miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma
Abstract
:1. Introduction
2. Results
2.1. Patient Sociodemographic and Clinical Characteristics
2.2. E2F2 Gene Expression and E2F2 Protein Expression in Tumour Samples Compared to Margin Samples
2.3. miR-125b-5p, miR-155-3p, and miR-214-5p Expression in Tumour Samples Compared to Margin Samples
2.4. Correlation of E2F2 Gene Expression and E2F2 Protein Concentration with miRNAs Expression
2.5. Correlations between E2F2 Gene Expression and Sociodemographic and Clinicopathological Features
2.6. Correlations between E2F2 Protein Expression and Sociodemographic and Clinicopathological Features
2.7. Correlation of miRNAs Expression Level with Sociodemographic and Clinicopathological Variables
3. Discussion
4. Materials and Methods
4.1. Patient and Samples
4.2. RNA and miRNAs Extraction and Quantification
4.3. Selection of Candidate MicroRNAs to E2F2 Target
4.4. Complementary DNA (cDNA) Synthesis
4.5. E2F2 Gene and miRNAs Expression Analysis
4.6. E2F2 and Total Protein Concentration Determinations
4.7. HPV 16 Detection
4.8. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Golusinski, P.; Di Maio, P.; Pehlivan, B.; Colley, S.; Nankivell, P.; Kong, A.; Hartley, A.; Mehanna, H. Evidence for the approach to the diagnostic evaluation of squamous cell carcinoma occult primary tumors of the head and neck. Oral Oncol. 2019, 88, 145–152. [Google Scholar] [CrossRef]
- Aghiorghiesei, O.; Zanoaga, O.; Raduly, L.; Aghiorghiesei, A.I.; Chiroi, P.; Trif, A.; Buiga, R.; Budisan, L.; Lucaciu, O.; Pop, L.A.; et al. Dysregulation of miR-21-5p, miR-93-5p, miR-200c-3p and miR-205-5p in Oral Squamous Cell Carcinoma: A Potential Biomarkers Panel? Curr. Issues Mol. Biol. 2022, 44, 1754–1767. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [Green Version]
- Dioguardi, M.; Caloro, G.A.; Laino, L.; Alovisi, M.; Sovereto, D.; Crincoli, V.; Aiuto, R.; Coccia, E.; Troiano, G.; Lo Muzio, L. Circulating miR-21 as a Potential Biomarker for the Diagnosis of Oral Cancer: A Systematic Review with Meta-Analysis. Cancers 2020, 12, 936. [Google Scholar] [CrossRef] [Green Version]
- Emmrich, S.; Pützer, B.M. Checks and balances: E2F-microRNA crosstalk in cancer control. Cell Cycle 2010, 9, 2555–2567. [Google Scholar] [CrossRef]
- Wang, H.; Wang, X.; Xu, L.; Zhang, J.; Cao, H. Integrated analysis of the E2F transcription factors across cancer types. Oncol. Rep. 2020, 43, 1133–1146. [Google Scholar] [CrossRef] [Green Version]
- Gao, Z.; Shi, R.; Yuan, K.; Wang, Y. Expression and prognostic value of E2F activators in NSCLC and subtypes: A research based on bioinformatics analysis. Tumour Biol. 2016, 37, 14979–14987. [Google Scholar] [CrossRef]
- Li, Y.; Huang, J.; Yang, D.; Xiang, S.; Sun, J.; Li, H.; Ren, G. Expression patterns of E2F transcription factors and their potential prognostic roles in breast cancer. Oncol. Lett. 2018, 15, 9216–9230. [Google Scholar] [CrossRef] [Green Version]
- Manicum, T.; Ni, F.; Ye, Y.; Fan, X.; Chen, B.C. Prognostic values of E2F mRNA expression in human gastric cancer. Biosci. Rep. 2018, 38, BSR20181264. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.L.; Ning, G.; Chen, L.B.; Lian, Y.F.; Gu, Y.R.; Wang, J.L.; Chen, D.M.; Wei, H.; Huang, Y.H. Promising diagnostic and prognostic value of E2Fs in human hepatocellular carcinoma. Cancer Manag. Res. 2019, 11, 1725–1740. [Google Scholar] [CrossRef] [Green Version]
- Kabzinski, J.; Maczynska, M.; Majsterek, I. MicroRNA as a Novel Biomarker in the Diagnosis of Head and Neck Cancer. Biomolecules 2021, 11, 844. [Google Scholar] [CrossRef]
- Thomaidou, A.C.; Batsaki, P.; Adamaki, M.; Goulielmaki, M.; Baxevanis, C.N.; Zoumpourlis, V.; Fortis, S.P. Promising Biomarkers in Head and Neck Cancer: The Most Clinically Important miRNAs. Int. J. Mol. Sci. 2022, 23, 8257. [Google Scholar] [CrossRef] [PubMed]
- Avram, E.G.; Moatar, I.A.; Miok, V.; Baderca, F.; Samoila, C.; Alexa, A.; Andreescu, I.N.; Podariu, A.; Marian, C.; Sirbu, I.O. Gene network analysis of the transcriptome impact of methylated microRNAs on oral squamous cell carcinoma. Adv. Clin. Exp. Med. 2022, 31, 1231–1242. [Google Scholar] [PubMed]
- Calin, G.A.; Dumitru, C.D.; Shimizu, M.; Bichi, R.; Zupo, S.; Noch, E.; Aldler, H.; Rattan, S.; Keating, M.; Rai, K.; et al. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. USA 2002, 99, 15524–15529. [Google Scholar] [CrossRef] [Green Version]
- Di Leva, G.; Garofalo, M.; Croce, C.M. MicroRNAs in cancer. Annu. Rev. Pathol. 2014, 9, 287–314. [Google Scholar] [CrossRef] [Green Version]
- Ali Syeda, Z.; Langden, S.S.S.; Munkhzul, C.; Lee, M.; Song, S.J. Regulatory Mechanism of MicroRNA Expression in Cancer. Int. J. Mol. Sci. 2020, 21, 1723. [Google Scholar] [CrossRef] [Green Version]
- Kent, O.A.; Fox-Talbot, K.; Halushka, M.K. RREB1 repressed miR-143/145 modulates KRAS signaling through downregulation of multiple targets. Oncogene 2013, 32, 2576–2585. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Shi, Z.; Hong, Z.; Pan, J.; Chen, Z.; Qiu, C.; Zhuang, H.; Zheng, X. MicroRNA-1276 Promotes Colon Cancer Cell Proliferation by Negatively Regulating LACTB. Cancer Manag. Res. 2020, 12, 12185–12195. [Google Scholar] [CrossRef]
- Coarfa, C.; Fiskus, W.; Eedunuri, V.K.; Rajapakshe, K.; Foley, C.; Chew, S.A.; Shah, S.S.; Geng, C.; Shou, J.; Mohamed, J.S.; et al. Comprehensive proteomic profiling identifies the androgen receptor axis and other signaling pathways as targets of microRNAs suppressed in metastatic prostate cancer. Oncogene 2016, 35, 2345–2356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takayama, K.I.; Misawa, A.; Inoue, S. Significance of microRNAs in Androgen Signaling and Prostate Cancer Progression. Cancers 2017, 9, 102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.J.; Yan, Z.J.; Luo, G.C.; Chen, Y.Y.; Bai, P.M. miR-26 suppresses renal cell cancer via down-regulating coronin-3. Mol. Cell. Biochem. 2020, 463, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Chen, W.; Li, R.; Chen, X.; Huang, G.; Lu, C.; Wen, Z.; Peng, X.; Liu, K.; Zhang, C.; et al. Bladder cancer diagnosis with a four-miRNA panel in serum. Future Oncol. 2022, 18, 3311–3322. [Google Scholar] [CrossRef]
- Gao, S.; Shi, P.; Tian, Z.; Yang, X.; Liu, N. Overexpression of miR-1225 promotes the progression of breast cancer, resulting in poor prognosis. Clin. Exp. Med. 2021, 21, 287–296. [Google Scholar] [CrossRef] [PubMed]
- Gao, C.; Zhou, C.; Zhuang, J.; Liu, L.; Liu, C.; Li, H.; Liu, G.; Wei, J.; Sun, C. MicroRNA expression in cervical cancer: Novel diagnostic and prognostic biomarkers. J. Cell. Biochem. 2018, 119, 7080–7090. [Google Scholar] [CrossRef]
- Wei, L.; He, Y.; Bi, S.; Li, X.; Zhang, J.; Zhang, S. miRNA-199b-3p suppresses growth and progression of ovarian cancer via the CHK1/E-cadherin/EMT signaling pathway by targeting ZEB1. Oncol. Rep. 2021, 45, 569–581. [Google Scholar] [CrossRef]
- Liang, G.; Meng, W.; Huang, X.; Zhu, W.; Yin, C.; Wang, C.; Fassan, M.; Yu, Y.; Kudo, M.; Xiao, S.; et al. miR-196b-5p-mediated downregulation of TSPAN12 and GATA6 promotes tumor progression in non-small cell lung cancer. Proc. Natl. Acad. Sci. USA 2020, 117, 4347–4357. [Google Scholar] [CrossRef]
- Wan, Y.; Hoyle, R.G.; Xie, N.; Wang, W.; Cai, H.; Zhang, M.; Ma, Z.; Xiong, G.; Xu, X.; Huang, Z.; et al. A Super-Enhancer Driven by FOSL1 Controls miR-21-5p Expression in Head and Neck Squamous Cell Carcinoma. Front. Oncol. 2021, 11, 656628. [Google Scholar] [CrossRef]
- Patil, S.; Warnakulasuriya, S. Blood-based circulating microRNAs as potential biomarkers for predicting the prognosis of head and neck cancer-a systematic review. Clin. Oral Investig. 2020, 24, 3833–3841. [Google Scholar] [CrossRef]
- Al Rawi, N.; Elmabrouk, N.; Abu Kou, R.; Mkadmi, S.; Rizvi, Z.; Hamdoon, Z. The role of differentially expressed salivary microRNA in oral squamous cell carcinoma. A systematic review. Arch. Oral Biol. 2021, 125, 105108. [Google Scholar] [CrossRef]
- Dioguardi, M.; Cantore, S.; Sovereto, D.; La Femina, L.; Caloro, G.A.; Spirito, F.; Scacco, S.; Di Cosola, M.; Lo Muzio, L.; Troiano, G.; et al. Potential Role of miR-196a and miR-196b as Prognostic Biomarkers of Survival in Head and Neck Squamous Cell Carcinoma: A Systematic Review, Meta-Analysis and Trial Sequential Analysis. Life 2022, 12, 1269. [Google Scholar] [CrossRef]
- Dioguardi, M.; Spirito, F.; Caloro, G.A.; Lo Muzio, L.; Cantore, S.; Ballini, A.; Scacco, S.; Malcangi, A.; Sembronio, S.; Cascardi, E.; et al. Is the Non-Coding RNA miR-195 a Biodynamic Marker in the Pathogenesis of Head and Neck Squamous Cell Carcinoma? A Prognostic Meta-Analysis. J. Pers. Med. 2023, 13, 275. [Google Scholar] [CrossRef] [PubMed]
- Dioguardi, M.; Spirito, F.; Sovereto, D.; La Femina, L.; Campobasso, A.; Cazzolla, A.P.; Di Cosola, M.; Zhurakivska, K.; Cantore, S.; Ballini, A.; et al. Biological Prognostic Value of miR-155 for Survival Outcome in Head and Neck Squamous Cell Carcinomas: Systematic Review, Meta-Analysis and Trial Sequential Analysis. Biology 2022, 11, 651. [Google Scholar] [CrossRef]
- Slaughter, D.P.; Southwick, H.W.; Smejkal, W. Field cancerization in oral stratified squamous epithelium; clinical implications of multicentric origin. Cancer 1953, 6, 963–968. [Google Scholar] [CrossRef] [PubMed]
- Braakhuis, B.J.; Tabor, M.P.; Kummer, J.A.; Leemans, C.R.; Brakenhoff, R.H. A genetic explanation of Slaughter’s concept of field cancerization: Evidence and clinical implications. Cancer Res. 2003, 63, 1727–1730. [Google Scholar] [PubMed]
- Roman, A.; Munger, K. The papillomavirus E7 proteins. Virology 2013, 445, 138–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, Y.; Zou, J.; Su, S.; Huang, H.; Deng, Y.; Wang, B.; Li, W. MicroRNA-218 and microRNA-520a inhibit cell proliferation by downregulating E2F2 in hepatocellular carcinoma. Mol. Med. Rep. 2015, 12, 1016–1022. [Google Scholar] [CrossRef] [Green Version]
- Li, T.; Luo, W.; Liu, K.; Lv, X.; Xi, T. miR-31 promotes proliferation of colon cancer cells by targeting E2F2. Biotechnol. Lett. 2015, 37, 523–532. [Google Scholar] [CrossRef]
- Zhang, Y.; Han, D.; Wei, W.; Cao, W.; Zhang, R.; Dong, Q.; Zhang, J.; Wang, Y.; Liu, N. MiR-218 Inhibited Growth and Metabolism of Human Glioblastoma Cells by Directly Targeting E2F2. Cell. Mol. Neurobiol. 2015, 35, 1165–1173. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, X.; Liu, Y.; Ni, Z.; Lin, Y.; Duan, Z.; Shi, Y.; Wang, G.; Li, F. Downregulated miR-31 level associates with poor prognosis of gastric cancer and its restoration suppresses tumor cell malignant phenotypes by inhibiting E2F2. Oncotarget 2016, 7, 36577–36589. [Google Scholar] [CrossRef] [Green Version]
- Fang, Z.Q.; Li, M.C.; Zhang, Y.Q.; Liu, X.G. MiR-490-5p inhibits the metastasis of hepatocellular carcinoma by down-regulating E2F2 and ECT2. J. Cell. Biochem. 2018, 119, 8317–8324. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Tao, H. Overexpression of microRNA-936 suppresses non-small cell lung cancer cell proliferation and invasion via targeting E2F2. Exp. Ther. Med. 2018, 16, 2696–2702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, X.; Xiao, D.; Cui, Y.; Wang, X. Exosomes-Derived Long Non-Coding RNA HOTAIR Reduces Laryngeal Cancer Radiosensitivity by Regulating microRNA-454-3p/E2F2 Axis. OncoTargets Ther. 2019, 12, 10827–10839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, Q.Y.; Wang, J.Q.; Wu, L.L.; Zheng, W.E.; Chen, P.R. miR-638 represses the stem cell characteristics of breast cancer cells by targeting E2F2. Breast Cancer 2020, 27, 147–158. [Google Scholar] [CrossRef]
- Miyamoto, M.; Sawada, K.; Nakamura, K.; Yoshimura, A.; Ishida, K.; Kobayashi, M.; Shimizu, A.; Yamamoto, M.; Kodama, M.; Hashimoto, K.; et al. Paclitaxel exposure downregulates miR-522 expression and its downregulation induces paclitaxel resistance in ovarian cancer cells. Sci. Rep. 2020, 10, 16755. [Google Scholar] [CrossRef]
- Feng, H.; Sun, S.Z.; Cheng, F.; Zhang, N.Q. Mediation of circ_RPPH1 on miR-146b-3p/E2F2 pathway to hinder the growth and metastasis of breast carcinoma cells. Aging 2021, 13, 20552–20568. [Google Scholar] [CrossRef]
- Zhang, H.; Qiu, X.; Song, Z.; Lan, L.; Ren, X.; Ye, B. CircCUL2 suppresses retinoblastoma cells by regulating miR-214-5p/E2F2 Axis. Anticancer Drugs 2022, 33, e218–e227. [Google Scholar] [CrossRef]
- Yin, H.; Sun, Y.; Wang, X.; Park, J.; Zhang, Y.; Li, M.; Yin, J.; Liu, Q.; Wei, M. Progress on the relationship between miR-125 family and tumorigenesis. Exp. Cell Res. 2015, 339, 252–260. [Google Scholar] [CrossRef]
- Huang, L.; Luo, J.; Cai, Q.; Pan, Q.; Zeng, H.; Guo, Z.; Dong, W.; Huang, J.; Lin, T. MicroRNA-125b suppresses the development of bladder cancer by targeting E2F3. Int. J. Cancer 2011, 128, 1758–1769. [Google Scholar] [CrossRef] [PubMed]
- Feliciano, A.; Castellvi, J.; Artero-Castro, A.; Leal, J.A.; Romagosa, C.; Hernández-Losa, J.; Peg, V.; Fabra, A.; Vidal, F.; Kondoh, H.; et al. miR-125b acts as a tumor suppressor in breast tumorigenesis via its novel direct targets ENPEP, CK2-α, CCNJ, and MEGF9. PLoS ONE 2013, 8, e76247. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Yan, L.X.; Wu, Q.N.; Du, Z.M.; Chen, J.; Liao, D.Z.; Huang, M.Y.; Hou, J.H.; Wu, Q.L.; Zeng, M.S.; et al. miR-125b is methylated and functions as a tumor suppressor by regulating the ETS1 proto-oncogene in human invasive breast cancer. Cancer Res. 2011, 71, 3552–3562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, H.Y.; Wang, Y.X.; Yan, W.T.; Li, H.Y.; Tian, Y.Z.; Wang, S.M.; Zhao, H.L. MicroRNA-125b functions as a tumor suppressor in hepatocellular carcinoma cells. Int. J. Mol. Sci. 2012, 13, 8762–8774. [Google Scholar] [CrossRef] [Green Version]
- Gong, J.; Zhang, J.P.; Li, B.; Zeng, C.; You, K.; Chen, M.X.; Yuan, Y.; Zhuang, S.M. MicroRNA-125b promotes apoptosis by regulating the expression of Mcl-1, Bcl-w and IL-6R. Oncogene 2013, 32, 3071–3079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guan, Y.; Yao, H.; Zheng, Z.; Qiu, G.; Sun, K. MiR-125b targets BCL3 and suppresses ovarian cancer proliferation. Int. J. Cancer 2011, 128, 2274–2283. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Xu, Q.; Jing, Y.; Agani, F.; Qian, X.; Carpenter, R.; Li, Q.; Wang, X.R.; Peiper, S.S.; Lu, Z.; et al. Reactive oxygen species regulate ERBB2 and ERBB3 expression via miR-199a/125b and DNA methylation. EMBO Rep. 2012, 13, 1116–1122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; You, T.; Jing, J. MiR-125b inhibits cell biological progression of Ewing’s sarcoma by suppressing the PI3K/Akt signalling pathway. Cell Prolif. 2014, 47, 152–160. [Google Scholar] [CrossRef]
- Kong, F.; Sun, C.; Wang, Z.; Han, L.; Weng, D.; Lu, Y.; Chen, G. miR-125b confers resistance of ovarian cancer cells to cisplatin by targeting pro-apoptotic Bcl-2 antagonist killer 1. J. Huazhong Univ. Sci. Technol. Med. Sci. 2011, 31, 543. [Google Scholar] [CrossRef]
- Yuan, T.Z.; Zhang, H.H.; Lin, X.L.; Yu, J.X.; Yang, Q.X.; Liang, Y.; Deng, J.; Huang, L.J.; Zhang, X.P. microRNA-125b reverses the multidrug resistance of nasopharyngeal carcinoma cells via targeting of Bcl-2. Mol. Med. Rep. 2017, 15, 2223–2228. [Google Scholar] [CrossRef] [Green Version]
- Shiiba, M.; Shinozuka, K.; Saito, K.; Fushimi, K.; Kasamatsu, A.; Ogawara, K.; Uzawa, K.; Ito, H.; Takiguchi, Y.; Tanzawa, H. MicroRNA-125b regulates proliferation and radioresistance of oral squamous cell carcinoma. Br. J. Cancer 2013, 108, 181721. [Google Scholar] [CrossRef] [Green Version]
- Doukas, S.G.; Vagelim, D.P.; Lazopoulos, G.; Spandidos, D.A.; Sasaki, C.T.; Tsatsakis, A. The Effect of NNK, A Tobacco Smoke Carcinogen, on the miRNA and Mismatch DNA Repair Expression Profiles in Lung and Head and Neck Squamous Cancer Cells. Cells 2020, 9, 1031. [Google Scholar] [CrossRef] [Green Version]
- Chawla, J.P.; Iyer, N.; Soodan, K.S.; Sharma, A.; Khurana, S.K.; Priyadarshni, P. Role of miRNA in cancer diagnosis, prognosis, therapy and regulation of its expression by Epstein-Barr virus and human papillomaviruses: With special reference to oral cancer. Oral Oncol. 2015, 51, 731–737. [Google Scholar] [CrossRef]
- Mycko, M.P.; Cichalewska, M.; Cwiklinska, H.; Selmaj, K.W. miR-155-3p Drives the Development of Autoimmune Demyelination by Regulation of Heat Shock Protein 40. J. Neurosci. 2015, 35, 16504–16515. [Google Scholar] [CrossRef] [Green Version]
- Manikandan, M.; Deva Magendhra Rao, A.K.; Rajkumar, K.S.; Rajaraman, R.; Munirajan, A.K. Altered levels of miR-21, miR-125b-2*, miR-138, miR-155, miR-184, and miR-205 in oral squamous cell carcinoma and association with clinicopathological characteristics. J. Oral Pathol. Med. 2015, 44, 792–800. [Google Scholar] [CrossRef] [PubMed]
- Baba, O.; Hasegawa, S.; Nagai, H.; Uchida, F.; Yamatoji, M.; Kanno, N.I.; Yamagata, K.; Sakai, S.; Yanagawa, T.; Bukawa, H. MicroRNA-155-5p is associated with oral squamous cell carcinoma metastasis and poor prognosis. J. Oral Pathol. Med. 2016, 45, 248–255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, M.; Duan, Q.; Liu, X.; Zhang, P.; Fu, Y.; Zhang, Z.; Liu, L.; Cheng, J.; Jiang, H. MiR-155-5p promotes oral cancer progression by targeting chromatin remodeling gene ARID2. Biomed. Pharm. 2020, 122, 109696. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.J.; Liang, T.S.; Wang, J.; Zhao, J.Y.; Zhai, S.N.; Yang, D.K.; Wang, L.D. MicroRNA-155 acts as a diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma. Artif. Cells Nanomed. Biotechnol. 2020, 48, 977–982. [Google Scholar] [CrossRef]
- Zhang, M.; Wang, D.; Zhu, T.; Yin, R. miR-214-5p Targets ROCK1 and Suppresses Proliferation and Invasion of Human Osteosarcoma Cells. Oncol. Res. 2017, 25, 75–81. [Google Scholar] [CrossRef]
- Li, H.; Wang, H.; Ren, Z. MicroRNA-214-5p Inhibits the Invasion and Migration of Hepatocellular Carcinoma Cells by Targeting Wiskott-Aldrich Syndrome Like. Cell. Physiol. Biochem. 2018, 46, 757–764. [Google Scholar] [CrossRef] [Green Version]
- Cao, T.H.; Ling, X.; Chen, C.; Tang, W.; Hu, D.M.; Yin, G.J. Role of miR-214-5p in the migration and invasion of pancreatic cancer cells. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 7214–7221. [Google Scholar]
- Yu, Z.W.; Zhong, L.P.; Ji, T.; Zhang, P.; Chen, W.T.; Zhang, C.P. MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010, 46, 317–322. [Google Scholar] [CrossRef]
- Yao, Z.; Chen, Q.; Ni, Z.; Zhou, L.; Wang, Y.; Yang, Y.; Huang, H. Long Non-Coding RNA Differentiation Antagonizing Nonprotein Coding RNA (DANCR) Promotes Proliferation and Invasion of Pancreatic Cancer by Sponging miR-214-5p to Regulate E2F2 Expression. Med. Sci. Monit. 2019, 25, 4544–4552. [Google Scholar] [CrossRef] [PubMed]
- Patil, R.N.; Karpe, Y.A. Uncovering the Roles of miR-214 in Hepatitis E Virus Replication. J. Mol. Biol. 2020, 432, 5322–5342. [Google Scholar] [CrossRef] [PubMed]
- Brunner, M.; Ng, B.C.; Veness, M.J.; Clark, J.R. Comparison of the AJCC N staging system in mucosal and cutaneous squamous head and neck cancer. Laryngoscope 2014, 124, 1598–1602. [Google Scholar] [CrossRef]
- Rodrigues, P.C.; Miguel, M.C.; Bagordakis, E.; Fonseca, F.P.; de Aquino, S.N.; Santos-Silva, A.R.; Lopes, M.A.; Graner, E.; Salo, T.; Kowalski, L.P.; et al. Clinicopathological prognostic factors of oral tongue squamous cell carcinoma: A retrospective study of 202 cases. Int. J. Oral Maxillofac. Surg. 2014, 43, 795–801. [Google Scholar] [CrossRef] [PubMed]
- El-Naggar, A.K.; Chan, J.K.C.; Grandis, J.R.; Takata, T.; Slootweg, P.J. WHO Classification of Head and Neck Tumours International Agency for Research on Cancer (IARC), 4th ed.; IARC Publications: Lyon, France, 2017. [Google Scholar]
- Gołąbek, K.; Rączka, G.; Gaździcka, J.; Miśkiewicz-Orczyk, K.; Zięba, N.; Krakowczyk, Ł.; Misiołek, M.; Strzelczyk, J.K. Expression Profiles of CDKN2A, MDM2, E2F2 and LTF Genes in Oral Squamous Cell Carcinoma. Biomedicines 2022, 10, 3011. [Google Scholar] [CrossRef]
- miRCode. Available online: http://www.mircode.org (accessed on 14 September 2022).
- miRDB. Available online: http://mirdb.org (accessed on 14 September 2022).
- TargetScan. Available online: http://www.targetscan.org/vert_72 (accessed on 14 September 2022).
Clinical Parameters | Patients, n (%) |
---|---|
Histological grading | |
G1 (Well differentiated) | 9 (18) |
G2 (Moderately differentiated) | 23 (46) |
G3 (Poorly differentiated) | 18 (36) |
T classification | |
T1 | 10 (20) |
T2 | 23 (46) |
T3 | 16 (32) |
T4 | 1 (2) |
Nodal status | |
N0 | 24 (48) |
N1 | 2 (4) |
N2 | 20 (40) |
N3 | 4 (8) |
Patient status at 3 years | |
Alive | 12 (24) |
Dead | 38 (76) |
Perform the poly(A) tailing reaction | Reaction Composition | |||
Component | Volume | |||
10× Poly(A) Buffer | 0.5 μL | |||
ATP | 0.5 μL | |||
Poly(A) enzyme | 0.3 μL | |||
RNA sample | 2 μL | |||
RNase-free water | 1.7 μL | |||
Thermal Profile | ||||
Step | Temperature | Time | ||
Polyadenylation | 37 °C | 45 min | ||
Stop reaction | 65 °C | 10 min | ||
Hold | 4 °C | Hold | ||
Perform the adaptor ligation reaction | Reaction Composition | |||
Component | Volume | |||
5× DNA Ligase Buffer | 3 μL | |||
50% PEG 8000 | 4.5 μL | |||
25× Ligation Adaptor | 0.6 μL | |||
RNA Ligase | 1.5 μL | |||
Poly(A) tailing reaction product | 5 μL | |||
RNase-free water | 0.4 μL | |||
Thermal Profile | ||||
Step | Temperature | Time | ||
Ligation | 16 °C | 60 min | ||
Hold | 4 °C | Hold | ||
Perform the reverse transcription (RT) reaction | Reaction Composition | |||
Component | Volume | |||
5× RT Buffer | 6 μL | |||
dNTP Mix (25 mM each) | 1.2 μL | |||
20× Universal RT primer | 1.5 μL | |||
10× RT enzyme mix | 3 μL | |||
Adaptorligation reaction product | 15 μL | |||
RNase-free water | 3.3 μL | |||
Thermal Profile | ||||
Step | Temperature | Time | ||
Reverse transcription | 42 °C | 15 min | ||
Stop reaction | 85 °C | 5 min | ||
Hold | 4 °C | Hold | ||
Perform the miR-Amp reaction | Reaction Composition | |||
Component | Volume | |||
2× miR-Amp master mix | 25 μL | |||
20× miR-Amp primer mix | 2.5 μL | |||
RT reaction product | 5 μL | |||
RNase-free water | 17.5 μL | |||
Thermal Profile | ||||
Step | Temperature | Time | Cycles | |
Enzyme activation | 95 °C | 5 min | 1 | |
Denature | 95 °C | 3 s | 14 | |
Anneal/extend | 60 °C | 30 s | ||
Stop reaction | 99 °C | 10 min | 1 | |
Hold | 4 °C | Hold | 1 |
miRNA | Mature miRNA Sequence |
---|---|
miR-125b-5p | UCCCUGAGACCCUAACUUGUGA |
miR-155-3p | CUCCUACAUAUUAGCAUUAACA |
miR-214-5p | UGCCUGUCUACACUUGCUGUGC |
miR-361-5p (Housekeeping control) | UUAUCAGAAUCUCCAGGGGUAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gołąbek, K.; Hudy, D.; Świętek, A.; Gaździcka, J.; Dąbrowska, N.; Miśkiewicz-Orczyk, K.; Zięba, N.; Misiołek, M.; Strzelczyk, J.K. miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma. Int. J. Mol. Sci. 2023, 24, 6320. https://doi.org/10.3390/ijms24076320
Gołąbek K, Hudy D, Świętek A, Gaździcka J, Dąbrowska N, Miśkiewicz-Orczyk K, Zięba N, Misiołek M, Strzelczyk JK. miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma. International Journal of Molecular Sciences. 2023; 24(7):6320. https://doi.org/10.3390/ijms24076320
Chicago/Turabian StyleGołąbek, Karolina, Dorota Hudy, Agata Świętek, Jadwiga Gaździcka, Natalia Dąbrowska, Katarzyna Miśkiewicz-Orczyk, Natalia Zięba, Maciej Misiołek, and Joanna Katarzyna Strzelczyk. 2023. "miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma" International Journal of Molecular Sciences 24, no. 7: 6320. https://doi.org/10.3390/ijms24076320