Next Article in Journal
An Effectively Uncoupled Gd8 Cluster Formed through Fixation of Atmospheric CO2 Showing Excellent Magnetocaloric Properties
Previous Article in Journal
The Potential of Congo Red Supplied Aggregates of Multitargeted Tyrosine Kinase Inhibitor (Sorafenib, BAY-43-9006) in Enhancing Therapeutic Impact on Bladder Cancer
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 1
10.3390/ijms25010266
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogeny and Evolution of Cocconeiopsis (Cocconeidaceae) as Revealed by Complete Chloroplast and Mitochondrial Genomes

by
Feichao Du
1,2,3,†,
Yuhang Li
1,2,† and
Kuidong Xu
1,2,3,4,*
1
Laboratory of Marine Organism Taxonomy and Phylogeny, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
2
Qingdao Key Laboratory of Marine Biodiversity and Conservation, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
3
University of Chinese Academy of Sciences, Beijing 100049, China
4
Laoshan Laboratory, Qingdao 266237, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(1), 266; https://doi.org/10.3390/ijms25010266
Submission received: 20 November 2023 / Revised: 17 December 2023 / Accepted: 21 December 2023 / Published: 23 December 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
The genus Cocconeiopsis was separated from Navicula, but its systematic position is in debate. We sequenced the complete chloroplast and mitochondrial genome of Cocconeidaceae for the first time with Cocconeiopsis kantsiensis and investigated its phylogeny and evolutionary history. Results showed that the plastid genome was 140,415 bp long with 167 genes. The mitochondrial genome was 43,732 bp long with 66 genes. Comparative analysis showed that the plastid genome structure of C. kantsiensis was most similar to those of three Navicula species and Halamphora americana, and its size was significantly smaller than that of a monoraphid species. Its mitochondrial genome was similar to that of related species except for Phaeodactylum tricornutum. The multigene phylogeny reconstruction showed that Cocconeiopsis was sister to Didymosphenia but distant from Naviculaceae. The two-gene phylogenetic analysis containing 255 species showed Cocconeiopsis was sister to Cocconeis, and distant from Naviculaceae as well. Divergence time estimation indicates the common ancestor of cocconeid species occurred about 62.8 Ma and Cocconeiopsis diverged with monoraphid Cocconeis about 58.9 Ma. Our results support the assignment of Cocconeiopsis to Cocconeidaceae and that monoraphid cocconeids were likely evolved from the lineage of Cocconeiopsis.

1. Introduction

The genus Cocconeiopsis was established by Witkowski et al. [1] to accommodate ten Navicula species similar to N. orthoneoides Hustedt. This genus is characterized by a flat discoid to linear-elliptic valve, a filiform and straight raphe internally running on an elevated raphe sternum, external simple and usually expanded raphe endings, terminal ones distant from apices, areolae loculate with external vela, and internal round pores [1]. Subsequently, Riaux–Gobin and Witkowski [2] added two new species, C. juandenovensis and C. discoides. Up to now, this genus contains 12 species [3].
The systematic position of Cocconeiopsis remains unclear. Morphologically, they have two raphes and laterally symmetric valves, suggesting a close relationship with Naviculaceae. However, the presence of elliptical valves, areolae loculate with external vela and internal round pores, and shallow mantles makes it also resemble the genus Cocconeis. Initially, Witkowski et al. [1] established and assigned this genus to “Naviculaceae (in traditional sense)”. However, Riaux–Gobin and Witkowski [2] did not confirm this assignment and classified it as Baccilariophyceae incertae sedis. In a more recent modification by Cox [4], this genus was moved to Cocconeidaceae. Currently, the molecular phylogenetic study of Cocconeiopsis is lacking and its exact phylogenetic position remains unknown.
The chloroplast and mitochondrial genome are now widely used for phylogenomic and molecular evolutionary studies due to their conserved nature and relatively high substitution rate [5,6,7]. Kowallik et al. [8] sequenced the chloroplast of a marine centric diatom, Odontella sinensis, providing the first organelle genome of a diatom. Subsequently, the chloroplast and mitochondrial genome of a biraphid diatom, Phaeodactylum tricornutum, were sequenced, revealing several novel features, including gene transfer from plastid to host nucleus and a large mitochondrial genome [9,10]. Recently, Górecka et al. [11] provided for the first time the complete plastid and mitochondrial genomes of a monoraphid diatom, Schizostauron trachyderma, and resolved the phylogenetic positions of this species based on the concatenated multigene. At present, there are over twenty raphid species whose organelle genomes have been deposited in GenBank, but no one belongs to the cocconeid group.
In this study, we sequenced the plastid and mitochondrial genome of Cocconeiopsis kantsiensis and compared the genomic structure and nucleotide composition with those of related species. The phylogenetic position of C. kantsiensis was analyzed by using shared organelle protein-coding genes and a two-gene dataset (SSU rDNA–rbcL). This study aims to reveal the systematic position of the genus Cocconeiopsis and to better understand its evolutionary relationship.

2. Results

2.1. Morphology

Figure 1A–E show LM images of a solitary cell. One plastid with four lobes with a central bridge containing a pyrenoid. The nucleus lies centrally (Figure 1A,B). Valves shallow, broadly elliptical with rounded apices. 19.9–22.6 µm long, 13.2–15.7 µm in width (n = 20). Valve central area small and roundish. The transapical striae are uniseriate, 18–22 in 10 µm, strongly radiate and punctate.
SEM images (Figure 1F–K) show that, externally, raphe central fissures filiform, straight and expanded. Distal raphe endings expanded, rounded, and distant from the valve apices. Internal raphe fissures straight and terminate in small helictoglossae apart from apices. Straight raphe internally running on an elevated raphe sternum. Areolae round on most of the valve surface but elliptic near the margin and central area.

2.2. General Characterization of C. kantsiensis Plastid Genome

The plastid genome of C. kantsiensis was 140,415 bp in length and presented a typical quadripartite structure with a large single-copy region (LSC) of 76,086 bp, a small single-copy region (SSC) of 44,932 bp and a pair of inverted repeat regions (IR) of 9699 bp each (Figure 2). The GC content of the complete C. kantsiensis plastid genome was 31.8%, and the three main regions—LSC, SSC, and IR—were calculated to be about 30.3, 31.2, and 39.1%, respectively. The higher GC content in the IR region of C. kantsiensis might result from two rRNA genes which have high GC content [12].
The plastid genome of C. kantsiensis contained a total of 167 genes, including 130 protein-coding genes (PCGs), 7 open-reading frames (ORFs), 28 tRNA genes and 2 rRNA genes. None of the genes contained intron. The distribution of PCGs in the plastid genome of C. kantsiensis showed that 74, 52, and 4 genes were located in the LSC, SSC, and IR regions, respectively. Among the 7 ORFs, orf284 encoded a putative integrase/recombinase protein, but its sequence was incomplete. Note that orf284 was closed to the PinE that was inferred to encode a functional protein serine recombinase. Hence, we speculated that orf284 is likely a pseudogene originating from PinE [11].

2.3. Comparative Analysis of C. kantsiensis Plastid Genome

The plastid genomes of nine biraphid diatoms and one monoraphid diatom were chosen to compare with that of C. kantsiensis (Table 1). The plastid genome size of C. kantsiensis (140,415 bp) is similar to those of three Navicula species (N. arenaria, N. avium, and N. tsukamotoi) and Halamphora americana, ranging from 136,746 to 147,331 bp; it is significantly smaller than that of Pleurosigma intermedium (174,382 bp), Seminavis. robusta (150,905), and the monoraphid species Schizostauron trachyderma (187,029 bp), but is larger than that of Phaeodactylum tricornutum (117,369 bp), Didymosphenia geminata (117,972), and Fistulifera saprophila (122,456 bp). The GC contents of these 11 species are similar (29.6–32.6%). The length of the IR regions of the C. kantsiensis (9699 bp) plastid genome is similar to that of other biraphid species except Phaeodactylum tricornutum (6912 bp) and Didymosphenia geminate (6996 bp), but significantly smaller than that of the monoraphid species Schizostauron Trachyderma (17,237 bp). Moreover, monoraphid species (197 genes) have more plastid genes when compared with biraphid species (157–175 genes), which is attributed to a large number of ORFs (42). However, the result was based on only one plastid genome, and further studies involving more plastid genomes of monoraphid diatoms are necessary to confirm this conclusion.
Comparative analysis of the boundaries of the junction sites of the C. kantsiensis plastid genome with nine species, including eight biraphid species (Navicula avium, N. tsukamotoi, Phaeodactylum tricornutum, Pleurosigma intermedium, Seminavis robusta, Didymosphenia geminate, Fistulifera saprophila, and Halamphora americana), and one monoraphid species, Schizostauron trachyderma, revealed that the IR region expansion was different within diatom species (Figure 3). The JLB (the junction between IRb and LSC) extended 105, 1373 and 3 bp into the pseudogene ycf45 of C. kantsiensis, Seminavis robusta, and Halamphora karadagensis, respectively. The rpl32 was located in the SSC and 46, 148, 13, and 122 bp away from the JSB (the junction between IRb and SSC) in C. kantsiensis, Pleurosigma intermedium, Fistulifera saprophila, and Halamphora americana plastid genomes, respectively. However, in Phaeodactylum tricornutum, the JSB expanded 12 bp into rpl32. Notably, in the monoraphid species Schizostauron trachyderma, the rpl32 was close to the JSA (the junction between IRa and SSC), within 40 bp. The psaC was also located in the SSC and 38 and 22 bp away from the JSA in C. kantsiensis and Phaeodactylum tricornutum, respectively. In addition, the acpP1 (43 bp) was only found in IR regions of C. kantsiensis and was 181 bp away from the JLA (the junction between IRa and LSC).

2.4. General Characterization of C. kantsiensis Mitochondrial Genome

The complete circular mitochondrial genome of C. kantsiensis was 43,732 bp in length and 28.3% in GC content (Figure 4). It encoded a total of 66 genes, including 33 PCGs that included the two conserved subunits of Nad11 in diatoms, 6 ORFs, 2 rRNA genes, and 25 tRNA genes. In these 33 PCGs, the TTA is the most common start codon (25) and is followed by the CTA (3), ATG (3), ATT (1), and TCA (1) codons. Two introns were found in the C. kantsiensis mitochondrial genome: one located in the trnY–GUG genes with 1387 bp, the other one being a group II intron of 3270 bp in length which classically interrupts the cox1 [18], with two intronic orf (orf168 and orf710). The C. kantsiensis mitochondrial genome has 25 tRNA, which is almost enough to satisfy all translation requirements, but like other heterokonts, C. kantsiensis has lost the tRNA–Thr [10]. In addition, most PCGs (35/37) are encoded on the same strand, as previously found in Phaeodactylum tricornutum and Asterionella formosa [10,19].

2.5. Comparative Analysis of C. kantsiensis Mitochondrial Genome

The mitochondrial genomes of seven related biraphid species and one monoraphid species were selected to compare with C. kantsiensis (Table 2). The size (43,732) and overall GC content (28.30%) of the C. kantsiensis mitochondrial genome are similar to those of other related species except for Phaeodactylum tricornutum, which has the largest mitochondrial genome size and the highest GC content due to the large repeat regions [10]. The total gene number (66) and composition of the C. kantsiensis mitochondrial genome are well within the range of these related species (62–70), but the number is higher than that of the monoraphid species Schizostauron trachyderma (59).
mVISTA program analysis was performed to identify the genomic divergences events (Figure 5). Our results showed the tRNA and rRNA genes were relatively conserved in all nine species, and highly divergent regions were detected within protein-coding genes, including nad2, nad11, rpl2, rpl5, rpl6, rps2, rps3, rps4, rps7, rps10, rps14, rps19, atp8, and tatC, as well as the intergenic non–coding regions such as trnL–nad6, trnW–trnM.

