Next Article in Journal
Genome-Wide Identification and Chilling Stress Analysis of the NF-Y Gene Family in Melon
Next Article in Special Issue
Haplotype Analysis of GmSGF14 Gene Family Reveals Its Roles in Photoperiodic Flowering and Regional Adaptation of Soybean
Previous Article in Journal
A New One-Tube Reaction Assay for the Universal Determination of Sweet Cherry (Prunus avium L.) Self-(In)Compatible MGST- and S-Alleles Using Capillary Fragment Analysis
Previous Article in Special Issue
Maternal Donor and Genetic Variation of Lagerstroemia indica Cultivars
error_outline You can access the new MDPI.com website here. Explore and share your feedback with us.
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biodiversity of rolB/C-like Natural Transgene in the Genus Vaccinium L. and Its Application for Phylogenetic Studies

1
Department of Genetic and Breeding, St. Petersburg State University, Saint Petersburg 199034, Russia
2
Komarov Botanical Institute of the Russian Academy of Sciences, Saint Petersburg 197022, Russia
3
Faculty of Bioengineering and Bioinformatics, Moscow State University, Moscow 119991, Russia
4
Research Park, St. Petersburg State University, Saint Petersburg 199034, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(8), 6932; https://doi.org/10.3390/ijms24086932
Submission received: 25 March 2023 / Revised: 6 April 2023 / Accepted: 6 April 2023 / Published: 8 April 2023
(This article belongs to the Special Issue Plant Phylogenomics and Genetic Diversity)

Abstract

A variety of plant species found in nature contain agrobacterial T-DNAs in their genomes which they transmit in a series of sexual generations. Such T-DNAs are called cellular T-DNAs (cT-DNAs). cT-DNAs have been discovered in dozens of plant genera, and are suggested to be used in phylogenetic studies, since they are well-defined and unrelated to other plant sequences. Their integration into a particular chromosomal site indicates a founder event and a clear start of a new clade. cT-DNA inserts do not disseminate in the genome after insertion. They can be large and old enough to generate a range of variants, thereby allowing the construction of detailed trees. Unusual cT-DNAs (containing the rolB/C-like gene) were found in our previous study in the genome data of two Vaccinium L. species. Here, we present a deeper study of these sequences in Vaccinium L. Molecular-genetic and bioinformatics methods were applied for sequencing, assembly, and analysis of the rolB/C-like gene. The rolB/C-like gene was discovered in 26 new Vaccinium species and Agapetes serpens (Wight) Sleumer. Most samples were found to contain full-size genes. It allowed us to develop approaches for the phasing of cT-DNA alleles and reconstruct a Vaccinium phylogenetic relationship. Intra- and interspecific polymorphism found in cT-DNA makes it possible to use it for phylogenetic and phylogeographic studies of the Vaccinium genus.

1. Introduction

Agrobacterium” is a soil bacterium with a unique mechanism to transfer well-defined DNA fragments (T-DNAs) into the chromosomes of a large variety of dicotyledonous plant species [1,2,3,4,5,6]. Normally, the transfers result in crown gall disease (in the case of Agrobacterium tumefaciens Conn or A. vitis Ophel and Kerr) or hairy roots formation (in the case of A. rhizogenes, also called Rhizobium rhizogenes Young). It has been experimentally demonstrated that hairy roots can regenerate into fertile plants [7,8,9]. Moreover, a variety of plant species, found in nature, contain T-DNA in their genomes, which they transmit in a series of sexual generations. Such T-DNA is called cellular (cT-DNA), and the plants containing it are called naturally transgenic or genetically-modified organisms (nGMO). Initially, such sequences were discovered in Nicotiana glauca Graham and other Nicotiana L. species [10,11,12], and further nGMOs were found inside genera Linaria Mill. [13], Ipomoea L. [14], Cuscuta L. [15], and dozens of other species [6,16,17,18]. These discoveries enabled making a number of generalizations regarding the distribution, structures, and possible functions of cT-DNA, summarized in our previous paper [19]. Sequences of cT-DNAs have been used in phylogenetic studies of Linaria [20], Ipomoea [21], Nicotiana [22], and Camellia [23]. They present several advantages for exploring the origin and evolution of nGMO species. To begin with, cT-DNAs are well-defined, highly specific, and well recognizable DNA fragments, unrelated to plant sequences. They do not occur in non-transformed ancestors, and their integration at a particular chromosomal site constitutes a founder event which creates a clear start for a new clade. Moreover, unlike transposable elements, cT-DNA inserts do not amplify and disseminate in the genome after insertion. This prevents the generation of multiple paralogs, which is a significant advantage over classical nuclear markers. Additionally, cT-DNAs can be large and old enough to generate a range of variants, thereby allowing the construction of detailed trees [23]. Phasing of T-DNA alleles enables the reconstruction of more precise phylogenetic relationships and identification of hybridization events in the evolution of plant species [24]. These approaches have been successfully applied in the study of the genus Camellia [23].
We also found unusual sequences of the rolB/C-like gene in the genome data of Vaccinium corymbosum L. and Vaccinium macrocarpon Ait. [6,16]. This gene belongs to the plast-gene family. It is more similar to plast-genes present in fungus Laccaria bicolor (Maire) P.D.Orton (and absent in most basidiomycetes), plant Nyssa sinensis Oliv., and bacteria Ensifer sp. Casida, than to ones from known strains of Agrobacterium (Rhizobium) rhizogenes, which indicates the transfer of this sequence from an unknown «Agrobacterium» strain [16].
Based on the results of previous phylogenetic studies, we can try to reconstruct phylogenetic relationships between species of Vaccinium genus, using the rolB/C-like gene sequence. This task is quite relevant since the phylogeny of Vaccinium genus is highly controversial.
The Vaccinium genus was first described by Carl Linnaeus in 1753 [25]. After that, there were no large-scale phylogenetic studies of this genus until the beginning of the 20th century, when active breeding of cranberries and blueberries started in the United States [26,27]. Therefore, the first studies of Vaccinium phylogeny and taxonomy mainly involved species distributed in North America. The main difficulties in such studies were caused by the absence of fertility barriers in morphologically different organisms, which leads to the formation of a large number of hybrids, along with polyploidy distribution throughout the genus [27].
Camp was one of the first to introduce the system of Vaccinium genus in 1945 [28]. He conducted his classification according to morphological features. As a result, the genus was divided into several sections. The North American blueberry section Cyanococcus included 9 diploid, 12 tetraploid, and 3 hexaploid species [29]. Later, some of the species were merged into V. corymbosum with three levels of ploidy; therefore, in the new Kloet’s classification, the Cyanococcus section contained 6 diploid, 5 tetraploid, and 1 hexaploid blueberry species [29], while dividing into sections did not change itself [30].
Thereby, Vaccinium species differentiation is complicated by polyploidy, similar morphology, and introgressions during hybridization [29]. Additionally, the application of morphological traits for phylogenetic studies of this genus does not always enable an ambiguous assessment of the evolutionary relationships between the studied species. This problem can be partially solved by the application of modern methods of phylogeny.
Methods such as DNA barcoding, fingerprinting, phylogenomics, and chemosystematics have been used recently in the study of Vaccinium genus. They allowed us to reconsider the taxonomy proposed by K. Kloet. An example of such study is the application of matK and ITS markers to determine phylogenetic relationships of various representatives of the entire tribe Vaccinieae [31]. The resulting dendrograms did not confirm traditional generic boundaries, but several well-supported clades were found on the tree: Andean; Mesoamerican/Caribbean; East Malaysian; Agapetes (consisting of some Asiatic Vaccinium and Agapetes); Bracteata-Oarianthe (represented by the respective sections); Orthaea/Notopora (containing the genera Orthaea Klotzsch and Notopora Hook); Myrtillus; and Vaccinium clades. Moreover, most of the discovered clades combined representatives of various genera, while the clades Vaccinium and Myrtillus contained species from different Vaccinium sections according to the previous classifications. Based on the obtained results, the authors concluded that it is necessary to reassess the taxonomy of the genus Vaccinium, since it is not monophyletic. Although work on this reassessment began in 2003 [32], a number of researchers pointed at too radical differences from the accepted structure of the genus. Inconsistencies can be explained by the difficult interpretation of the results of phylogenetic analysis based on ITS and matK, in taxon, where hybridization and polyploidization played a significant evolutionary role [33].
Since the use of DNA barcoding does not enable unambiguous reconstruction of the phylogeny of Vaccinium genus, more time-consuming and expensive methods of molecular phylogenetics were used in genetic studies of economically important species. Recent assemblies of the genomes of V. macrocarpon, V. microcarpum (Turcz. ex Rupr.) Schmalh., V. oxycoccos L., and V. corymbosum made it possible to conduct their comparative genomics [34,35]. Molecular dating has shown that V. macrocarpon diverged from V. oxycoccos 2 mya, and from V. microcarpum 4.5 mya. Divergence time estimated for V. macrocarpon and V. corymbosum differs from 5 to 10.4 mya [34,35].
An analysis of the intra- and interspecific variability of American blueberry species by double digest restriction-site-associated DNA sequencing [36], showed that the rabbit eye blueberry and northern highbush blueberry are relatively homogeneous, but the southern highbush blueberry contains a significantly more mixed genetic background. Considering the pedigree of blueberries, the most optimal solution was to separate the entire dataset into nine hypothetical genomes, which correspond to the number of species actively used in breeding, V. darrowii Camp, V. elliottii Chapm, V. tenellum Ait., V. angustifolium Ait., V. corymbosum, V. constablaei A. Gray, V. virgatum Ait, V. myrtilloides Michx., and V. pallidum Ait. The trends identified in this way are consistent with the history of blueberry breeding [36].
Thereby, attempts to reconstruct the phylogenetic relationships of species of the genus Vaccinium by various methods have led to contradictory results. The use of phylogenetic markers ITS and matK leads to the construction of a phylogenetic tree with significant differences from the classical system. The use of more expensive and time-consuming methods of genome studies gives a more plausible picture, that is more consistent with the classical system. However, expensive methods can currently be applied to a narrow list of economically important species. For more extensive studies of various representatives of the genus, easy-to-use and cheap markers are required. They can be developed based on genome regions newly acquired in the course of evolution with a known structure and localization. An example of such sequences would be cellular T-DNA. Therefore, our study aims to characterize cellular T-DNA polymorphism in the genomes of plants of Vaccinium genus, and to evaluate the possibility of its application for phylogenetic studies of the genus.

2. Results

2.1. Vaccinium rolB/C-like Gene: General Description

Until recently, the rolB/C-like gene has been described only in V. corymbosum and V. macrocarpon. In the framework of this study, using BLAST algorithm, this gene was described in the WGS data for V. myrtillus and V. darrowii. Their ORFs correspond to the amino acid sequences from 290 (in V. myrtillus) to 292 amino acids (in V. macrocarpon).
In blueberries, the gene is located on chromosome 3 (in the cranberry genome, this region corresponds to chromosome 4). Located on both sides of it, at a distance of 5 kb, are genes of plant origin with functions that have not been described yet. No other agrobacterial genes were found in the genome of plants of Vaccinium genus.
Our search for homologues of the rolB/C-like gene in SRA database revealed new species of naturally transgenic plants in the Vaccinium genus, summarized in Table 1.
Natural GMOs were found in the sections Oxycoccoides, Oxycoccus, Cyanococcus, Hemimyrtillus, Myrtillus, Polycodium, Bracteata, Vaccinium, and Vitis-idaea, indicating that their common ancestor was transformed before the sections diverged.
Genomic data for different species varies in coverage quality. In some cases, the presence of a transgene can be inferred from single reads. In other cases (in V. selerianum, V. shastense, V. striicaule, V. symplocifolium, V. vidalii, and V. whitmeei), the transgene was not found at all, but this does not mean its absence from the genome, it indicates, however, that additional studies are required.
Sequences with good coverage were used further to assemble full-length sequences. For a deeper understanding of the gene variability, field material was collected, which was included in further variability analysis of the rolB/C-like gene. In all studied species, except for V. oxycoccos (see below), only full-length sequences of the roB/C-like gene were found.
When studying SNPs within full-length sequences, one can see that there are nucleotide differences characteristic of the species, distinguishing each of them from other representatives of the genus Vaccinium. They are represented by substitutions and indels. Moreover, indels are equal or multiples of three nucleotides. This is evidence in favor of the gene product functionality. Examples of such polymorphism can be SNPs in V. uliginosum and V. vitis-idaea shown in Figure S1, as well as indels in different Vaccinium species shown in Figure S2.
Modeling of protein structures based on the predicted amino acid sequences (Table S1) shows their similarity in representatives of the genus Vaccinium, as well as in Laccaria, Nyssa, and Ensifer. The closest of the described agrobacterial proteins is the RolB protein (Figure 1).
Collectively, these data allow us to outline the directions for future research in terms of these sequences’ functionality.

2.2. Intraspecific Variability of rolB/C-like Gene

To assess intraspecific variability of the rolB/C-like gene, we used sequences of several independent samples presented in the SRA for V. bracteatum, V. corymbosum, V. darrowii, V. dunalianum, V. macrocarpon, V. myrtillus, V. oxycoccos, V. uliginosum, V. virgatum/ashei, and V. vitis-idaea. In addition, samples of V. myrtillus, V. oxycoccos, V. uliginosum, and V. vitis-idaea collected from different geographic locations were characterized for polymorphism of the studied gene. For each genotype, alleles were reconstructed, based on Sanger sequencing data, or SRA reads.
PCR with primers VaccR and VaccF, followed by sequencing of the products have shown that 8 out of 15 samples of V. oxycoccos were homozygous for a deletion spanning from nucleotides 198 to 800 of CDS (Figure 2). Three samples had deletions other than the most common. They spanned nucleotides 354–798, 390–548, and 159 to the end of the gene, respectively. Four samples contained full size genes. All samples of other species contained only full-size intact genes.
Within each species, there are SNPs represented by nucleotide substitutions that distinguish different alleles of a gene from each other. Based on these data, we can assess the diversity of alleles within a species, the frequency of occurrence of homo- and heterozygotes in populations, and the geographical distribution of alleles for some species. Data on the number of investigated alleles are presented in Table 2. Figure 3 shows allele frequency diagrams for Vaccinium species. This diagram does not claim to be an accurate estimate of allele frequencies, however, it stimulates the consideration that there are more common and rarer alleles. For example, A in V. vitis-idaea was found in most of the analyzed samples. The remaining alleles were found in a smaller number of samples and sometimes specific for certain locations. The proportion of homo- and heterozygotes and allelic diversity differ in the studied species, which can be explained by different reproduction biology. For example, blueberry species are more prone to cross-pollination, compared to cranberries.
Reconstruction of the phylogenetic relationships, based on molecular genetic studies of taxonomically significant regions of DNA, often relies on the evaluation of single specimens from the studied species. To avoid possible mistakes, especially when working with new markers, it is logical to test them out on a wider material. Since we used samples from collection points that are geographically distant from each other, it was decided to compare interspecific and intraspecific differences between them. Independent alleles were used for phylogenetic tree construction. Only full-length sequences were included in the analysis (Figure 4).
The resulting phylogenetic tree, in general, was consistent with our expectations. A total of 8 clades, that mostly correspond to analyzed species, can be distinguished on this tree. Interestingly, the clades represented by wild species (A, B, E, F) are homogeneous, despite the wide geography of sampling. At the same time, clades D and H are mosaic. Clade H is represented by alleles from V. virgatum and V. ashei Reade. Species name given by the authors of sequences was kept, but at the same time, we understand them as synonyms and refer them to the same species. Two V. corymbosym alleles C and E are noted in this clade. Both of them belong to the variety Draper, in the breeding of which V. virgatum and V. darrowii were involved [37]. Clade G consists of the related species V. corymbosum and V. darrowii, with an admixture of two alleles of V. virgatum. Their presence may be explained by hybridization during development of cultivars of North American Rabbit-eye blueberries.
V. macrocarpon and V. oxycoccos are related species that form clade D. These species require more detailed study in the future, since the American cranberry is a cultivated species, and, therefore, hybridization was used in the early stages of its breeding. In turn, swamp cranberries are the only species known today where the transgene was extensively mutated in many of the studied samples.
In general, our studies have shown that, at least in the analyzed species, the intraspecific variability of transgene is lower than interspecific, and the mosaic distribution of alleles on the tree in American blueberries can be explained in terms of interspecific hybridization documented during the creation of studied varieties.
Therefore, we compiled consensus sequences, as a characteristic of each of the species analyzed at the previous stage, and supplemented this list with sequences obtained on the basis of gene sequences we obtained from single samples of the collection of the Komarov Botanical Institute.

2.3. Reconstruction of Phylogenetic Relationship of Vaccinium Species Based on rolB/C-like Sequence

In the final part of this study, several types of data were used. First of which, were the consensus sequences of the rolB/C-like gene of species studied in the previous stage. Alleles of presumably hybrid origin were excluded at the stage of constructing consensus sequences.
In addition, sequences of species sufficient for gene assembly but not sufficient for allele phasing were included in our analysis.
Finally, we obtained sequences of the rolB/C-like gene from additional species, represented by single samples in the collection of the Komarov Botanical Institute.
The phylogenetic tree presented in Figure 5 included, in addition to studied above, such species as V. myrtilloides (Sec. Cyanococcus), V. ovalifolium Sm. (Sec. Myrtillus), V. praestans Lamb. (Sec. Praestantia), V. smallii A. Gray (Sec. Hemimyrtillus), V. vulcanorum Kom. (Sec. Vaccinium), V. conchophyllum Rehder, V. emarginatum Hayata (Sec. Conchophyllum), and Agapetes serpens (Wight) Sleumer (based on previous studies, Agapetes can be considered a closely related genus in relation to Vaccinium, so its involvement in the work seems logical) [31].
As can be seen from Figure 5, species assigned to the same section in the classical system of Vaccinium genus are clustered together when constructing a tree based on the proposed DNA marker. Marked with ovals in Figure 5.
Another phylogenetic tree was constructed based on ITS sequences of samples studied in this work, combined with sequences from Kron et al. research [31]. This tree is presented in Figure 6. We can distinguish Andean, Meso-American/Caribbean, East Malaysian, Agapetes, Bracteata-Oarianthe, Orthaea/Notopora, Myrtillus, and Vaccinium clades, which were previously identified by Kron et al., composition of these clades differs significantly from the traditional taxonomy. Thereby, species V. macrocarpon and V. oxycoccos belong to the section Oxycoccus, but on ITS tree these species are separated by species V. vitis-idaea, which belongs to the section Vitis-idaea, Clade Myrtillus unites species of sections Myrtillus and Macropelma. Clade Bracteata-Oarianthe also includes species from sections Hemimyrtillus, Oarianthe, Bracteata, and Baccula-Nigra. Clade Agapetes includes representatives of genus Agapetes and some representatives of genus Vaccinium from sections Rigiolepis, Conchophyllum, and Galeopetalum, while some other species from these sections are spread over the tree. Orthaea/Notopora clade includes representatives of different genera, Notopora, Orthaea, and Vaccinium. The combination of Vaccinium representatives with other genera is also characteristic of Meso-American/Caribbean clades, which includes a representative of section Oreades.
There are much fewer of such contradictions in the phylogenetic tree based on the rolB/C-like gene.

3. Discussion

Vaccinium is the fifth genus of natural GMOs after Nicotiana, Linaria, Ipomoea, and Camellia, where the cT-DNA structure was characterized in greater detail in many species. [11,13,14,23].
In addition to the unusual plast-gene found in plant genomes, a distinguishing feature of the Vaccinium genus is also the fact that the gene has been preserved intact in most of the studied species. The plast-genes family includes most of the oncogenes of R. rhizogenes (coding for RolB, RolC, Orf13, and Orf14 proteins), and some T-DNA genes of A. tumefaciens (coding for p5, p7, 6a, 6b) [38]. They have also been found in naturally transgenic plants, fungi, and some other bacteria [10,13,14,38]. Plast genes were described in detail in the review by Leon Otten [38], where he defined them on the basis of weak, but significant, protein similarity, and highlighted their capacity to change plant development, being introduced into plant genomes during the genetic transformation process. Levesque et al. [39] suggested that plast genes could have similar functions because of their common ancestry, and their diversification could be an adaptation to different plant species. Describing the biodiversity of plast genes can be very important in order to find their basic function and some common features of all these genes. In this regard, the discovery of plast genes, that are not quite similar to previously known ones (as in our case), is very valuable for future research.
In accordance with the analysis of previously assembled genomes and sequences, the representatives of two Vaccinium subgenera and Agapetes have a common localization site of the rolB/C-like sequence in the genome. This indicates a common origin of the sequence, as a result of a single transformation event of the ancestral form, and, accordingly, the monophyletic origin of all species containing transgene, included in our analysis. During evolution, the newly acquired sequence seems to have accumulated mutations. This variability can be assessed and used to estimate species divergence.
This is very important for the Vaccinium genus since there is still no consensus on the genus system.
Phylogenetic studies of the Vaccinium genus have been conducted since the middle of last century [26,27]. The traditional system of the genus involves its division into 2 subgenera and 33 sections. This division is based on morphological features [30]. The use of DNA barcoding methods showed the polyphyletic nature of the genus. At the same time, the construction of phylogenetic trees, based on ITS and matK, revealed contradictions with the traditional system. The trees constructed using ITS sequences by Kron et al. [31], and reconstructed in our study, based on an extended list of species, have shown a similar topology. They contained several well-maintained clades, such as Andean; Mesoamerican/Caribbean; East Malaysian; Agapetes, consisting of some Asiatic Vaccinium and Agapetes; Bracteata-Oarianthe, uniting representatives of the respective sections; Orthaea/Notopora, which includes the genera Orthaea and Notopora; Myrtillus; and Vaccinium. These clades contained species of the genus Vaccinium, which, in previous classifications, belonged to different sections. Moreover, representatives of the oxycoccus subgenus were separated on the tree by V. vitis-idea. Representatives of the Cyanococcus section also fell into different clades, clustering with species of other sections.
This contradiction could be related to the manifestation peculiarities of used DNA markers in species of hybrid origin. The ITS of hybrid species retain the features of only one parent, and chloroplast markers are inherited mainly through the maternal line [40]. At the same time, the phylogeny based on genomic data is in better agreement with the traditional system [34,35,41,42]. Collectively, these data indicate that additional research is required, including the search for new cheap and reliable markers for the molecular phylogeny of Vaccinium.
In this article, we propose such a marker. An important feature of the work carried out by us was the use of a large number of forms of cranberries, lingonberries, and blueberries of different geographical origin, as well as the phasing of natural transgene alleles using SRA data in order to assess intraspecific variability. Such an approach was first used to study cellular T-DNA of representatives of the Camellia genus [23]. The analysis of individual alleles in phylogenetic studies makes it possible to identify acts of hybridization, including interspecific hybridization. This is important to understand when assessing the degree of speciation. Alleles identification makes it possible to better describe intraspecific variability in order to assess the occurrence of alleles and their geography. In the future, this marker can be used to describe the allelic state of a gene in various populations in order to mark them and control unauthorized picking of wild berries. In addition to the general assessment of variability, the description of alleles makes it possible to identify the facts of hybridization in the pedigree of specific isolates, varieties, lines of cultivated Vaccinium plants, as well as to identify homo- and heterozygotes for this marker. This may be useful in interpreting controversial results of the origin of hybrid forms, as well as illustrating the incomplete isolation of species, as previously demonstrated in case of the genus Camellia [23].
Based on the phylogenetic analysis of allelic variants, obtained in our research, it can be concluded that intraspecific variability of marker in Vaccinium is less than the interspecific one. Therefore, it can be used to study the phylogenetic relationships of Vaccinium species.
A phylogenetic analysis of the genus Vaccinium was performed, using sequences of the rolB/C-like gene, as well as ITS sequences from previous studies [31], supplemented by sequences of our samples. The addition of new species to phylogenetic analysis, based on ITS, did not significantly change the topology of the tree.
The comparison of trees built based on ITS and rolB/C-like gene shows that they have similarities and differences. Species of Myrtillus section (V. myrtillus and V. ovalifolium) cluster together in both trees. Species of Cyanococcus section are clustered on both trees in a similar way. No other similarities in the topology of these trees were found. Species V. conchophyllum and V. emarginatum belonging to section Conchophyllum cluster together on the rolB/C-like tree, but not on ITS tree. Species V. macrocarpon and V. oxycoccos from section Oxycoccus, V. vulcanorum and V. uliginosum from section Vaccinium form separate clades on the rolB/C-like tree, but are scattered across different parts of the ITS tree.
Bracteata, Hemimyrtillus, Vitis-idaea, Oxycoccoides, and Praestantia sections are represented by single species on the rolB/C-tree. These sections require additional research involving new species. Reconstruction of phylogeny using the rolB/C-like gene is consistent with data obtained by other researchers using more expensive and time-consuming methods [34,35,42].
Therefore, a phylogeny, built on the basis of the rolB/C-like gene, has fewer contradictions with classical ideas, compared to a tree built based on ITS. The rolB/C-like gene, as a molecular marker, is cheap, easy to use, and is not time consuming. Given minimal amounts of biological material, new species can easily be included in further analyses.

4. Materials and Methods

4.1. Plant Material

Plant material was represented by samples of Vaccinium myrtillus L., V. oxycoccos, V. vitis-idaea L., and V. uliginosum L., collected from various habitats in Russia and Belgium. Samples of 9 species of the studied genus were taken from the collection of the Komarov Botanical Institute (St. Petersburg, Russia). A detailed description of the samples is presented in Table S2.

4.2. SRA Data

Sequences of Vaccinium species from SRA database, used in this study are presented in Table S3.

4.3. DNA Isolation

Leaves and stems of plants were grounded in liquid nitrogen. Plant DNA was isolated by a CTAB method described by Draper and co-authors [43].

4.4. PCR

Type I. Classic PCR was performed using the primers shown in Table 3, in the Tercyc gene cycler (DNA Technology, Moscow, Russia). Primers were selected on the basis of cranberry genome fragment (JOTO01169953.1). The 40 µL reaction mixture contained DreamTaq Green PCR Master Mix (2X) buffer (Thermo Fisher, Waltham, MA, USA), 100 ng DNA, and 10 µM primers. The following program was used for PCR, 5 min at 93 °C; 40 cycles of 17 s at 93 °C, 30 s at X °C and 90 s at 72 °C; then 5 min at 72 °C, where X was the annealing temperature, depending on the primers used.
Type II. Real-time PCR from colonies was performed for additional control of early threshold values to search for clones containing the target insert. Real-time PCR was carried out in ANK-32 cycler (Sintol, Moscow, Russia). Primers for plasmid pJET1.2 from the CloneJET PCR Cloning Kit (Thermo Fisher, Waltham, MA, USA) were used in the reaction. The 20 μL of the reaction mixture contained SsoAdvanced Universal SYBR Green Supermix buffer (Bio-Rad, Hercules, CA, USA), 10 μM primers, and a suspension of E. coli bacterial cells taken from a colony of transformants. The following program was used for real-time PCR: 60 s at 50 °C, 40 cycles of 5 min at 95 °C, 30 s at 58 °C, 60 s 72 °C, and 18 s at 95 °C.
PCR products were separated on agarose gel in 1x TBE buffer and visualized using GelDoc Go (BioRad, Hercules, CA, USA).

4.5. Molecular Cloning

PCR products were cloned into pJET1.2 vector, using CloneJET PCR Cloning Kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer instructions, and transformed into DH5 alpha chemically competent cells according to Inoue and co-authors [44].

4.6. DNA Sequencing

PCR fragments were sequenced using Sanger method, and BrilliantDye™ Terminator (v3.1) Cycle Sequencing Kit (NimaGen, Nijmegen, The Netherlands). Then, sequencing mixtures were separated at the Resource Center of St. Petersburg University “Development of Molecular and Cellular Technologies” using an ABI Prism 3500 xl sequencer (Applied Biosystems, Waltham, MA, USA).

4.7. Allele Reconstruction from Sanger Sequencing Data

In order to determine the sequences of alleles, we represented in binary form each sample as a set of polymorphic positions, where “1” indicates the most frequent nucleotide in a given position in the species, and “0” the least frequent. Then, for each sample, all possible combinations of values were written for polymorphic positions. Since homozygotes and samples with one SNP were found among the samples, we were able to obtain a primary pool of alleles, and these alleles were subsequently found in the remaining samples. Since each of these alleles, in a diploid, must match to an allele with alternative values in polymorphic positions, a homologous pair can be found for the primary allele [45].
In cases where the number of sequences was insufficient to resolve the set of sequences per allele, they were cloned into pJET 1.2 according to Clone Jet PCR Cloning Kit (Thermo Fisher Scientific, Waltham, MA, USA) manufacturer’s instructions. Then, inserts from individual clones, that represent individual alleles, were sequenced.

4.8. Allele Phasing

The NCBI SRA database was used to search for T-DNA in the Vaccinium genus. The search was carried out using BLAST against the reference (JOTO01169953.1). Resulting reads were aligned to the reference using BWA 0.7.17 [46]. The processing of SAM files was carried out in SAMtools 1.7 [47]. The alignment visualization for ploidy estimation was performed in IGV 2.12.3 [48]. Allele phasing was performed using variant calling with GATK 4.2 [49] followed by WhatsHap 1.0 [50]. Additionally, the SAMtools phase was used for alternative analysis. In the case of small coverage, alleles were phased manually, with some only partially successful. Upon the assumption of SNP being artificial, its presence was verified in other samples.

4.9. Phylogenetic Analysis

Sequences were aligned using the MAFFT online service for multiple sequence alignment [51]. The evolutionary history was inferred by using the Maximum Likelihood method and General Time Reversible model [52]. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. Trees were drawn to scale, with branch lengths measured in the number of substitutions per site. All positions with less than 95% site coverage were eliminated, i.e., fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position (partial deletion option). Evolutionary analyses were conducted in MEGA11 [53].

4.10. Prediction of Protein’s Structure

AlphaFold prediction [54] of the structures of various Plast-proteins was made using the Colabfold web resource at https://colab.research.google.com/github/sokrypton/ColabFold/blob/main/AlphaFold2.ipynb (accessed on 18 April 2022), using default settings.

5. Conclusions

In this study, new species of natural GMOs were described within the genera Vaccinium and Agapetes. The natural transgene of these plants can be used for phylogenetic studies of the genus. This nuclear marker is cheap, easy to use, and is not time consuming. It can also be recommended for further research. The allele phasing approach makes it possible to track hybridization events in the evolution of studied plants. Data, regarding intraspecific variability of the proposed marker, can be used to mark populations of wild berries of the Vaccinium genus, in order to prevent their unauthorized harvesting.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24086932/s1.

Author Contributions

Investigation, Writing—original draft, R.Z.; Software, Writing—original draft, P.Z.; Resources, Software, O.B.; Investigation, E.G.; Resources, I.K. and D.A.; Conceptualization, Investigation, Methodology, Project administration, Resources, Writing—original draft, Writing—review and editing, T.M. All authors have read and agreed to the published version of the manuscript.

Funding

The work was performed using the equipment of the Resource Center of Saint Petersburg State University “Development of Molecular and Cellular Technologies” with the support of the Ministry of Science and Higher Education of the Russian Federation in accordance with agreement No. 075-15-2022-322 dated 22 April 2022 on the provision of a grant in the form of a subsidy from the Federal budget of the Russian Federation. The grant was provided as part of the state support for the creation and development of the world-class Scientific Center “Agrotechnologies for the Future”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The sequences obtained during the work were deposited into the National Center for Biotechnology Information database (https://www.ncbi.nlm.nih.gov/ (accessed on 26 February 2023) with accession numbers OQ095269-OQ095321, OQ129379-OQ129399, OQ311354, OQ311356, OQ311358-OQ311360, and OQ519855.

Acknowledgments

We are grateful to Shevchuk S. V. for the kind provision of the vaccinium material from the collection of the Russian Academy of Sciences Vladimir Komarov Botanical Institute’s Botanical Garden of Peter the Great, which he supervises.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chilton, M.-D.; Drummond, M.H.; Merlo, D.J.; Sciaky, D.; Montoya, A.L.; Gordon, M.P.; Nester, E.W. Stable incorporation of plasmid DNA into higher plant cells: The molecular basis of crown gall tumorigenesis. Cell 1977, 11, 263–271. [Google Scholar] [CrossRef] [PubMed]
  2. Zhu, J.; Oger, P.M.; Schrammeijer, B.; Hooykaas, P.J.J.; Farrand, S.K.; Winans, S.C. The bases of crown gall tumorigenesis. J. Bacteriol. 2000, 182, 3885–3895. [Google Scholar] [CrossRef] [PubMed]
  3. Nester, E.W. Agrobacterium: Nature’s genetic engineer. Front. Plant Sci. 2015, 5, 730. [Google Scholar] [CrossRef] [PubMed]
  4. Gelvin, S.B. Integration of Agrobacterium T-DNA into the plant genome. Annu. Rev. Genet. 2017, 51, 195–217. [Google Scholar] [CrossRef] [PubMed]
  5. Lacroix, B.; Citovsky, V. Pathways of DNA transfer to plants from Agrobacterium tumefaciens and related bacterial species. Ann. Rev. Phytopath. 2019, 57, 231–251. [Google Scholar] [CrossRef]
  6. Matveeva, T.V.; Otten, L. Widespread occurrence of natural transformation of plants by Agrobacterium. Plant Mol. Biol. 2019, 101, 415–437. [Google Scholar] [CrossRef]
  7. Tepfer, D. Genetic transformation using Agrobacterium rhizogenes. Physiol. Plant 1990, 79, 140–146. [Google Scholar] [CrossRef]
  8. Christey, M.C. Use of Ri-mediated transformation for production of transgenic plants. In Vitro Cell. Dev. Biol.-Plant 2001, 37, 687–700. [Google Scholar] [CrossRef]
  9. Lütken, H.; Clarke, J.L.; Müller, R. Genetic engineering and sustainable production of ornamentals: Current status and future directions. Plant Cell Rep. 2012, 31, 1141–1157. [Google Scholar] [CrossRef]
  10. White, F.F.; Garfinkel, D.J.; Huffman, G.A.; Gordon, M.P.; Nester, E.W. Sequence homologous to Agrobacterium rhizogenes T-DNA in the genomes of uninfected plants. Nature 1983, 301, 348–350. [Google Scholar] [CrossRef]
  11. Furner, I.J.; Huffman, G.A.; Amasino, R.M.; Garfinkel, D.J.; Gordon, M.P.; Nester, E.W. An Agrobacterium transformation in the evolution of the genus. Nicotiana. Nat. 1986, 319, 422–427. [Google Scholar] [CrossRef]
  12. Suzuki, K.; Yamashita, I.; Tanaka, N. Tobacco plants were transformed by Agrobacterium rhizogenes infection during their evolution. Plant J. 2002, 32, 775–787. [Google Scholar] [CrossRef]
  13. Matveeva, T.V.; Bogomaz, D.I.; Pavlova, O.A.; Nester, E.W.; Lutova, L.A. Horizontal gene transfer from genus Agrobacterium to the plant Linaria in nature. Mol. Plant Microbe Interact. 2012, 25, 1542–1551. [Google Scholar] [CrossRef]
  14. Kyndt, T.; Quispe, D.; Zhai, H.; Jarret, R.; Ghislain, M.; Liu, Q.; Gheysen, G.; Kreuze, J.F. The genome of cultivated sweet potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop. Proc. Natl. Acad. Sci. USA 2015, 112, 5844–5849. [Google Scholar] [CrossRef]
  15. Zhang, Y.; Wang, D.; Wang, Y.; Dong, H.; Yuan, Y.; Yang, W.; Lai, D.; Zhang, M.; Jiang, L.; Li, Z. Parasitic plant dodder (Cuscuta spp.): A new natural Agrobacterium-to-plant horizontal gene transfer species. Sci. China Life Sci. 2020, 63, 312–316. [Google Scholar] [CrossRef]
  16. Matveeva, T.V. New naturally transgenic plants: 2020 up-date. Biol. Commun. 2021, 66, 36–46. [Google Scholar] [CrossRef]
  17. Bogomaz, F.D.; Matveeva, T.V. Expression sequences of opine synthase genes in natural GMOs based on analysis of their transcriptomes. Plant Biotechnol. Breed. 2022, 5, 15–24. [Google Scholar] [CrossRef]
  18. Lipatov, P.Y.; Bogomaz, F.D.; Gosudarev, K.D.; Kondrashova, S.A.; Kuchevsky, M.V.; Malyuga, N.L.; Myagkiy, E.V.; Sergeenkova, M.V.; Tverdokhlebova, V.R.; Shtina, A.D.; et al. New cellular T-DNAs in naturally transgenic plants. Ecol. Genet. 2022, 20, 40–41. [Google Scholar] [CrossRef]
  19. Matveeva, T.V. Why do plants need agrobacterial genes? Ecol. Genet. 2021, 19, 365–375. [Google Scholar] [CrossRef]
  20. Matveeva, T.V. Agrobacterium-mediated transformation in the evolution of plants. Curr. Top. Microbiol. Immun. 2018, 418, 421–441. [Google Scholar] [CrossRef]
  21. Quispe-Huamanquispe, D.G.; Gheysen, G.; Yang, J.; Jarret, R.; Rossel, G.; Kreuze, J.F. The horizontal gene transfer of Agrobacterium T-DNAs into the series batatas (Genus Ipomoea) genome is not confined to hexaploid sweetpotato. Sci. Rep. 2019, 9, 12584. [Google Scholar] [CrossRef]
  22. Khafizova, G.V.; Matveeva, T.V. Agrobacterium-mediated transformation of Nicotiana glauca and Nicotiana sylvestris. Vavilovskii Zhurnal Genetiki I Selektsii 2022, 26, 697–703. [Google Scholar] [CrossRef]
  23. Chen, K.; Zhurbenko, P.; Danilov, L.; Matveeva, T.; Otten, L. Conservation of an Agrobacterium cT-DNA insert in Camellia section Thea reveals the ancient origin of tea plants from a genetically modified ancestor. Front. Plant Sci. 2022, 13, 997762. [Google Scholar] [CrossRef]
  24. Zhurbenko, P.M.; Klimenko, F.N. PhaseAll: A simple tool for read-based allele phasing. Ecol. Genet. 2022, 20, 32. [Google Scholar] [CrossRef]
  25. Index Nominum Genericorum. Available online: https://naturalhistory2.si.edu/botany/ing/ (accessed on 30 December 2022).
  26. Vorsa, N.; Zalapa, J. Domestication, Genetics, and Genomics of the American Cranberry. Plant Breed. Rev. 2019, 40, 279–315. [Google Scholar] [CrossRef]
  27. Camp, W.H. On the Structure of Populations in the Genus Vaccinium. Brittonia 1942, 4, 189–204. [Google Scholar] [CrossRef]
  28. Camp, W. The North American blueberries with notes on other groups of Vacciniaceae. Brittonia 1945, 5, 203–275. [Google Scholar] [CrossRef]
  29. Hancock, J.; Lyrene, P.; Finn, C.; Vorsa, N.; Lobos, G. Blueberries and Cranberries. Temp. Fruit Crop Breed. 2008, 115–150. [Google Scholar] [CrossRef]
  30. Vander Kloet, S.P. The Genus Vaccinium in North America; Agriculture Canada: Ottawa, ON, Canada, 1988. [Google Scholar]
  31. Kron, K.; Powell, E.; Luteyn, J. Phylogenetic relationships within the blueberry tribe (Vaccinieae, Ericaceae) based on sequence data from matK and nuclear ribosomal ITS regions, with comments on the placement of Satyria. Am. J. Bot. 2002, 89, 327–336. [Google Scholar] [CrossRef]
  32. Powell, E.; Kron, K. Molecular Systematics of the Northern Andean Blueberries (Vaccinieae, Vaccinioideae, Ericaceae). Int. J. Plant Sci. 2003, 164, 987–995. [Google Scholar] [CrossRef]
  33. Soltis, D.; Mavrodiev, E.; Doyle, J.; Rauscher, J.; Soltis, P. ITS and ETS Sequence Data and Phylogeny Reconstruction in Allopolyploids and Hybrids. Syst. Bot. 2008, 33, 7–20. [Google Scholar] [CrossRef]
  34. Diaz-Garcia, L.; Garcia-Ortega, L.; González-Rodríguez, M.; Delaye, L.; Iorizzo, M.; Zalapa, J. Chromosome-Level Genome Assembly of the American Cranberry (Vaccinium macrocarpon Ait.) and Its Wild Relative Vaccinium microcarpum. Front. Plant Sci. 2021, 12, 137. [Google Scholar] [CrossRef] [PubMed]
  35. Kawash, J.; Colt, K.; Hartwick, N.T.; Abramson, B.W.; Vorsa, N.; Polashock, J.J.; Michael, T.P. Contrasting a reference cranberry genome to a crop wild relative provides insights into adaptation, domestication, and breeding. PLoS ONE 2022, 17, e0264966. [Google Scholar] [CrossRef] [PubMed]
  36. Nishiyama, S.; Fujikawa, M.; Yamane, H.; Shirasawa, K.; Babiker, E.; Tao, R. Genomic insight into the developmental history of southern highbush blueberry populations. Heredity 2020, 126, 194–205. [Google Scholar] [CrossRef] [PubMed]
  37. Hancock, J. Blueberry Plant Denominated ‘Draper’. U.S. Patent No. USPP15103P3, 23 January 2003. [Google Scholar]
  38. Otten, L. The Agrobacterium Phenotypic Plasticity (Plast) Genes. Agrobacterium Biol. 2018, 418, 375–419. [Google Scholar] [CrossRef]
  39. Levesque, H.; Delepelaire, P.; Rouzé, P.; Slightom, J.; Tepfer, D. Common evolutionary origin of the central portions of the Ri TL-DNA of Agrobacterium rhizogenes and the Ti T-DNAs of Agrobacterium tumefaciens. Plant Mol. Biol. 1988, 11, 731–744. [Google Scholar] [CrossRef]
  40. Rodionov, A.V.; Amosova, A.V.; Belyakov, E.A.; Zhurbenko, P.M.; Mikhailova, Y.V.; Punina, E.O.; Shneyer, V.S.; Loskutov, I.G. Genetic Con-sequences of Interspecific Hybridization, Its Role in Speciation and Phenotypic Diversity of Plants. Russ. J. Genet. 2019, 55, 278–294. [Google Scholar] [CrossRef]
  41. Zhidkin, R.R.; Matveeva, T.V. Phylogeny problems of the genus Vaccinium L. and ways to solve them. Ecol. Genet. 2022, 20, 151–164. [Google Scholar] [CrossRef]
  42. Schlautman, B.; Covarrubias-Pazaran, G.; Fajardo, D.; Steffan, S.; Zalapa, J. Dis-criminating power of microsatellites in cranberry organelles for taxonomic studies in Vaccinium and Ericaceae. Genet. Resour. Crop Evol. 2016, 64, 451–466. [Google Scholar] [CrossRef]
  43. Draper, J.; Scott, R.; Armitage, P.; Walden, R. Plant Genetic Transformation and Gene Expression—A Laboratory Manual; Blackwell Science: Oxford, UK, 1988. [Google Scholar]
  44. Inoue, H.; Nojima, H.; Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene 1990, 96, 23–28. [Google Scholar] [CrossRef]
  45. Zhidkin, R.R.; Zhurbenko, P.M.; Gorodilova, E.Y.; Matveeva, T.V. Molecular genetic and bioinformatic approaches for the allele reconstruction of the rolB/C-like gene in representatives of the genus Vaccinium L. Ecol. Genet. 2022, 22, 36–37. [Google Scholar] [CrossRef]
  46. Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 2013, arXiv:1303.3997. [Google Scholar] [CrossRef]
  47. Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. GigaScience 2021, 10, 10–14. [Google Scholar] [CrossRef]
  48. Robinson, J.T.; Thorvaldsdóttir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef]
  49. Van der Auwera, G.A.; O’Connor, B.D. Genomics in the Cloud: Using Docker, GATK, and WDL in Terra, 1st ed.; O’Reilly Media: Sebastopol, CA, USA, 2020. [Google Scholar]
  50. Martin, M.; Patterson, M.; Garg, S.; OFischer, S.; Pisanti, N.; WKlau, G.; Schöenhuth, A.; Marschall, T. WhatsHap: Fast and accurate read-based phasing. bioRxiv 2016. [Google Scholar] [CrossRef]
  51. Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000. [Google Scholar]
  52. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  53. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  54. Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef]
Figure 1. Predicted structures of various Plast-proteins. (A) RolB/C-protein from plants and fungus; (B) various plast-proteins from Agrobacterium. Abbreviations: Vm—V. macrocarpon, Vu—V. uliginosum, Vv—V. vitis-idaea, Lt—L. trichodermophora, Ns—N. sinensis, Rr—R. rhizogenes, and At—A. tumefaciens.
Figure 1. Predicted structures of various Plast-proteins. (A) RolB/C-protein from plants and fungus; (B) various plast-proteins from Agrobacterium. Abbreviations: Vm—V. macrocarpon, Vu—V. uliginosum, Vv—V. vitis-idaea, Lt—L. trichodermophora, Ns—N. sinensis, Rr—R. rhizogenes, and At—A. tumefaciens.
Ijms 24 06932 g001
Figure 2. PCR products containing the rolB/C-like gene in cranberry samples. (M) Molecular Weight Marker GeneRulerTM 1 kb DNA Ladder (Thermo Fisher Scientific, USA); (C) negative control; (1,2,3)—V. oxycoccos (samples 1,2—full size, 3—the most common deletion); and (4) V. macrocarpon.
Figure 2. PCR products containing the rolB/C-like gene in cranberry samples. (M) Molecular Weight Marker GeneRulerTM 1 kb DNA Ladder (Thermo Fisher Scientific, USA); (C) negative control; (1,2,3)—V. oxycoccos (samples 1,2—full size, 3—the most common deletion); and (4) V. macrocarpon.
Ijms 24 06932 g002
Figure 3. Frequencies of alleles of rolB/C-like gene in Vaccinium species.
Figure 3. Frequencies of alleles of rolB/C-like gene in Vaccinium species.
Ijms 24 06932 g003
Figure 4. Phylogenetic relationships of alleles of Vaccinium rolB/C-like gene based on Maximum Likelihood method and General Time Reversible model (There were a total of 657 positions in the final dataset). (A) V. myrtillus, (B) V. vitis-idaea, (C) V. japonicum, (D) section Oxycoccus, (E) V. bracteatum, (F) V. uliginosum, (G,H) section Cyanococcus.
Figure 4. Phylogenetic relationships of alleles of Vaccinium rolB/C-like gene based on Maximum Likelihood method and General Time Reversible model (There were a total of 657 positions in the final dataset). (A) V. myrtillus, (B) V. vitis-idaea, (C) V. japonicum, (D) section Oxycoccus, (E) V. bracteatum, (F) V. uliginosum, (G,H) section Cyanococcus.
Ijms 24 06932 g004
Figure 5. Molecular phylogenetic analysis of Vaccinium based on the rolB/C-like gene using Maximum Likelihood method and General Time Reversible model (There were a total of 667 positions in the final dataset). Representatives of the same section are circled in ovals.
Figure 5. Molecular phylogenetic analysis of Vaccinium based on the rolB/C-like gene using Maximum Likelihood method and General Time Reversible model (There were a total of 667 positions in the final dataset). Representatives of the same section are circled in ovals.
Ijms 24 06932 g005
Figure 6. Molecular phylogenetic analysis of tribe Vaccinieae based on ITS sequences using Maximum Likelihood method and General Time Reversible model (There were a total of 651 positions in the final dataset). Species with sequences obtained by us are highlighted in red.
Figure 6. Molecular phylogenetic analysis of tribe Vaccinieae based on ITS sequences using Maximum Likelihood method and General Time Reversible model (There were a total of 651 positions in the final dataset). Species with sequences obtained by us are highlighted in red.
Ijms 24 06932 g006
Table 1. Natural transgene of Vaccinium species, based on NGS data.
Table 1. Natural transgene of Vaccinium species, based on NGS data.
SectionSpeciesNGS DataSRR Accession
Number(s)
Oxycoccoides (Hooker f.) SleumerV. japonicum Miq.rolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR13349629
Oxycoccus (Hill) KochV. macrocarpon AitonrolB/C-like gene described earlier, in new SRA data coverage is sufficient to assemble a full-length geneSRR13376387
SRR13376383
SRR13376388
V. oxycoccos L.rolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR14876344
Cyanococcus A. GrayV. virgatum Aiton/V. ashei ReaderolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR12686860
SRR12686864
V. darrowii CamprolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR13865261
SRR15673719
V. corymbosum L.rolB/C-like gene was described earlier, in new SRA data coverage is sufficient to assemble a full-length geneSRR8298002
SRR8298006
V. stenophyllum Steud.rolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19401505
V. tenellum AitonrolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19908712
Hemimyrtillus SleumerV. smallii A. GrayrolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19400793
Myrtillus DumortierV. myrtillus L.rolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR7523927
SRR7523930
SRR7523926
V. scoparium Leiberg ex CovillerolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19405468
V. yatabe MakinorolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19400792
Polycodium (Rafinesque) RehderV. stamineum L.rolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19401493
Pseudocephalanthos C.Y.Wu and R.C.Fang.V. dunalianum WightrolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR7768528
SRR2057022
Bracteata J.J. SmithV. bracteatum Thunb.rolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR17459400
SRR17459403
SRR17459408
V. wrightii A.GrayrolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19401672
Vaccinium L.V. uliginosum L.rolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR7686610
SRR7686609
Vitis-idaea (Moench) KochV. vitis-idaea L.rolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR5799277
SRR5799278
SRR5799279
Relation to any section is not definedV. talamancense (Wilbur and Luteyn) LuteynrolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19401435
V. schoddei SleumerrolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19401400
V. stanleyi SchweinfrolB/C-like gene is present in the genome, and coverage is sufficient to assemble a full-length geneSRR19354672
V. wollastonii WernhamrolB/C-like gene is present in the genome, but coverage is not sufficient to assemble a full-length geneSRR19401324
Table 2. Studied genotypes of Vaccinium and their allelic status.
Table 2. Studied genotypes of Vaccinium and their allelic status.
SpeciesNumber of
Genotypes
Number of Unique
Alleles
Number of
Homozygotes
Number of HeterozygotesPloidy of
Studied Species
Max.
Alleles per Plant
V. myrtillus1310103Diploids2
V. corymbosum2602Tetraploids4
V. macrocarpon3130Diploids1
V. oxycoccos4431Diploids, tetraploids and hexaploids2
V. virgatum/ashei5932Hexaploids3
V. japonicum2220Diploids1
V. vitis-idaea189513Diploids2
V. uliginosum1418014Diploids, tetraploids and hexaploids3
V. dunalianum2120Diploids1
V. bracteatum3512Diploids2
V. darrowii2302Diploids2
Table 3. Primers used in the work.
Table 3. Primers used in the work.
PrimersTmAmplicon SizePurpose of Use
NameSequence
VaccFvntcctaaccctaaccctgacc501503Amplification of the entire gene and flanking sequences
VaccRvnaactcgtgattgtacctcgtt
VaccRttactggccggtcctcatca551002Amplification and sequencing of the entire gene
VaccFcacgtgtaaagcccgtgatgtt
Vacc_ts_Ftaaagcctgccactgcgatt55838Efficient amplification of 838 out of 876 bp of coding sequence in any of studied Vaccinium genotype
Vacc_ts_pRccaatcgccacgagtaactaac
Vacc_reRccgaagttcgccgtcctgn/a *n/aPrimers for sequencing of gene fragments
Vacc_reFtccaagccatcgacctactc
pJET1.2 Forward Sequencing Primer cgactcactatagggagagcggc58n/aReal-time PCR from colonies and sequencing
pJET1.2 Reverse Sequencing Primeraagaacatcgattttccatggcag
* n/a—not applicable.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhidkin, R.; Zhurbenko, P.; Bogomaz, O.; Gorodilova, E.; Katsapov, I.; Antropov, D.; Matveeva, T. Biodiversity of rolB/C-like Natural Transgene in the Genus Vaccinium L. and Its Application for Phylogenetic Studies. Int. J. Mol. Sci. 2023, 24, 6932. https://doi.org/10.3390/ijms24086932

AMA Style

Zhidkin R, Zhurbenko P, Bogomaz O, Gorodilova E, Katsapov I, Antropov D, Matveeva T. Biodiversity of rolB/C-like Natural Transgene in the Genus Vaccinium L. and Its Application for Phylogenetic Studies. International Journal of Molecular Sciences. 2023; 24(8):6932. https://doi.org/10.3390/ijms24086932

Chicago/Turabian Style

Zhidkin, Roman, Peter Zhurbenko, Olesya Bogomaz, Elizaveta Gorodilova, Ivan Katsapov, Dmitry Antropov, and Tatiana Matveeva. 2023. "Biodiversity of rolB/C-like Natural Transgene in the Genus Vaccinium L. and Its Application for Phylogenetic Studies" International Journal of Molecular Sciences 24, no. 8: 6932. https://doi.org/10.3390/ijms24086932

APA Style

Zhidkin, R., Zhurbenko, P., Bogomaz, O., Gorodilova, E., Katsapov, I., Antropov, D., & Matveeva, T. (2023). Biodiversity of rolB/C-like Natural Transgene in the Genus Vaccinium L. and Its Application for Phylogenetic Studies. International Journal of Molecular Sciences, 24(8), 6932. https://doi.org/10.3390/ijms24086932

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop