.; Garcia-Macia, M.; Monfregola, J.; Esposito, A.; Napolitano, G.; Guevara-Ferrer, M.; Scotto Rosato, A.; Krogsaeter, E.K.; et al. Repurposing of Tamoxifen Ameliorates CLN3 and CLN7 Disease Phenotype. EMBO Mol. Med. 2021, 13, e13742. [Google Scholar] [CrossRef] [PubMed]
- Napolitano, G.; Ballabio, A. TFEB at a Glance. J. Cell Sci. 2016, 129, 2475–2481. [Google Scholar] [CrossRef] [PubMed]
- Martina, J.A.; Diab, H.I.; Li, H.; Puertollano, R. Novel Roles for the MiTF/TFE Family of Transcription Factors in Organelle Biogenesis, Nutrient Sensing, and Energy Homeostasis. Cell. Mol. Life Sci. 2014, 71, 2483–2497. [Google Scholar] [CrossRef]
- Sardiello, M.; Palmieri, M.; di Ronza, A.; Medina, D.L.; Valenza, M.; Gennarino, V.A.; Di Malta, C.; Donaudy, F.; Embrione, V.; Polishchuk, R.S.; et al. A Gene Network Regulating Lysosomal Biogenesis and Function. Science 2009, 325, 473–477. [Google Scholar] [CrossRef]
- Martina, J.A.; Chen, Y.; Gucek, M.; Puertollano, R. MTORC1 Functions as a Transcriptional Regulator of Autophagy by Preventing Nuclear Transport of TFEB. Autophagy 2012, 8, 903–914. [Google Scholar] [CrossRef]
- Roczniak-Ferguson, A.; Petit, C.S.; Froehlich, F.; Qian, S.; Ky, J.; Angarola, B.; Walther, T.C.; Ferguson, S.M. The Transcription Factor TFEB Links MTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Sci. Signal. 2012, 5, ra42. [Google Scholar] [CrossRef]
- Puertollano, R.; Ferguson, S.M.; Brugarolas, J.; Ballabio, A. The Complex Relationship between TFEB Transcription Factor Phosphorylation and Subcellular Localization. EMBO J. 2018, 37, e98804. [Google Scholar] [CrossRef]
- Medina, D.L.; Di Paola, S.; Peluso, I.; Armani, A.; De Stefani, D.; Venditti, R.; Montefusco, S.; Scotto-Rosato, A.; Prezioso, C.; Forrester, A.; et al. Lysosomal Calcium Signalling Regulates Autophagy through Calcineurin and TFEB. Nat. Cell Biol. 2015, 17, 288–299. [Google Scholar] [CrossRef]
- Li, P.; Gu, M.; Xu, H. Lysosomal Ion Channels as Decoders of Cellular Signals. Trends Biochem. Sci. 2019, 44, 110–124. [Google Scholar] [CrossRef] [PubMed]
- Faris, P.; Shekha, M.; Montagna, D.; Guerra, G.; Moccia, F. Endolysosomal Ca2+ Signalling and Cancer Hallmarks: Two-Pore Channels on the Move, TRPML1 Lags Behind! Cancers 2018, 11, 27. [Google Scholar] [CrossRef] [PubMed]
- Höglinger, D.; Haberkant, P.; Aguilera-Romero, A.; Riezman, H.; Porter, F.D.; Platt, F.M.; Galione, A.; Schultz, C. Intracellular Sphingosine Releases Calcium from Lysosomes. Elife 2015, 4, e10616. [Google Scholar] [CrossRef] [PubMed]
- Malek, M.; Wawrzyniak, A.M.; Ebner, M.; Puchkov, D.; Haucke, V. Inositol Triphosphate–Triggered Calcium Release from the Endoplasmic Reticulum Induces Lysosome Biogenesis via TFEB/TFE3. J. Biol. Chem. 2022, 298, 101740. [Google Scholar] [CrossRef] [PubMed]
- Molina, L.; Bustamante, F.; Ortloff, A.; Ramos, I.; Ehrenfeld, P.; Figueroa, C.D. Continuous Exposure of Breast Cancer Cells to Tamoxifen Upregulates GPER-1 and Increases Cell Proliferation. Front. Endocrinol. 2020, 11, 563165. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Couldwell, W.T.; Song, H.; Takano, T.; Lin, J.H.C.; Nedergaard, M. Tamoxifen-Induced Enhancement of Calcium Signaling in Glioma and MCF-7 Breast Cancer Cells. Cancer Res. 2000, 60, 5395–5400. [Google Scholar] [PubMed]
- Medina, D.L.; Ballabio, A. Lysosomal Calcium Regulates Autophagy. Autophagy 2015, 11, 970–971. [Google Scholar] [CrossRef]
- Palmieri, M.; Impey, S.; Kang, H.; di Ronza, A.; Pelz, C.; Sardiello, M.; Ballabio, A. Characterization of the CLEAR Network Reveals an Integrated Control of Cellular Clearance Pathways. Hum. Mol. Genet. 2011, 20, 3852–3866. [Google Scholar] [CrossRef]
- Napolitano, G.; Esposito, A.; Choi, H.; Matarese, M.; Benedetti, V.; Di Malta, C.; Monfregola, J.; Medina, D.L.; Lippincott-Schwartz, J.; Ballabio, A. MTOR-Dependent Phosphorylation Controls TFEB Nuclear Export. Nat. Commun. 2018, 9, 3312. [Google Scholar] [CrossRef]
- Mound, A.; Vautrin-Glabik, A.; Foulon, A.; Botia, B.; Hague, F.; Parys, J.B.; Ouadid-Ahidouch, H.; Rodat-Despoix, L. Downregulation of Type 3 Inositol (1,4,5)-Trisphosphate Receptor Decreases Breast Cancer Cell Migration through an Oscillatory Ca2+ Signal. Oncotarget 2017, 8, 72324–72341. [Google Scholar] [CrossRef]
- Liu, G.; Honisch, S.; Liu, G.; Schmidt, S.; Alkahtani, S.; AlKahtane, A.A.; Stournaras, C.; Lang, F. Up-Regulation of Orai1 Expression and Store Operated Ca2+ Entry Following Activation of Membrane Androgen Receptors in MCF-7 Breast Tumor Cells. BMC Cancer 2015, 15, 995. [Google Scholar] [CrossRef] [PubMed]
- Vismara, M.; Negri, S.; Scolari, F.; Brunetti, V.; Trivigno, S.M.G.; Faris, P.; Galgano, L.; Soda, T.; Berra-Romani, R.; Canobbio, I.; et al. Platelet-Derived Extracellular Vesicles Stimulate Migration through Partial Remodelling of the Ca2+ Handling Machinery in MDA-MB-231 Breast Cancer Cells. Cells 2022, 11, 3120. [Google Scholar] [CrossRef] [PubMed]
- Zuccolo, E.; Laforenza, U.; Ferulli, F.; Pellavio, G.; Scarpellino, G.; Tanzi, M.; Turin, I.; Faris, P.; Lucariello, A.; Maestri, M.; et al. Stim and Orai Mediate Constitutive Ca2+ Entry and Control Endoplasmic Reticulum Ca2+ Refilling in Primary Cultures of Colorectal Carcinoma Cells. Oncotarget 2018, 9, 31098–31119. [Google Scholar] [CrossRef] [PubMed]
- Ariazi, E.A.; Brailoiu, E.; Yerrum, S.; Shupp, H.A.; Slifker, M.J.; Cunliffe, H.E.; Black, M.A.; Donato, A.L.; Arterburn, J.B.; Oprea, T.I.; et al. The G Protein-Coupled Receptor GPR30 Inhibits Proliferation of Estrogen Receptor-Positive Breast Cancer Cells. Cancer Res. 2010, 70, 1184–1194. [Google Scholar] [CrossRef] [PubMed]
- Vismara, M.; Zarà, M.; Negri, S.; Canino, J.; Canobbio, I.; Barbieri, S.S.; Moccia, F.; Torti, M.; Guidetti, G.F. Platelet-Derived Extracellular Vesicles Regulate Cell Cycle Progression and Cell Migration in Breast Cancer Cells. Biochim. Biophys. Acta Mol. Cell Res. 2021, 1868, 118886. [Google Scholar] [CrossRef] [PubMed]
- Szatkowski, C.; Parys, J.B.; Ouadid-Ahidouch, H.; Matifat, F. Inositol 1,4,5-Trisphosphate-Induced Ca2+ Signalling Is Involved in Estradiol-Induced Breast Cancer Epithelial Cell Growth. Mol. Cancer 2010, 9, 156. [Google Scholar] [CrossRef] [PubMed]
- Faris, P.; Pellavio, G.; Ferulli, F.; Di Nezza, F.; Shekha, M.; Lim, D.; Maestri, M.; Guerra, G.; Ambrosone, L.; Pedrazzoli, P.; et al. Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Induces Intracellular Ca2+ Release through the Two-Pore Channel TPC1 in Metastatic Colorectal Cancer Cells. Cancers 2019, 11, 542. [Google Scholar] [CrossRef]
- Kilpatrick, B.S.; Yates, E.; Grimm, C.; Schapira, A.H.; Patel, S. Endo-Lysosomal TRP Mucolipin-1 Channels Trigger Global ER Ca2+ Release and Ca2+ Influx. J. Cell Sci. 2016, 129, 3859–3867. [Google Scholar] [CrossRef]
- Scorza, S.I.; Milano, S.; Saponara, I.; Certini, M.; De Zio, R.; Mola, M.G.; Procino, G.; Carmosino, M.; Moccia, F.; Svelto, M.; et al. TRPML1-Induced Lysosomal Ca2+ Signals Activate AQP2 Translocation and Water Flux in Renal Collecting Duct Cells. Int. J. Mol. Sci. 2023, 24, 1647. [Google Scholar] [CrossRef]
- So, C.L.; Saunus, J.M.; Roberts-Thomson, S.J.; Monteith, G.R. Calcium Signalling and Breast Cancer. Semin. Cell Dev. Biol. 2019, 94, 74–83. [Google Scholar] [CrossRef]
- Haque, M.M.; Desai, K.V. Pathways to Endocrine Therapy Resistance in Breast Cancer. Front. Endocrinol. 2019, 10, 573. [Google Scholar] [CrossRef] [PubMed]
- Cook, K.L.; Shajahan, A.N.; Clarke, R. Autophagy and Endocrine Resistance in Breast Cancer. Expert Rev. Anticancer Ther. 2011, 11, 1283–1294. [Google Scholar] [CrossRef] [PubMed]
- Schoenlein, P.V.; Periyasamy-Thandavan, S.; Samaddar, J.S.; Jackson, W.H.; Barrett, J.T. Autophagy Facilitates the Progression of ERα-Positive Breast Cancer Cells to Antiestrogen Resistance. Autophagy 2009, 5, 400–403. [Google Scholar] [CrossRef] [PubMed]
- Samaddar, J.S.; Gaddy, V.T.; Duplantier, J.; Thandavan, S.P.; Shah, M.; Smith, M.J.; Browning, D.; Rawson, J.; Smith, S.B.; Barrett, J.T.; et al. A Role for Macroautophagy in Protection against 4-Hydroxytamoxifen-Induced Cell Death and the Development of Antiestrogen Resistance. Mol. Cancer Ther. 2008, 7, 2977–2987. [Google Scholar] [CrossRef] [PubMed]
- Torres-López, L.; Maycotte, P.; Liñán-Rico, A.; Liñán-Rico, L.; Donis-Maturano, L.; Delgado-Enciso, I.; Meza-Robles, C.; Vásquez-Jiménez, C.; Hernández-Cruz, A.; Dobrovinskaya, O. Tamoxifen Induces Toxicity, Causes Autophagy, and Partially Reverses Dexamethasone Resistance in Jurkat T Cells. J. Leukoc. Biol. 2019, 105, 983–998. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Zan, L. Knockdown of ATG4A Inhibits Breast Cancer Progression and Promotes Tamoxifen Chemosensitivity by Suppressing Autophagy. Mol. Med. Rep. 2022, 25, 101. [Google Scholar] [CrossRef] [PubMed]
- Jia, J.; Abudu, Y.P.; Claude-Taupin, A.; Gu, Y.; Kumar, S.; Choi, S.W.; Peters, R.; Mudd, M.H.; Allers, L.; Salemi, M.; et al. Galectins Control MTOR in Response to Endomembrane Damage. Mol. Cell 2018, 70, 120–135.e8. [Google Scholar] [CrossRef]
- Settembre, C.; De Cegli, R.; Mansueto, G.; Saha, P.K.; Vetrini, F.; Visvikis, O.; Huynh, T.; Carissimo, A.; Palmer, D.; Klisch, T.J.; et al. TFEB Controls Cellular Lipid Metabolism through a Starvation-Induced Autoregulatory Loop. Nat. Cell Biol. 2013, 15, 647–658. [Google Scholar] [CrossRef]
- Tsunemi, T.; Ashe, T.D.; Morrison, B.E.; Soriano, K.R.; Au, J.; Roque, R.A.V.; Lazarowski, E.R.; Damian, V.A.; Masliah, E.; La Spada, A.R. PGC-1α Rescues Huntington’s Disease Proteotoxicity by Preventing Oxidative Stress and Promoting TFEB Function. Sci. Transl. Med. 2012, 4, 142ra97. [Google Scholar] [CrossRef]
- Curnock, R.; Yalci, K.; Palmfeldt, J.; Jäättelä, M.; Liu, B.; Carroll, B. TFEB-Dependent Lysosome Biogenesis Is Required for Senescence. EMBO J. 2023, 42, e111241. [Google Scholar] [CrossRef]
- Wang, X.; Zhao, H.F.; Zhang, G.J. Mechanism of Cytosol Phospholipase C and Sphingomyelinase-Induced Lysosome Destabilization. Biochimie 2006, 88, 913–922. [Google Scholar] [CrossRef] [PubMed]
- Tan, A.; Prasad, R.; Lee, C.; Jho, E. hoon Past, Present, and Future Perspectives of Transcription Factor EB (TFEB): Mechanisms of Regulation and Association with Disease. Cell Death Differ. 2022, 29, 1433–1449. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Cheng, X.; Yu, L.; Yang, J.; Calvo, R.; Patnaik, S.; Hu, X.; Gao, Q.; Yang, M.; Lawas, M.; et al. MCOLN1 Is a ROS Sensor in Lysosomes That Regulates Autophagy. Nat. Commun. 2016, 7, 12109. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Chen, W.; Gao, Q.; Yang, J.; Yan, X.; Zhao, H.; Su, L.; Yang, M.; Gao, C.; Yao, Y.; et al. Rapamycin Directly Activates Lysosomal Mucolipin TRP Channels Independent of MTOR. PLoS Biol. 2019, 17, e3000252. [Google Scholar] [CrossRef]
- Yu, L.; Zhang, X.; Yang, Y.; Li, D.; Tang, K.; Zhao, Z.; He, W.; Wang, C.; Sahoo, N.; Converso-Baran, K.; et al. Small-Molecule Activation of Lysosomal TRP Channels Ameliorates Duchenne Muscular Dystrophy in Mouse Models. Sci. Adv. 2020, 6, eaaz2736. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Arozena, A.A.; Adachi, H.; Adams, C.M.; Adams, P.D.; Adeli, K.; et al. Guidelines for the Use and Interpretation of Assays for Monitoring Autophagy, 3rd ed.; Taylor and Francis Inc.: Abingdon, UK, 2016; Volume 12, pp. 1–222. [Google Scholar]
- Urban, N.; Leonhardt, M.; Schaefer, M. Multiplex G Protein-Coupled Receptor Screen Reveals Reliably Acting Agonists and a Gq-Phospholipase C Coupling Mode of GPR30/GPER1. Mol. Pharmacol. 2023, 103, 48–62. [Google Scholar] [CrossRef]
- Berridge, M.J.; Bootman, M.D.; Roderick, H.L. Calcium Signalling: Dynamics, Homeostasis and Remodelling. Nat. Rev. Mol. Cell Biol. 2003, 4, 517–529. [Google Scholar] [CrossRef]
- Guse, A.H. Enzymology of Ca2+-Mobilizing Second Messengers Derived from NAD: From NAD Glycohydrolases to (Dual) NADPH Oxidases. Cells 2023, 12, 675. [Google Scholar] [CrossRef]
- Rivero-Ríos, P.; Weisman, L.S. Roles of PIKfyve in Multiple Cellular Pathways. Curr. Opin. Cell Biol. 2022, 76, 102086. [Google Scholar] [CrossRef]
- Lewis, A.M.; Aley, P.K.; Roomi, A.; Thomas, J.M.; Masgrau, R.; Garnham, C.; Shipman, K.; Paramore, C.; Bloor-Young, D.; Sanders, L.E.L.; et al. β-Adrenergic Receptor Signaling Increases NAADP and CADPR Levels in the Heart. Biochem. Biophys. Res. Commun. 2012, 427, 326–329. [Google Scholar] [CrossRef]
- Zhu, Z.-D.; Yu, T.; Liu, H.-J.; Jin, J.; He, J. SOCE Induced Calcium Overload Regulates Autophagy in Acute Pancreatitis via Calcineurin Activation. Cell Death Dis. 2018, 9, 50. [Google Scholar] [CrossRef] [PubMed]
- Sallinger, M.; Tiffner, A.; Schmidt, T.; Bonhenry, D.; Waldherr, L.; Frischauf, I.; Lunz, V.; Derler, I.; Schober, R.; Schindl, R. Luminal STIM1 Mutants That Cause Tubular Aggregate Myopathy Promote Autophagic Processes. Int. J. Mol. Sci. 2020, 21, 4410. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.B.; Quinn, J.A.; Graeber, C.T.; Filardo, E.J. Down-Modulation of the G-Protein-Coupled Estrogen Receptor, GPER, from the Cell Surface Occurs via a Trans-Golgi-Proteasome Pathway. J. Biol. Chem. 2011, 286, 22441–22455. [Google Scholar] [CrossRef] [PubMed]
- Aits, S.; Jäättelä, M. Lysosomal Cell Death at a Glance. J. Cell Sci. 2013, 126, 1905–1912. [Google Scholar] [CrossRef] [PubMed]
- Lefort, S.; Joffre, C.; Kieffer, Y.; Givel, A.-M.; Bourachot, B.; Zago, G.; Bieche, I.; Dubois, T.; Meseure, D.; Vincent-Salomon, A.; et al. Inhibition of Autophagy as a New Means of Improving Chemotherapy Efficiency in High-LC3B Triple-Negative Breast Cancers. Autophagy 2014, 10, 2122–2142. [Google Scholar] [CrossRef] [PubMed]
- Levy, J.M.M.; Towers, C.G.; Thorburn, A. Targeting Autophagy in Cancer. Nat. Rev. Cancer 2017, 17, 528–542. [Google Scholar] [CrossRef] [PubMed]
- Mulcahy Levy, J.M.; Thorburn, A. Autophagy in Cancer: Moving from Understanding Mechanism to Improving Therapy Responses in Patients. Cell Death Differ. 2020, 27, 843–857. [Google Scholar] [CrossRef]
- Skelding, K.A.; Barry, D.L.; Theron, D.Z.; Lincz, L.F. Targeting the Two-Pore Channel 2 in Cancer Progression and Metastasis. Explor. Target. Anti-Tumor Ther. 2022, 3, 62–89. [Google Scholar] [CrossRef]
- Negri, S.; Faris, P.; Moccia, F. Endolysosomal Ca2+ Signaling in Cardiovascular Health and Disease. Int. Rev. Cell Mol. Biol. 2021, 363, 203–269. [Google Scholar] [CrossRef]
- Moccia, F.; Negri, S.; Faris, P.; Perna, A.; De Luca, A.; Soda, T.; Berra-Romani, R.; Guerra, G. Targeting Endolysosomal Two-Pore Channels to Treat Cardiovascular Disorders in the Novel COronaVIrus Disease 2019. Front. Physiol. 2021, 12, 629119. [Google Scholar] [CrossRef]
- Nguyen, O.N.P.; Grimm, C.; Schneider, L.S.; Chao, Y.-K.; Atzberger, C.; Bartel, K.; Watermann, A.; Ulrich, M.; Mayr, D.; Wahl-Schott, C.; et al. Two-Pore Channel Function Is Crucial for the Migration of Invasive Cancer Cells. Cancer Res. 2017, 77, 1427–1438. [Google Scholar] [CrossRef] [PubMed]
- Favia, A.; Pafumi, I.; Desideri, M.; Padula, F.; Montesano, C.; Passeri, D.; Nicoletti, C.; Orlandi, A.; Del Bufalo, D.; Sergi, M.; et al. NAADP-Dependent Ca(2+) Signaling Controls Melanoma Progression, Metastatic Dissemination and Neoangiogenesis. Sci. Rep. 2016, 6, 18925. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Zhang, Y.; Alharbi, A.; Hanbashi, A.; Alhoshani, A.; Parrington, J. Targeting Two-Pore Channels: Current Progress and Future Challenges. Trends Pharmacol. Sci. 2020, 41, 582–594. [Google Scholar] [CrossRef] [PubMed]
- Rühl, P.; Rosato, A.S.; Urban, N.; Gerndt, S.; Tang, R.; Abrahamian, C.; Leser, C.; Sheng, J.; Jha, A.; Vollmer, G.; et al. Estradiol Analogs Attenuate Autophagy, Cell Migration and Invasion by Direct and Selective Inhibition of TRPML1, Independent of Estrogen Receptors. Sci. Rep. 2021, 11, 8313. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Dong, X.-P. Endolysosomal TRPMLs in Cancer. Biomolecules 2021, 11, 65. [Google Scholar] [CrossRef] [PubMed]
- Misko, A.; Wood, L.; Kiselyov, K.; Slaugenhaupt, S.; Grishchuk, Y. Progress in Elucidating Pathophysiology of Mucolipidosis IV. Neurosci. Lett. 2021, 755, 135944. [Google Scholar] [CrossRef]
- Kendall, R.L.; Holian, A. The Role of Lysosomal Ion Channels in Lysosome Dysfunction. Inhal. Toxicol. 2021, 33, 41–54. [Google Scholar] [CrossRef]
- Spix, B.; Chao, Y.-K.; Abrahamian, C.; Chen, C.-C.; Grimm, C. TRPML Cation Channels in Inflammation and Immunity. Front. Immunol. 2020, 11, 225. [Google Scholar] [CrossRef]
- De Chaumont, F.; Dallongeville, S.; Chenouard, N.; Hervé, N.; Pop, S.; Provoost, T.; Meas-Yedid, V.; Pankajakshan, P.; Lecomte, T.; Le Montagner, Y.; et al. Icy: An Open Bioimage Informatics Platform for Extended Reproducible Research. Nat. Methods 2012, 9, 690–696. [Google Scholar] [CrossRef]
- Wolff, B.; Sanglier, J.J.; Wang, Y. Leptomycin B Is an Inhibitor of Nuclear Export: Inhibition of Nucleo-Cytoplasmic Translocation of the Human Immunodeficiency Virus Type 1 (HIV-1) Rev Protein and Rev-Dependent MRNA. Chem. Biol. 1997, 4, 139–147. [Google Scholar] [CrossRef]
Target | Forward | Reverse |
---|---|---|
Hs_ATP6V1C1 | CCCGAGGAGTCTGCTGGTTC | AAGTGTGCCTCCCCTTCGAC |
Hs_CTSB | TGGAAGCCATCTCTGACCGG | TACAGCCGTCCCCACACATG |
Hs_HIF1α | CAGCTATTTGCGTGTGAGGA | CCTCATGGTCACATGGATGA |
Hs_TFE3 | TGCTGTTGGAGGAGCGCA | CTTGAGCGAAGGGGTAAGGG |
Hs_TFEB | GTCCGAGACCTATGGGAACA | TCGTCCAGACGCATAATGTTG |
Hs_GAPDH | CGGGAAACTGTGGCGTGATG | ATGCCAGTGAGCTTCCCGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Boretto, C.; Actis, C.; Faris, P.; Cordero, F.; Beccuti, M.; Ferrero, G.; Muzio, G.; Moccia, F.; Autelli, R. Tamoxifen Activates Transcription Factor EB and Triggers Protective Autophagy in Breast Cancer Cells by Inducing Lysosomal Calcium Release: A Gateway to the Onset of Endocrine Resistance. Int. J. Mol. Sci. 2024, 25, 458. https://doi.org/10.3390/ijms25010458
Boretto C, Actis C, Faris P, Cordero F, Beccuti M, Ferrero G, Muzio G, Moccia F, Autelli R. Tamoxifen Activates Transcription Factor EB and Triggers Protective Autophagy in Breast Cancer Cells by Inducing Lysosomal Calcium Release: A Gateway to the Onset of Endocrine Resistance. International Journal of Molecular Sciences. 2024; 25(1):458. https://doi.org/10.3390/ijms25010458
Chicago/Turabian StyleBoretto, Cecilia, Chiara Actis, Pawan Faris, Francesca Cordero, Marco Beccuti, Giulio Ferrero, Giuliana Muzio, Francesco Moccia, and Riccardo Autelli. 2024. "Tamoxifen Activates Transcription Factor EB and Triggers Protective Autophagy in Breast Cancer Cells by Inducing Lysosomal Calcium Release: A Gateway to the Onset of Endocrine Resistance" International Journal of Molecular Sciences 25, no. 1: 458. https://doi.org/10.3390/ijms25010458
APA StyleBoretto, C., Actis, C., Faris, P., Cordero, F., Beccuti, M., Ferrero, G., Muzio, G., Moccia, F., & Autelli, R. (2024). Tamoxifen Activates Transcription Factor EB and Triggers Protective Autophagy in Breast Cancer Cells by Inducing Lysosomal Calcium Release: A Gateway to the Onset of Endocrine Resistance. International Journal of Molecular Sciences, 25(1), 458. https://doi.org/10.3390/ijms25010458