2.6. Phylogenetic Analysis of C. kantsiensis Plastid and Mitochondrial Genome

We inferred the phylogeny by using 38 pennate diatom plastid genomes, as well as 36 pennate diatom mitochondrial genomes, respectively, with five Bacillariaceae species as outgroups. The ML and BI phylogenetic trees based on plastid genomes (Figure 6) showed that C. kantsiensis formed a strongly supported clade together with two Didymosphenia species (IQ–TREE ultrafast bootstrap value = 100, Mrbayes posterior probability = 1.00). This clade is sister to the clade comprising Fistulifera and Schizostauron. While in the ML and BI phylogenetic trees based on mitochondrial genomes (Figure 7), C. kantsiensis formed a strongly supported clade together with two Didymosphenia species (IQ–TREE ultrafast bootstrap value = 99, Mrbayes posterior probability = 1.00). This clade is sister to the clade comprising Fistulifera, Berkeleya, Proschkinia, and Schizostauron. Moreover, in all molecular phylogenetic trees, C. kantsiensis has a distant relationship with Naviculaceae.

2.7. Phylogenetic Analysis and Divergence Time Estimation Based on a Two-Gene Dataset

Phylogenetic analysis based on a two-gene dataset (SSU rDNA–rbcL) containing 255 species was performed. ML and BI phylogenetic results both showed that Cocconeiopsis was placed in Cocconeidaceae and was sister to Cocconeis (IQ–TREE ultrafast bootstrap value = 86, Mrbayes posterior probability = 0.77), but distant from the Naviculaceae (Figure 8, Figures S1 and S2). Cocconeidaceae was in a larger clade (Clade A) with Achnanthidiaceae (Figure 8). Moreover, both of the phylogenetic analysis based on two-gene and organelle PCGs support the close phylogenetic relationship between Achnanthales (Clade A) and Cymbellales (Clade B), which is consistent with previous studies based on single-gene SSU rDNA and a three-gene (SSU rDNA–rbcL-psbC) dataset [23,24].
Divergence time estimation calibrated by five fossil records within an ML framework (Figure 9 and Figure S3) displayed that the origin of raphid pennates was in the Cretaceous period (101.6 Ma, 95% HPD: 92.6–114.4 Ma). Cocconeidaceae and Achnanthidiaceae were estimated to have diverged from their common ancestor about 62.8 Ma (95% HPD: 52.3–75.2 Ma). Furthermore, the divergence time between biraphid cocconeid Cocconeiopsis and the common ancestor of monoraphid cocconeids was inferred to have occurred about 58.9 Ma (95% HPD: 48.0–70.7 Ma). The origin of Cocconeis occurred about 32.1 Ma (95% HPD: 23.4–42.0 Ma).

3. Discussion

The plastid genomes of C. kantsiensis presented a typical quadripartite structure and a size more similar to those of several biraphid species than those of monoraphid species. There were no genes containing intron in the C. kantsiensis plastid genome, which is consistent with all reported diatom plastid genomes except that of Seminavis robusta [14]. In addition, previous studies showed that plastid gene loss frequently occurred in diatoms [15]; likewise, the petJ and tsf genes were also lost in the C. kantsiensis plastid genome (Figure 2). It is now clear that petJ was transferred to the nucleus in the early evolution in diatoms [15]. The tsf is a translation factor gene, which is also missing in other naviculoid species [13], while in Phaeodactylum tricornutum, this gene is presented in both the nuclear and plastid genomes, indicating an ongoing process of endosymbiotic gene transfer [9]. Moreover, the bas1, syfB, thiG, and thiS were annotated in the C. kantsiensis plastid genome, and are often absent or present as pseudogenes in other diatoms [25].
IR region expansion and contraction is the main reason for the variation in the sizes of plastid genomes and contributes to gene duplications in diatoms [26,27]. In this study, the IR regions of ten biraphid diatoms plastid genomes ranged from 6912 to 10,269 bp (Table 1), indicating they are relatively conserved in this group. However, a recent study has reported that a naviculoid species, Climaconeis cf. scalaris, has a huge IR region up to 78,313 bp due to an extreme IR expansion event [28]. Hence, more plastid genomes of naviculoid species should be sequenced, thus providing us more complete information to investigate the IR regions variation. In addition, the presence of acpP1 in each of the two IR regions suggests that an ancient duplication event occurred in the ancestor of C. kantsiensis because the acpP was considered to undergo multiple independent duplications in the acpP1/2-containing plastid genomes [27].
The multigene phylogenetic analysis based on plastid and mitochondrial genomes confirms the distant evolutionary relationship between Cocconeiopsis and Naviculaceae, which is different from the high similarity in the size and GC content of plastid and mitochondrial genomes between C. kantsiensis and Navicula species (Table 1 and Table 2). The two-gene phylogenetic analysis further showed that Cocconeiopsis was sister to Cocconeis, and that these cocconeids were placed in a larger clade with other Achnanthidiaceae species. These results support the establishment of the genus Cocconeiopsis separated from Naviculaceae, and assigning this genus to Cocconeidaceae [1,4]. Furthermore, divergence time estimation indicates the common ancestor of cocconeid species occurred about 62.8 Ma. The mass extinction event that occurred in this period caused the loss of about 85% of species on earth, which may have offered many niches for the emergence of these cocconeid species [29]. Cocconeid species could be divided into two groups according to the valve morphology and the number of raphes. For example, Cocconeis is heterovalvy: the concave valve is accompanied by a raphe system and the convex valve is not [30]; in Cocconeiopsis, the valves are flat and each has a raphe system. Previous studies argued that monoraphid diatoms were evolved from biraphid species [30,31,32]. In this study, Cocconeiopsis was in the basal position of the clade Cocconeidaceae and occurred about 58.9 Ma, earlier than the origin time of Cocconeis, about 32.1 Ma, indicating that these monoraphid cocconeid groups were likely derived from the biraphid cocconeid group Cocconeiopsis.

4. Materials and Methods

4.1. Sampling, Cultivation, and Morphological Observation

Surface muddy sediments with benthic diatoms were sucked up by using a glass tube from an intertidal sand beach in the Huiquan Bay, Qingdao City. The diatom cells were isolated using capillary pipettes and cultivated in 250 mL cell culture flasks with 100 mL F/2 medium. Cultures were maintained at 20–22 °C under a low light intensity (25–30 µmol photo/m2/s) with a light/dark cycle of 12:12 h. Five millilitres of diatom culture were fixed with 2.5% glutaraldehyde and then cleaned with hydrogen peroxide to remove organic components of frustules [33].
Morphological observation followed the method described in our previous study [34]: for light microscopy (LM) observation, cleaned samples were pipetted onto the coverslips, air-dried, and mounted on glass slides with Mountmedia (Wako Pure Chemical Industries, Ltd., Osaka, Japan). LM microphotographs of cleaned frustules were taken by using a Zeiss Imager Z2 microscope (Carl Zeiss Microimaging GmbH, Jena, Germany) with differential interference contrast (DIC). For scanning electron microscopy (SEM) observation, cleaned frustules were placed on round coverslips, air-dried, and coated with osmium. SEM observation was performed by using a Hitachi S–4800 (Hitachi, Ltd., Tokyo, Japan).

4.2. DNA Extraction and Sequencing

The cells of C. kantsiensis were harvested at the exponential growth phase by centrifuging 50 mL cultures at 5000× g for 5 min. The sample was quickly frozen in liquid nitrogen and stored at −80 °C for DNA extraction. Total DNA was extracted using the Plant Genomic DNA Kit (Tiangen Biotech Co., Beijing, China) according to the manufacturer’s instructions. Half of the total DNA was sent to Beijing BerryGenomics Biotechnology Co., Ltd. (Beijing, China) for library construction and Illumina sequencing. The rest of the total DNA was used for small-subunit ribosomal DNA (SSU rDNA) and chloroplast-encoded gene rbcL amplification by polymerase chain reaction (PCR). Forward and reverse strands were amplified using primers (Table 3). The PCR cycles of the two markers follow [35]. The PCR products were purified by using a TIANgel Midi Purification Kit (Tiangen Biotech Co., Beijing, China) and sequenced by Tsingke Biotechnology Co., Ltd. (Beijing, China). These sequences were deposited in the GenBank (SSU rDNA OR712156 and rbcL OR700023).

4.3. Organelle Genome Assembly and Annotation

Raw data were trimmed by removing adaptors and low-quality reads using Trimmomatic—0.39 (trimwindows = 5; minlength = 25) [39]. De novo assembly was performed using SPAdes v. 3.9.0 [40] with default settings. The annotation of the plastid genome was performing by the GeSeq [41], using the Navicula veneta (GenBank: MT383645) plastid genome as a reference. The structural and functional annotation of the mitochondrial genome was performed by online software MITOS (http://mitos.bioinf.uni-leipzig.de/ accessed on 2 June 2023). Protein-coding genes (PCGs) and rRNA genes were annotated by aligning with the mitochondrial genome of Navicula veneta (GenBank: MT383644). Apollo software [42] was used to manually correct the boundaries of positions of start and stop codons to ensure the accuracy of the annotation results. A map of the organelle genome was produced by OGDRAW [43]. The annotated complete plastid and mitochondrial genome of C. kantsiensis were deposited in GenBank with accession numbers OR699085 and OR699086, respectively.

4.4. Phylogenetic Analysis and Divergence Time Estimation

For multigene phylogenies, plastid and mitochondrial protein-coding genes were extracted separately and aligned with related species gene sequences obtained from GenBank by using PhyloSuite [44]. Five diatoms including Cylindrotheca Closterium, Tryblionella apiculate, Pseudo–nitzschia cuspidate, Ps. micropora and Ps. multiseries served as outgroups. The information of the selected species was listed in Table S1. The number of shared protein-coding genes in selected species is 78 for the plastid genome and 18 for the mitochondrial genome. These sequences were aligned using MAFFT v.7.313 [45] with normal mode. The trimAl was used to trim the alignment with parameter automated1 [46]. These sequences were then concatenated by PhyloSuite [44]. The final size of the alignments was 63,182 bp for the plastid genes alignment and 14,592 bp for the mitochondrial genes alignment. All genes were partitioned by codon position. PartitionFinder 2 was used to select best-fit models for ML and BI analysis [47], according to the Bayesian information criterion (BIC). IQ–TREE v.1.6.8 [48] and Mrbayes v.3.2.7 [49] were conducted to perform the maximum likelihood (ML) and Bayesian inference (BI) for the two alignments, respectively. The ML analysis with 1000 bootstrap was executed with the default settings. The BI program was run for 107 generations with samples every 1000 generations, and the first 25% of trees were discarded as burn-in. Convergence was judged based on the average standard deviation of split frequencies (all less than 0.01) and the ESS values (more than 3000) were analyzed in the R package RWTY [50]. The consensus topology and posterior probabilities of all branches were derived from the remaining trees using a majority-rule consensus approach.
To further infer the phylogenetic position of C. kantsiensis, we used a large two-gene dataset (SSU rDNA–rbcL) containing 255 species. The information of these genes is listed in Table S2. The phylogenetic analysis based on this two-gene dataset was similar to those of the multigene phylogenies mentioned above and a previous phylogeny study [24]. The final concatenated alignment included 1777 positions, of which 729 columns were SSU rDNA and 1048 were rbcL. The rbcL gene was partitioned by codon position to select best-fit models for ML and BI analysis. Based on the two-gene dataset (SSU rDNA–rbcL), we used the ML tress as the framework to estimate the divergence time of the 255 species by using MCMCTree in PAML v4. 9 [51]. The substitution rate was calculated using baseml first to get the rgene_gamma. We then selected the GTR + G substitution model with an independent-rate clock model to calculate branch lengths, gradient, and Hessian. Five calibration points [52,53,54] were used in this analysis (Table S3). 200,000 samples were discarded as a burn-in, the sample frequency was 10 and the number of samples was 20,000. Finally, FigTree v.1.4.4 and Adobe Illustrator were used to display and edit trees.

5. Conclusions

We sequenced and analyzed the plastid and mitochondrial genomes of a biraphid Cocconeidaceae species, Cocconeiopsis kantsiensis, for the first time. Comparative analysis showed that the plastid genome structure of C. kantsiensis was similar to those of three Navicula species (N. arenaria, N. avium, and N. tsukamotoi) as well as that of Halamphora americana, but its size was significantly smaller than those of monoraphid species Schizostauron trachyderma. the mitochondrial genome was similar to that of other related species except for Phaeodactylum tricornutum. Phylogenetic trees constructed based on shared protein-coding genes of plastid and mitochondrial genomes indicate that Cocconeiopsis is sister to Didymosphenia and has a distant relationship with Naviculaceae. To obtain a more clear phylogenetic position and evolutionary history of C. kantsiensis, we performed the phylogenetic analysis based on a two-gene dataset (SSU rDNA–rbcL) containing 255 species. The results also suggested that Cocconeiopsis was sister to Cocconeis, but far from the Naviculaceae, supporting the validity of the generic establishment [1,4]. Moreover, divergence time estimation indicates that the common ancestor of cocconeid species occurred about 62.8 Ma and that Cocconeiopsis occurred about 58.9 Ma, earlier than the origin time of Cocconeis, indicating that these monoraphid cocconeid groups, including cocconeis, were likely derived from the biraphid cocconeid group Cocconeiopsis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25010266/s1.

Author Contributions

Conceptualization, K.X.; Funding acquisition, Y.L.; Investigation, F.D. and Y.L.; Methodology, Y.L.; Supervision, K.X.; Writing—original draft, F.D.; Writing—review and editing, K.X. and Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Grant numbers 42276099 and 31800171).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Molecular data have all been deposited to GenBank with the following link: https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 1 December 2023).

Acknowledgments

This work was supported by Oceanographic Data Center, Institute of Oceanology, Chinese Academy of Sciences.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Andrzej, W.; Ditmar, L.B.H.M. Diatom Flora of Marine Coasts I. Iconographia Diatomologica 7: 925 pp. Koeltz Sci. Knigstein; A.R.G. Gantner Verlag: Ruggell, Germany, 2000. [Google Scholar]
  2. Riaux-Gobin, C.; Witkowski, A. Small-sized and discoid species of the genus Cocconeiopsis (Bacillariophyta) on Holothuria atra (Juan de Nova, Mozambique Channel). Phytotaxa 2012, 54, 43–58. [Google Scholar] [CrossRef]
  3. M.D. Guiry in Guiry, M.D.G., G.M. 17 February 2020. AlgaeBase. World-Wide Electronic Publication, National University of Ireland, Galway. Available online: https://www.algaebase.org (accessed on 27 August 2023).
  4. Cox, E. Coscinodiscophyceae, Mediophyceae, Fragilariophyceae, Bacillariophyceae (Diatoms). In Syllabus of Plant Families. Adolf Engler’s Syllabus der Pflanzenfamilien. 2/1 Photoautotrophic Eukaryotic Algae; Frey, W., Ed.; Borntraeger Science Publishers: Stuttgart, Germany, 2015; pp. 64–103. [Google Scholar]
  5. Li, H.; Leavengood, J.M., Jr.; Chapman, E.G.; Burkhardt, D.; Song, F.; Jiang, P.; Liu, J.; Zhou, X.; Cai, W. Mitochondrial phylogenomics of Hemiptera reveals adaptive innovations driving the diversification of true bugs. Proc. R. Soc. B Biol. Sci. 2017, 284, 20171223. [Google Scholar] [CrossRef]
  6. Salvato, P.; Simonato, M.; Battisti, A.; Negrisolo, E. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Genom. 2008, 9, 331. [Google Scholar] [CrossRef]
  7. Ren, T.; Aou, X.; Tian, R.; Li, Z.; Peng, C.; He, X. Complete Chloroplast Genome of Cnidium monnieri (Apiaceae) and Comparisons with Other Tribe Selineae Species. Diversity 2022, 14, 323. [Google Scholar] [CrossRef]
  8. Kowallik, K.V.; Stoebe, B.; Schaffran, I.; Kroth-Pancic, P.; Freier, U. The chloroplast genome of a chlorophylla+c–containing alga, Odontella sinensis. Plant Mol. Biol. Report. 1995, 13, 336–342. [Google Scholar] [CrossRef]
  9. Oudot-Le Secq, M.-P.; Grimwood, J.; Shapiro, H.; Armbrust, E.V.; Bowler, C.; Green, B.R. Chloroplast genomes of the diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana: Comparison with other plastid genomes of the red lineage. Mol. Genet. Genom. 2007, 277, 427–439. [Google Scholar] [CrossRef]
  10. Oudot-Le Secq, M.-P.; Green, B.R. Complex repeat structures and novel features in the mitochondrial genomes of the diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. Gene 2011, 476, 20–26. [Google Scholar] [CrossRef]
  11. Górecka, E.; Gastineau, R.; Davidovich, N.A.; Davidovich, O.I.; Ashworth, M.P.; Sabir, J.S.; Lemieux, C.; Turmel, M.; Witkowski, A. Mitochondrial and plastid genomes of the monoraphid diatom Schizostauron trachyderma. Int. J. Mol. Sci. 2021, 22, 11139. [Google Scholar] [CrossRef] [PubMed]
  12. Qian, J.; Song, J.; Gao, H.; Zhu, Y.; Xu, J.; Pang, X.; Yao, H.; Sun, C.; Li, X.e.; Li, C. The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza. PLoS ONE 2013, 8, e57607. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, Y.; Wang, J.; Chen, Y.; Liu, S.; Zhao, Y.; Chen, N. Comparative Analysis of Bacillariophyceae Chloroplast Genomes Uncovers Extensive Genome Rearrangements Associated with Speciation. Int. J. Environ. Res. Public Health 2022, 19, 10024. [Google Scholar] [CrossRef] [PubMed]
  14. Brembu, T.; Winge, P.; Tooming-Klunderud, A.; Nederbragt, A.J.; Jakobsen, K.S.; Bones, A.M. The chloroplast genome of the diatom Seminavis robusta: New features introduced through multiple mechanisms of horizontal gene transfer. Mar. Genom. 2014, 16, 17–27. [Google Scholar] [CrossRef] [PubMed]
  15. Ruck, E.C.; Nakov, T.; Jansen, R.K.; Theriot, E.C.; Alverson, A.J. Serial gene losses and foreign DNA underlie size and sequence variation in the plastid genomes of diatoms. Genome Biol. Evol. 2014, 6, 644–654. [Google Scholar] [CrossRef] [PubMed]
  16. Gastineau, R.; Hamedi, C.; Hamed, M.B.B.; Abi-Ayad, S.-M.E.-A.; Bąk, M.; Lemieux, C.; Turmel, M.; Dobosz, S.; Wróbel, R.J.; Kierzek, A. Morphological and molecular identification reveals that waters from an isolated oasis in Tamanrasset (extreme South of Algerian Sahara) are colonized by opportunistic and pollution–tolerant diatom species. Ecol. Indic. 2021, 121, 107104. [Google Scholar] [CrossRef]
  17. Hamsher, S.E.; Keepers, K.G.; Pogoda, C.S.; Stepanek, J.G.; Kane, N.C.; Kociolek, J.P. Extensive chloroplast genome rearrangement amongst three closely related Halamphora spp. (Bacillariophyceae), and evidence for rapid evolution as compared to land plants. PLoS ONE 2019, 14, e0217824. [Google Scholar] [CrossRef] [PubMed]
  18. Pogoda, C.S.; Keepers, K.G.; Hamsher, S.E.; Stepanek, J.G.; Kane, N.C.; Kociolek, J.P. Comparative analysis of the mitochondrial genomes of six newly sequenced diatoms reveals group II introns in the barcoding region of cox1. Mitochondrial DNA Part A 2019, 30, 43–51. [Google Scholar] [CrossRef] [PubMed]
  19. Villain, A.; Kojadinovic, M.; Puppo, C.; Prioretti, L.; Hubert, P.; Zhang, Y.; Grégori, G.; Roulet, A.; Roques, C.; Claverie, J.-M. Complete mitochondrial genome sequence of the freshwater diatom Asterionella formosa. Mitochondrial DNA Part B 2017, 2, 97–98. [Google Scholar] [CrossRef] [PubMed]
  20. An, S.M.; Noh, J.H.; Lee, H.R.; Choi, D.H.; Lee, J.H.; Yang, E.C. Complete mitochondrial genome of biraphid benthic diatom, Navicula ramosissima (Naviculales, Bacillariophyceae). Mitochondrial DNA Part B 2016, 1, 549–550. [Google Scholar] [CrossRef] [PubMed]
  21. Wang, Y.; Liu, S.; Wang, J.; Yao, Y.; Chen, Y.; Xu, Q.; Zhao, Z.; Chen, N. Diatom Biodiversity and Speciation Revealed by Comparative Analysis of Mitochondrial Genomes. Front. Plant Sci. 2022, 13, 749982. [Google Scholar] [CrossRef]
  22. Aunins, A.W.; Hamilton, D.; King, T.L. The complete mitochondrial genome of the stalk-forming diatom Didymosphenia geminata. Mitochondrial DNA Part B 2018, 3, 676–677. [Google Scholar] [CrossRef]
  23. Sims, P.A.; Mann, D.G.; Medlin, L.K. Evolution of the diatoms: Insights from fossil, biological and molecular data. Phycologia 2006, 45, 361–402. [Google Scholar] [CrossRef]
  24. Stepanek, J.G.; Kociolek, J.P. Molecular Phylogeny of Amphora sensu lato (Bacillariophyta): An Investigation into the Monophyly and Classification of the Amphoroid Diatoms. Protist 2014, 165, 177–195. [Google Scholar] [CrossRef] [PubMed]
  25. Gastineau, R.; Li, C.; Ashworth, M.P.; Witkowski, A.; Turmel, M.; Gorecka, E.; Frankovich, T.A.; Wachnicka, A.; Lobban, C.S.; Theriot, E.C. A new insight into Amicula, a genus of tiny marine benthic diatoms with the description of two new tropical species and the largest mitogenome known for a stramenopile. Front. Mar. Sci. 2022, 9, 941506. [Google Scholar] [CrossRef]
  26. Goulding, S.E.; Wolfe, K.; Olmstead, R.; Morden, C. Ebb and flow of the chloroplast inverted repeat. Mol. Gen. Genet. MGG 1996, 252, 195–206. [Google Scholar] [CrossRef] [PubMed]
  27. Yu, M.; Ashworth, M.P.; Hajrah, N.H.; Khiyami, M.A.; Sabir, M.J.; Alhebshi, A.M.; Al-Malki, A.L.; Sabir, J.S.; Theriot, E.C.; Jansen, R.K. Evolution of the plastid genomes in diatoms. In Advances in Botanical Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 85, pp. 129–155. [Google Scholar]
  28. Gastineau, R.; Davidovich, N.A.; Davidovich, O.I.; Lemieux, C.; Turmel, M.; Wróbel, R.J.; Witkowski, A. Extreme enlargement of the inverted repeat region in the plastid genomes of diatoms from the genus Climaconeis. Int. J. Mol. Sci. 2021, 22, 7155. [Google Scholar] [CrossRef] [PubMed]
  29. Falkowski, P.G.; Katz, M.E.; Knoll, A.H.; Quigg, A.; Raven, J.A.; Schofield, O.; Taylor, F. The evolution of modern eukaryotic phytoplankton. Science 2004, 305, 354–360. [Google Scholar] [CrossRef] [PubMed]
  30. Round, F.E.; Crawford, R.M.; Mann, D.G. Diatoms: Biology and Morphology of the Genera; Cambridge University Press: Cambridge, UK, 1990. [Google Scholar]
  31. Simonsen, R. The diatom system: Ideas on phylogeny. Bacillaria 1979, 2, 9. [Google Scholar]
  32. Mann, D.G. Structure, life history and systematics of Rhoicosphenia (Bacillariophyta). I. The Vegetative Cell of rh. Curvata 1. J. Phycol. 1982, 18, 162–176. [Google Scholar]
  33. Trobajo, R.; Mann, D.G. A rapid cleaning method for diatoms. Diatom Res. 2019, 34, 115–124. [Google Scholar] [CrossRef]
  34. Du, F.-C.; Li, Y.-H.; Xu, K.-D. Morphology and molecular phylogeny of Pleurosigma pacificum sp. nov.(Pleurosigmataceae), a new tropical pelagic species from the Western Pacific Ocean. PhytoKeys 2023, 227, 99. [Google Scholar] [CrossRef]
  35. Alverson, A.J.; Jansen, R.K.; Theriot, E.C. Bridging the Rubicon: Phylogenetic analysis reveals repeated colonizations of marine and fresh waters by thalassiosiroid diatoms. Mol. Phylogenetics Evol. 2007, 45, 193–210. [Google Scholar] [CrossRef]
  36. Medlin, L.; Elwood, H.J.; Stickel, S.; Sogin, M.L. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 1988, 71, 491–499. [Google Scholar] [CrossRef]
  37. Edgar, S.M.; Theriot, E.C. Phylogeny of Aulacoseira (Bacillariophyta) based on molecules and morphology 1. J. Phycol. 2004, 40, 772–788. [Google Scholar] [CrossRef]
  38. Ruck, E.C.; Theriot, E.C. Origin and evolution of the canal raphe system in diatoms. Protist 2011, 162, 723–737. [Google Scholar] [CrossRef]
  39. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
  40. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
  41. Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq-versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
  42. Lewis, S.E.; Searle, S.; Harris, N.; Gibson, M.; Iyer, V.; Richter, J.; Wiel, C.; Bayraktaroglu, L.; Birney, E.; Crosby, M. Apollo: A sequence annotation editor. Genome Biol. 2002, 3, research0082.1. [Google Scholar] [CrossRef]
  43. Lohse, M.; Drechsel, O.; Bock, R. OrganellarGenomeDRAW (OGDRAW): A tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr. Genet. 2007, 52, 267–274. [Google Scholar] [CrossRef]
  44. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef]
  45. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
  46. Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef] [PubMed]
  47. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef] [PubMed]
  48. Nguyen, L.-T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
  49. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
  50. Warren, D.L.; Geneva, A.J.; Lanfear, R. RWTY (R We There Yet): An R package for examining convergence of Bayesian phylogenetic analyses. Mol. Biol. Evol. 2017, 34, 1016–1020. [Google Scholar] [CrossRef]
  51. Yang, Z. PAML 4: Phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 2007, 24, 1586–1591. [Google Scholar] [CrossRef]
  52. Hajós, M. Stratigraphy of Hungary's Miocene diatomaceous earth deposits. Geologica Hungarica. Ser. Palaeontol. 1986, 49, 1–339. [Google Scholar]
  53. Lazarus, D. Neptune: A marine micropaleontology database. Math. Geol. 1994, 26, 817–832. [Google Scholar] [CrossRef]
  54. Nakov, T.; Beaulieu, J.M.; Alverson, A.J. Accelerated diversification is related to life history and locomotion in a hyperdiverse lineage of microbial eukaryotes (Diatoms, Bacillariophyta). New Phytol. 2018, 219, 462–473. [Google Scholar] [CrossRef]
Ijms 25 00266 g001
Figure 1. LM and SEM photographs of Cocconeiopsis kantsiensis. (A,B) live cells with plastids in valve view; (C–E) cleaned frustules in LM; (F–H) external view of the valve in SEM; (G) external central area showing the expanded central raphe endings; (H) external distal raphe ending expanded distant from valve margin; (I–K) internal view of the valve in SEM; (J) internal valve central area with simple raphe endings; (K) internal raphe fissures terminate in helictoglossae at the apices. Scale bars: 10 μm (A–E); 5 μm (F,I); 2 μm (H); 1 μm (G,J,K).
Figure 1. LM and SEM photographs of Cocconeiopsis kantsiensis. (A,B) live cells with plastids in valve view; (C–E) cleaned frustules in LM; (F–H) external view of the valve in SEM; (G) external central area showing the expanded central raphe endings; (H) external distal raphe ending expanded distant from valve margin; (I–K) internal view of the valve in SEM; (J) internal valve central area with simple raphe endings; (K) internal raphe fissures terminate in helictoglossae at the apices. Scale bars: 10 μm (A–E); 5 μm (F,I); 2 μm (H); 1 μm (G,J,K).
Ijms 25 00266 g001
Ijms 25 00266 g002
Figure 2. Map of the plastid genome of C. kantsiensis. The darker grey in the inner circle represents the GC content. The genes belonging to different functional groups are color-coded.
Figure 2. Map of the plastid genome of C. kantsiensis. The darker grey in the inner circle represents the GC content. The genes belonging to different functional groups are color-coded.
Ijms 25 00266 g002
Ijms 25 00266 g003
Figure 3. Comparison of the LSC/IR and IR/SSC junction of the plastid genome between C. kantsiensis and related species.
Figure 3. Comparison of the LSC/IR and IR/SSC junction of the plastid genome between C. kantsiensis and related species.
Ijms 25 00266 g003
Ijms 25 00266 g004
Figure 4. Map of the mitochondrial genome of C. kantsiensis. The darker grey in the inner circle represents the GC content. The genes belonging to different functional groups are color-coded.
Figure 4. Map of the mitochondrial genome of C. kantsiensis. The darker grey in the inner circle represents the GC content. The genes belonging to different functional groups are color-coded.
Ijms 25 00266 g004
Ijms 25 00266 g005
Figure 5. Visualization of the mitochondrial genome alignment between C. kantsiensis and related species in mVISTA. The top grey arrows show the position and direction of each gene. The vertical scale represents the identity ranging from 50 to 100%.
Figure 5. Visualization of the mitochondrial genome alignment between C. kantsiensis and related species in mVISTA. The top grey arrows show the position and direction of each gene. The vertical scale represents the identity ranging from 50 to 100%.
Ijms 25 00266 g005
Ijms 25 00266 g006
Figure 6. Maximum likelihood (ML) and Bayesian inference (BI) phylogenetic trees based on the concatenated 78 shared protein-coding from 38 plastid genomes of diatoms. The values on each node indicate ML bootstrap and Bayesian posterior probabilities (%), respectively. Only bootstrap values over 50% are shown on the tree. “●” indicates ML/BI = 100/1.00.
Figure 6. Maximum likelihood (ML) and Bayesian inference (BI) phylogenetic trees based on the concatenated 78 shared protein-coding from 38 plastid genomes of diatoms. The values on each node indicate ML bootstrap and Bayesian posterior probabilities (%), respectively. Only bootstrap values over 50% are shown on the tree. “●” indicates ML/BI = 100/1.00.
Ijms 25 00266 g006
Ijms 25 00266 g007
Figure 7. Maximum likelihood (ML) and Bayesian inference (BI) phylogenetic trees based on the concatenated 18 shared protein-codings from 36 mitochondrial genomes of diatoms. The values on each node indicate ML bootstrap and Bayesian posterior probabilities (%), respectively. Only bootstrap values over 50% are shown on the tree. “●” indicates ML/BI = 100/1.00.
Figure 7. Maximum likelihood (ML) and Bayesian inference (BI) phylogenetic trees based on the concatenated 18 shared protein-codings from 36 mitochondrial genomes of diatoms. The values on each node indicate ML bootstrap and Bayesian posterior probabilities (%), respectively. Only bootstrap values over 50% are shown on the tree. “●” indicates ML/BI = 100/1.00.
Ijms 25 00266 g007
Ijms 25 00266 g008
Figure 8. The part of the maximum likelihood (ML) phylogenetic tree based on the concatenated two-gene dataset (SSU rDNA–rbcL) from 255 diatoms. The values on each node indicate ML bootstrap (%). Only bootstrap values over 50% are shown on the tree. “●” indicates ML = 100. (See Figure S1 for the complete phylogenetic tree.)
Figure 8. The part of the maximum likelihood (ML) phylogenetic tree based on the concatenated two-gene dataset (SSU rDNA–rbcL) from 255 diatoms. The values on each node indicate ML bootstrap (%). Only bootstrap values over 50% are shown on the tree. “●” indicates ML = 100. (See Figure S1 for the complete phylogenetic tree.)
Ijms 25 00266 g008
Ijms 25 00266 g009
Figure 9. The part of the time-calibrated divergence time estimation of 255 diatoms based on a two-gene dataset (SSU rDNA–rbcL) within the ML framework. The red nodes represent the calibration point and blue bars represent the 95% highest posterior density (HPD). (See Figure S3 for the complete divergence time estimate.)
Figure 9. The part of the time-calibrated divergence time estimation of 255 diatoms based on a two-gene dataset (SSU rDNA–rbcL) within the ML framework. The red nodes represent the calibration point and blue bars represent the 95% highest posterior density (HPD). (See Figure S3 for the complete divergence time estimate.)
Ijms 25 00266 g009
Table 1. Plastid genome of Cocconeiopsis kantsiensis with related species.
Table 1. Plastid genome of Cocconeiopsis kantsiensis with related species.
SpeciesCocconeiopsis kantsiensisNavicula arenariaNavicula aviumNavicula tsukamotoiPhaeodactylum tricornutumPleurosigma intermediumSeminavis. robustaDidymosphenia geminataFistulifera saprophilaHalamphora americanaSchizostauron trachyderma
Sizes140,415147,331137,691136,746117,369174,382150,905117,972122,456142,551187,029
LSC76,08680,13470,27370,01263,67496,63870,54063,61064,59077,28992,894
SSC44,93247,69949,19450,04839,87160,40061,49740,37039,96844,72459,661
IR96999749911283436912867294346996894910,26917,237
GC content31.80%30.70%31.30%31.40%32.60%29.60%30.92%31.60%32.44%32.00%30.77%
Total genes167165164164162157175160160172197
ReferenceThis study[13][13][13][9][13][14][15][16][17][11]
Table 2. Mitochondrial genome of Cocconeiopsis kantsiensis with related species.
Table 2. Mitochondrial genome of Cocconeiopsis kantsiensis with related species.
SpeciesCocconeiopsis kantsiensisNavicula ramosissimaNavicula tsukamotoiNavicula venetaPhaeodactylum tricornutumHaslea karadagensisDidymosphenia geminataHalamphora coffeaeformisSchizostauron trachyderma
Sizes43,73248,65250,97238,89777,35640,92437,76544,65341,957
GC content28.30%31.11%28.60%25.09%35.01%29.76%26.93%32.90%27.83%
PCG333536353434353835
tRNA252325232422252222
rRNA232222222
Total genes666870626065626259
ReferenceThis study[20][21][16][10]Accession: OK729586[22][18][11]
Table 3. Primers were used to amplify SSU rDNA and rbcL fragments from C. kantsiensis.
Table 3. Primers were used to amplify SSU rDNA and rbcL fragments from C. kantsiensis.
NameMarkerSequence (5′ to 3′)Reference
SSU1 SSUAACCTGGTTGATCCTGCCAGT[36]
ITS1DRSSUCCTTGTTACGACTTCACCTTCC[37]
rbcL 66+rbcLTTAAGGAGAAATAAATGTCTCAATCTG[35]
rbcL 1444− rbcLGCGAAATCAGCTGTATCTGTW G[38]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Du, F.; Li, Y.; Xu, K. Phylogeny and Evolution of Cocconeiopsis (Cocconeidaceae) as Revealed by Complete Chloroplast and Mitochondrial Genomes. Int. J. Mol. Sci. 2024, 25, 266. https://doi.org/10.3390/ijms25010266

AMA Style

Du F, Li Y, Xu K. Phylogeny and Evolution of Cocconeiopsis (Cocconeidaceae) as Revealed by Complete Chloroplast and Mitochondrial Genomes. International Journal of Molecular Sciences. 2024; 25(1):266. https://doi.org/10.3390/ijms25010266

Chicago/Turabian Style

Du, Feichao, Yuhang Li, and Kuidong Xu. 2024. "Phylogeny and Evolution of Cocconeiopsis (Cocconeidaceae) as Revealed by Complete Chloroplast and Mitochondrial Genomes" International Journal of Molecular Sciences 25, no. 1: 266. https://doi.org/10.3390/ijms25010266

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop