Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler
Abstract
1. Introduction
2. Results
2.1. An Additional Intranucleosomal High-Affinity UASp Element Allows PHO8 Promoter Nucleosome Remodeling without SWI/SNF Activity
2.2. PHO4 Overexpression Is Sufficient for PHO8 Promoter Chromatin Remodeling without SWI/SNF
2.3. PHO80 Deletion Is Less Effective Than PHO4 Overexpression Regarding PHO8 Promoter Nucleosome Removal without SWI/SNF
2.4. RSC Rather Hinders Than Helps Circumventing the SWI/SNF Requirement for PHO8 Promoter Nucleosome Removal under Conditions of PHO4 Overexpression
2.5. Combining PHO4 Overexpression with an Additional High-Affinity Intranucleosomal UASp Element Is Necessary to Allow Partial PHO84 Promoter Opening without SWI/SNF
3. Discussion
4. Materials and Methods
4.1. Strains, Media, Plasmids and Strain Construction
4.2. Chromatin Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Luger, K.; Mader, A.W.; Richmond, R.K.; Sargent, D.F.; Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 1997, 389, 251–260. [Google Scholar] [CrossRef] [PubMed]
- Kornberg, R.D.; Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 1999, 98, 285–294. [Google Scholar] [CrossRef] [PubMed]
- Bell, O.; Tiwari, V.K.; Thoma, N.H.; Schubeler, D. Determinants and dynamics of genome accessibility. Nat. Rev. Genet. 2011, 12, 554–564. [Google Scholar] [CrossRef]
- Struhl, K. Fundamentally different logic of gene regulation in eukaryotes and prokaryotes. Cell 1999, 98, 1–4. [Google Scholar] [CrossRef]
- Lai, W.K.M.; Pugh, B.F. Understanding nucleosome dynamics and their links to gene expression and DNA replication. Nat. Rev. Mol. Cell Biol. 2017, 18, 548–562. [Google Scholar] [CrossRef]
- Morse, R.H. Transcription factor access to promoter elements. J. Cell Biochem. 2007, 102, 560–570. [Google Scholar] [CrossRef] [PubMed]
- Barnes, T.; Korber, P. The Active Mechanism of Nucleosome Depletion by Poly(dA:dT) Tracts In Vivo. Int. J. Mol. Sci. 2021, 22, 8233. [Google Scholar] [CrossRef]
- Rossi, M.J.; Kuntala, P.K.; Lai, W.K.M.; Yamada, N.; Badjatia, N.; Mittal, C.; Kuzu, G.; Bocklund, K.; Farrell, N.P.; Blanda, T.R.; et al. A high-resolution protein architecture of the budding yeast genome. Nature 2021, 592, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Yuan, G.C.; Liu, Y.J.; Dion, M.F.; Slack, M.D.; Wu, L.F.; Altschuler, S.J.; Rando, O.J. Genome-scale identification of nucleosome positions in S. cerevisiae. Science 2005, 309, 626–630. [Google Scholar] [CrossRef]
- Fascher, K.D.; Schmitz, J.; Horz, W. Structural and functional requirements for the chromatin transition at the PHO5 promoter in Saccharomyces cerevisiae upon PHO5 activation. J. Mol. Biol. 1993, 231, 658–667. [Google Scholar] [CrossRef]
- Tirosh, I.; Barkai, N. Two strategies for gene regulation by promoter nucleosomes. Genome Res. 2008, 18, 1084–1091. [Google Scholar] [CrossRef] [PubMed]
- Cairns, B.R. The logic of chromatin architecture and remodelling at promoters. Nature 2009, 461, 193–198. [Google Scholar] [CrossRef] [PubMed]
- Korber, P.; Barbaric, S. The yeast PHO5 promoter: From single locus to systems biology of a paradigm for gene regulation through chromatin. Nucleic Acids Res. 2014, 42, 10888–10902. [Google Scholar] [CrossRef] [PubMed]
- Rando, O.J.; Winston, F. Chromatin and transcription in yeast. Genetics 2012, 190, 351–387. [Google Scholar] [CrossRef]
- Wykoff, D.D.; O’Shea, E.K. Phosphate transport and sensing in Saccharomyces cerevisiae. Genetics 2001, 159, 1491–1499. [Google Scholar] [CrossRef]
- Auesukaree, C.; Homma, T.; Tochio, H.; Shirakawa, M.; Kaneko, Y.; Harashima, S. Intracellular phosphate serves as a signal for the regulation of the PHO pathway in Saccharomyces cerevisiae. J. Biol. Chem. 2004, 279, 17289–17294. [Google Scholar] [CrossRef]
- O’Neill, E.M.; Kaffman, A.; Jolly, E.R.; O’Shea, E.K. Regulation of PHO4 nuclear localization by the PHO80-PHO85 cyclin-CDK complex. Science 1996, 271, 209–212. [Google Scholar] [CrossRef]
- Kaffman, A.; Herskowitz, I.; Tjian, R.; O’Shea, E.K. Phosphorylation of the transcription factor PHO4 by a cyclin-CDK complex, PHO80-PHO85. Science 1994, 263, 1153–1156. [Google Scholar] [CrossRef]
- Kaffman, A.; Rank, N.M.; O’Shea, E.K. Phosphorylation regulates association of the transcription factor Pho4 with its import receptor Pse1/Kap121. Genes Dev. 1998, 12, 2673–2683. [Google Scholar] [CrossRef]
- Komeili, A.; O’Shea, E.K. Roles of phosphorylation sites in regulating activity of the transcription factor Pho4. Science 1999, 284, 977–980. [Google Scholar] [CrossRef]
- Barbaric, S.; Munsterkotter, M.; Goding, C.; Horz, W. Cooperative Pho2-Pho4 interactions at the PHO5 promoter are critical for binding of Pho4 to UASp1 and for efficient transactivation by Pho4 at UASp2. Mol. Cell. Biol. 1998, 18, 2629–2639. [Google Scholar] [CrossRef] [PubMed]
- Barbarić, S.; Münsterkötter, M.; Svaren, J.; Hörz, W. The homeodomain protein Pho2 and the basic-helix-loop-helix protein Pho4 bind DNA cooperatively at the yeast PHO5 promoter. Nucleic Acids Res. 1996, 24, 4479–4486. [Google Scholar] [CrossRef] [PubMed]
- Fascher, K.D.; Schmitz, J.; Horz, W. Role of trans-activating proteins in the generation of active chromatin at the PHO5 promoter in S. cerevisiae. EMBO J. 1990, 9, 2523–2528. [Google Scholar] [CrossRef]
- McAndrew, P.C.; Svaren, J.; Martin, S.R.; Horz, W.; Goding, C.R. Requirements for chromatin modulation and transcription activation by the Pho4 acidic activation domain. Mol. Cell. Biol. 1998, 18, 5818–5827. [Google Scholar] [CrossRef] [PubMed]
- Lemire, J.M.; Willcocks, T.; Halvorson, H.O.; Bostian, K.A. Regulation of repressible acid phosphatase gene transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 1985, 5, 2131–2141. [Google Scholar]
- Svaren, J.; Schmitz, J.; Horz, W. The transactivation domain of Pho4 is required for nucleosome disruption at the PHO5 promoter. EMBO J. 1994, 13, 4856–4862. [Google Scholar] [CrossRef]
- Neely, K.E.; Hassan, A.H.; Brown, C.E.; Howe, L.; Workman, J.L. Transcription activator interactions with multiple SWI/SNF subunits. Mol. Cell. Biol. 2002, 22, 1615–1625. [Google Scholar] [CrossRef]
- Barbaric, S.; Reinke, H.; Hörz, W. Multiple Mechanistically Distinct Functions of SAGA at the PHO5 Promoter. Mol. Cell Biol. 2003, 23, 3468–3476. [Google Scholar] [CrossRef]
- Adkins, M.W.; Williams, S.K.; Linger, J.; Tyler, J.K. Chromatin disassembly from the PHO5 promoter is essential for the recruitment of the general transcription machinery and coactivators. Mol. Cell. Biol. 2007, 27, 6372–6382. [Google Scholar] [CrossRef]
- Reinke, H.; Gregory, P.D.; Horz, W. A transient histone hyperacetylation signal marks nucleosomes for remodeling at the PHO8 promoter in vivo. Mol. Cell 2001, 7, 529–538. [Google Scholar] [CrossRef]
- Reinke, H.; Horz, W. Histones are first hyperacetylated and then lose contact with the activated PHO5 promoter. Mol. Cell 2003, 11, 1599–1607. [Google Scholar] [CrossRef] [PubMed]
- Dhasarathy, A.; Kladde, M.P. Promoter occupancy is a major determinant of chromatin remodeling enzyme requirements. Mol. Cell. Biol. 2005, 25, 2698–2707. [Google Scholar] [CrossRef] [PubMed]
- Narlikar, G.J.; Sundaramoorthy, R.; Owen-Hughes, T. Mechanisms and Functions of ATP-Dependent Chromatin-Remodeling Enzymes. Cell 2013, 154, 490–503. [Google Scholar] [CrossRef]
- Bartholomew, B. Regulating the chromatin landscape: Structural and mechanistic perspectives. Annu. Rev. Biochem. 2014, 83, 671–696. [Google Scholar] [CrossRef]
- Clapier, C.R.; Cairns, B.R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 2009, 78, 273–304. [Google Scholar] [CrossRef] [PubMed]
- Clapier, C.R.; Iwasa, J.; Cairns, B.R.; Peterson, C.L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 2017, 18, 407–422. [Google Scholar] [CrossRef]
- Zhou, C.Y.; Johnson, S.L.; Gamarra, N.I.; Narlikar, G.J. Mechanisms of ATP-Dependent Chromatin Remodeling Motors. Annu. Rev. Biophys. 2016, 45, 153–181. [Google Scholar] [CrossRef]
- Cairns, B.R.; Lorch, Y.; Li, Y.; Zhang, M.; Lacomis, L.; Erdjument-Bromage, H.; Tempst, P.; Du, J.; Laurent, B.; Kornberg, R.D. RSC, an essential, abundant chromatin-remodeling complex. Cell 1996, 87, 1249–1260. [Google Scholar] [CrossRef]
- Tsukiyama, T.; Palmer, J.; Landel, C.C.; Shiloach, J.; Wu, C. Characterization of the imitation switch subfamily of ATP-dependent chromatin-remodeling factors in Saccharomyces cerevisiae. Genes Dev. 1999, 13, 686–697. [Google Scholar] [CrossRef]
- Mizuguchi, G.; Shen, X.; Landry, J.; Wu, W.H.; Sen, S.; Wu, C. ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 2004, 303, 343–348. [Google Scholar] [CrossRef]
- Zhang, H.; Roberts, D.N.; Cairns, B.R. Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 2005, 123, 219–231. [Google Scholar] [CrossRef]
- Wippo, C.J.; Krstulovic, B.S.; Ertel, F.; Musladin, S.; Blaschke, D.; Sturzl, S.; Yuan, G.C.; Horz, W.; Korber, P.; Barbaric, S. Differential cofactor requirements for histone eviction from two nucleosomes at the yeast PHO84 promoter are determined by intrinsic nucleosome stability. Mol. Cell. Biol. 2009, 29, 2960–2981. [Google Scholar] [CrossRef]
- Gregory, P.D.; Schmid, A.; Zavari, M.; Munsterkotter, M.; Horz, W. Chromatin remodelling at the PHO8 promoter requires SWI-SNF and SAGA at a step subsequent to activator binding. EMBO J. 1999, 18, 6407–6414. [Google Scholar] [CrossRef] [PubMed]
- Brown, C.R.; Mao, C.; Falkovskaia, E.; Law, J.K.; Boeger, H. In vivo role for the chromatin-remodeling enzyme SWI/SNF in the removal of promoter nucleosomes by disassembly rather than sliding. J. Biol. Chem. 2011, 286, 40556–40565. [Google Scholar] [CrossRef]
- Barbaric, S.; Luckenbach, T.; Schmid, A.; Blaschke, D.; Horz, W.; Korber, P. Redundancy of chromatin remodeling pathways for the induction of the yeast PHO5 promoter in vivo. J. Biol. Chem. 2007, 282, 27610–27621. [Google Scholar] [CrossRef]
- Musladin, S.; Krietenstein, N.; Korber, P.; Barbaric, S. The RSC chromatin remodeling complex has a crucial role in the complete remodeler set for yeast PHO5 promoter opening. Nucleic Acids Res. 2014, 42, 4270–4282. [Google Scholar] [CrossRef] [PubMed]
- Rawal, Y.; Qiu, H.; Hinnebusch, A.G. Distinct functions of three chromatin remodelers in activator binding and preinitiation complex assembly. PLoS Genet. 2022, 18, e1010277. [Google Scholar] [CrossRef]
- Rawal, Y.; Chereji, R.V.; Qiu, H.; Ananthakrishnan, S.; Govind, C.K.; Clark, D.J.; Hinnebusch, A.G. SWI/SNF and RSC cooperate to reposition and evict promoter nucleosomes at highly expressed genes in yeast. Genes Dev. 2018, 32, 695–710. [Google Scholar] [CrossRef] [PubMed]
- Flaus, A.; Martin, D.M.; Barton, G.J.; Owen-Hughes, T. Identification of multiple distinct Snf2 subfamilies with conserved structural motifs. Nucleic Acids Res. 2006, 34, 2887–2905. [Google Scholar] [CrossRef]
- Ehrensberger, A.H.; Kornberg, R.D. Isolation of an activator-dependent, promoter-specific chromatin remodeling factor. Proc. Natl. Acad. Sci. USA 2011, 108, 10115–10120. [Google Scholar] [CrossRef]
- Steger, D.J.; Haswell, E.S.; Miller, A.L.; Wente, S.R.; O’Shea, E.K. Regulation of chromatin remodeling by inositol polyphosphates. Science 2003, 299, 114–116. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; O’Shea, E.K. A systematic high-throughput screen of a yeast deletion collection for mutants defective in PHO5 regulation. Genetics 2005, 169, 1859–1871. [Google Scholar] [CrossRef] [PubMed]
- Partensky, P.D.; Narlikar, G.J. Chromatin remodelers act globally, sequence positions nucleosomes locally. J. Mol. Biol. 2009, 391, 12–25. [Google Scholar] [CrossRef] [PubMed]
- Clapier, C.R. Sophisticated Conversations between Chromatin and Chromatin Remodelers, and Dissonances in Cancer. Int. J. Mol. Sci. 2021, 22, 5578. [Google Scholar] [CrossRef]
- Rippe, K.; Schrader, A.; Riede, P.; Strohner, R.; Lehmann, E.; Langst, G. DNA sequence- and conformation-directed positioning of nucleosomes by chromatin-remodeling complexes. Proc. Natl. Acad. Sci. USA 2007, 104, 15635–15640. [Google Scholar] [CrossRef]
- Krietenstein, N.; Wal, M.; Watanabe, S.; Park, B.; Peterson, C.L.; Pugh, B.F.; Korber, P. Genomic Nucleosome Organization Reconstituted with Pure Proteins. Cell 2016, 167, 709–721.e712. [Google Scholar] [CrossRef]
- Oberbeckmann, E.; Niebauer, V.; Watanabe, S.; Farnung, L.; Moldt, M.; Schmid, A.; Cramer, P.; Peterson, C.L.; Eustermann, S.; Hopfner, K.P.; et al. Ruler elements in chromatin remodelers set nucleosome array spacing and phasing. Nat. Commun. 2021, 12, 3232. [Google Scholar] [CrossRef]
- Lorch, Y.; Maier-Davis, B.; Kornberg, R.D. Role of DNA sequence in chromatin remodeling and the formation of nucleosome-free regions. Genes Dev. 2014, 28, 2492–2497. [Google Scholar] [CrossRef]
- Kaneko, Y.; Hayashi, N.; Toh-e, A.; Banno, I.; Oshima, Y. Structural characteristics of the PHO8 gene encoding repressible alkaline phosphatase in Saccharomyces cerevisiae. Gene 1987, 58, 137–148. [Google Scholar]
- Barbaric, S.; Fascher, K.D.; Horz, W. Activation of the weakly regulated PHO8 promoter in S. cerevisiae: Chromatin transition and binding sites for the positive regulatory protein PHO4. Nucleic Acids Res. 1992, 20, 1031–1038. [Google Scholar] [CrossRef]
- Ogawa, N.; Hayashi, N.; Saito, H.; Noguchi, K.; Yamashita, Y.; Oshima, Y. Regulatory Circuits for Phosphatase Genes in Saccharomyces cerevisiae: Specific cis-Acting Sites in PHO Promoters for Binding the Positive Regulator Pho4p. In Phosphate in Microorganisms; Torriani-Gorini, A., Yagil, E., Silver, S., Eds.; ASM: Washington, DC, USA, 1994; pp. 56–62. [Google Scholar]
- Hayashi, N.; Oshima, Y. Specific cis-acting sequence for PHO8 expression interacts with PHO4 protein, a positive regulatory factor, in Saccharomyces cerevisiae. Mol. Cell. Biol. 1991, 11, 785–794. [Google Scholar] [PubMed]
- Zhou, X.; O’Shea, E.K. Integrated approaches reveal determinants of genome-wide binding and function of the transcription factor Pho4. Mol. Cell 2011, 42, 826–836. [Google Scholar] [CrossRef]
- Ogawa, N.; Saitoh, H.; Miura, K.; Magbanua, J.P.V.; Bunya, M.; Harashima, S.; Oshima, Y. Structure and distribution of specific cis-elements for transcriptional regulation of PHO84 in Saccharomyces cerevisiae. Mol. Gen. Genet. 1995, 249, 406–416. [Google Scholar] [CrossRef] [PubMed]
- Münsterkötter, M.; Barbaric, S.; Hörz, W. Transcriptional regulation of the yeast PHO8 promoter in comparison to the coregulated PHO5 promoter. J. Biol. Chem. 2000, 275, 22678–22685. [Google Scholar] [CrossRef] [PubMed]
- Ertel, F.; Dirac-Svejstrup, A.B.; Hertel, C.B.; Blaschke, D.; Svejstrup, J.Q.; Korber, P. In vitro reconstitution of PHO5 promoter chromatin remodeling points to a role for activator-nucleosome competition in vivo. Mol. Cell. Biol. 2010, 30, 4060–4076. [Google Scholar] [CrossRef]
- Schmid, A.; Fascher, K.D.; Hörz, W. Nucleosome disruption at the yeast PHO5 promoter upon PHO5 induction occurs in the absence of DNA replication. Cell 1992, 71, 853–864. [Google Scholar] [CrossRef]
- Lam, F.H.; Steger, D.J.; O’Shea, E.K. Chromatin decouples promoter threshold from dynamic range. Nature 2008, 453, 246–250. [Google Scholar] [CrossRef]
- Wippo, C.J.; Israel, L.; Watanabe, S.; Hochheimer, A.; Peterson, C.L.; Korber, P. The RSC chromatin remodelling enzyme has a unique role in directing the accurate positioning of nucleosomes. EMBO J. 2011, 30, 1277–1288. [Google Scholar] [CrossRef]
- Bun-Ya, M.; Nishimura, M.; Harashima, S.; Oshima, Y. The PHO84 gene of Saccharomyces cerevisiae encodes an inorganic phosphate transporter. Mol. Cell. Biol. 1991, 11, 3229–3238. [Google Scholar]
- Ghaemmaghami, S.; Huh, W.K.; Bower, K.; Howson, R.W.; Belle, A.; Dephoure, N.; O’Shea, E.K.; Weissman, J.S. Global analysis of protein expression in yeast. Nature 2003, 425, 737–741. [Google Scholar] [CrossRef]
- Barbaric, S.; Walker, J.; Schmid, A.; Svejstrup, J.Q.; Horz, W. Increasing the rate of chromatin remodeling and gene activation--a novel role for the histone acetyltransferase Gcn5. EMBO J. 2001, 20, 4944–4951. [Google Scholar] [CrossRef] [PubMed]
- Korber, P.; Barbaric, S.; Luckenbach, T.; Schmid, A.; Schermer, U.J.; Blaschke, D.; Horz, W. The histone chaperone Asf1 increases the rate of histone eviction at the yeast PHO5 and PHO8 promoters. J. Biol. Chem. 2006, 281, 5539–5545. [Google Scholar] [CrossRef] [PubMed]
- Venters, B.J.; Pugh, B.F. A canonical promoter organization of the transcription machinery and its regulators in the Saccharomyces genome. Genome Res. 2009, 19, 360–371. [Google Scholar] [CrossRef]
- Skene, P.J.; Henikoff, S. An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. eLife 2017, 6, e21856. [Google Scholar] [CrossRef] [PubMed]
- Ramachandran, S.; Zentner, G.E.; Henikoff, S. Asymmetric nucleosomes flank promoters in the budding yeast genome. Genome Res. 2015, 25, 381–390. [Google Scholar] [CrossRef]
- Kubik, S.; O’Duibhir, E.; de Jonge, W.J.; Mattarocci, S.; Albert, B.; Falcone, J.L.; Bruzzone, M.J.; Holstege, F.C.P.; Shore, D. Sequence-Directed Action of RSC Remodeler and General Regulatory Factors Modulates +1 Nucleosome Position to Facilitate Transcription. Mol. Cell 2018, 71, 89–102. [Google Scholar] [CrossRef]
- Dechassa, M.L.; Sabri, A.; Pondugula, S.; Kassabov, S.R.; Chatterjee, N.; Kladde, M.P.; Bartholomew, B. SWI/SNF has intrinsic nucleosome disassembly activity that is dependent on adjacent nucleosomes. Mol. Cell 2010, 38, 590–602. [Google Scholar] [CrossRef]
- Richmond, E.; Peterson, C.L. Functional analysis of the DNA-stimulated ATPase domain of yeast SWI2/SNF2. Nucleic Acids Res. 1996, 24, 3685–3692. [Google Scholar] [CrossRef]
- Almer, A.; Rudolph, H.; Hinnen, A.; Horz, W. Removal of positioned nucleosomes from the yeast PHO5 promoter upon PHO5 induction releases additional upstream activating DNA elements. EMBO J. 1986, 5, 2689–2696. [Google Scholar] [CrossRef]
- Hertel, C.B.; Langst, G.; Horz, W.; Korber, P. Nucleosome stability at the yeast PHO5 and PHO8 promoters correlates with differential cofactor requirements for chromatin opening. Mol. Cell. Biol. 2005, 25, 10755–10767. [Google Scholar] [CrossRef]
- Gregory, P.D.; Horz, W. Mapping chromatin structure in yeast. Methods Enzymol. 1999, 304, 365–376. [Google Scholar] [PubMed]
- Gregory, P.D.; Barbaric, S.; Horz, W. Analyzing chromatin structure and transcription factor binding in yeast. Methods 1998, 15, 295–302. [Google Scholar] [CrossRef] [PubMed]








| Relevant Cis Promoter Features | Relevant Trans Factors | Nucleosome Remodeling upon–Pi Induction? | |
|---|---|---|---|
| PHO8 Promoter | PHO84 Promoter Upstream Nucl. | ||
| wt | wt | yes | yes |
| wt | no SWI/SNF | no | no |
| intranucleosomal high-affinity UASp | no SWI/SNF | yes | no |
| wt | no SWI/SNF PHO4 overexpression | yes | no |
| wt | no SWI/SNF PHO4 overexpression depleted RSC | yes | n.d. |
| wt | no SWI/SNF PHO4-DBD overexpression | no | n.d. |
| high-affinity UASp1 | no SWI/SNF | no | n.a. |
| wt | no SWI/SNF, no Pho80 | no | n.d. |
| wt | no SWI/SNF, no Pho80 PHO4 overexpression | yes | n.d. |
| intranucleosomal high-affinity UASp | no SWI/SNF PHO4 overexpression | yes | yes |
| Strain Name | Genotype | Short Hand | Source |
|---|---|---|---|
| CY337 | MATa ura3-52 lys2-801 ade2-101 leu2-Δ1 his3-Δ200 | CY wild type | [79] |
| CY338 | CY337 pho4::URA3 | pho4∆ | [42] |
| CY397 | MATα swi2∆::HIS3 swi2(K798A)-HA-6HIS::URA3 HO-lacZ | snf2K798A | [79] |
| CY397 pho8::KAN | CY397 pho8::KanMX4 | snf2K798A pho8∆ | This study |
| CY397 ura | CY397 ura3 (after selection on 5-FOA plates) | This study | |
| CY407 | CY337 snf2::HIS3 | snf2∆ | [79] |
| CY407 pho8::KAN | CY407 pho8::KanMX4 | snf2∆ pho8∆ | This study |
| CY337 sth1td | CY337 sth1Δ::pCUP1-sth1td::URA3 | sth1td | [46] |
| CY407 sth1td | CY407 sth1Δ::pCUP1-sth1td::URA3 | snf2∆sth1td | [46] |
| CY39780 | CY397 pho80::LEU2 | snf2K798A pho80∆ | Hörz group, unpublished |
| CY408 | CY407 pho4::URA3 | snf2∆ pho4∆ | [30] |
| CY408 ura | CY408 ura3 (after selection on 5-FOA plates) | This study | |
| BY4741 (=EUROSCARF Y00000) | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | BY wild type | EUROSCARF |
| Y04315 | BY4741 pho8::KanMX4 | pho8∆ | EUROSCARF |
| Plasmid | Source/Mutagenesis Primers | Marker |
|---|---|---|
| pP4-70L (PHO4 o/x) | [45] | LEU2 |
| pP4-70U (PHO4 o/x) | [26] | URA3 |
| pP4-72 (PHO4-DBD o/x) | [26] | URA3 |
| pP4-72V (PHO4-DBD-VP16 o/x) | [26] | URA3 |
| pP8apain intraUASp_high | this study 5′GTAATCCTAATTTGAGCTCTACACAATACCACACGTGGGTTAACAGCTACTGCA3′ 5′TGCAGTAGCTGTTAACCCACGTGTGGTATTGTGTAGAGCTCAAATTAGGATTAC3′ | LEU2 |
| pP8apain UASp1_high | this study 5′GATAAGAAGGAAAAATTATATTCCACGTGCGGGTAAAGGCAAGGAAGAATC3′ GATTCTTCCTTGCCTTTACCCGCACGTGGAATATAATTTTTCCTTCTTATC | LEU2 |
| pP8apain intraUASp_ scrambled | this study 5′CTCTACACAATACCACTCGAGGGTTAACAGCTACTGC3′ 5′GCAGTAGCTGTTAACCCTCGAGTGGTATTGTGTAGAG3′ | LEU2 |
| pCB84a-Bhi | this study 5′CAGTATTACGCACGTGGGTGCTGTTATAGGC3′ 5′GCCTATAACAGCACCCACGTGCGTAATACTG3′ | LEU2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lieleg, C.; Novacic, A.; Musladin, S.; Schmid, A.; Akpinar, G.G.; Barbaric, S.; Korber, P. Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler. Int. J. Mol. Sci. 2023, 24, 4949. https://doi.org/10.3390/ijms24054949
Lieleg C, Novacic A, Musladin S, Schmid A, Akpinar GG, Barbaric S, Korber P. Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler. International Journal of Molecular Sciences. 2023; 24(5):4949. https://doi.org/10.3390/ijms24054949
Chicago/Turabian StyleLieleg, Corinna, Ana Novacic, Sanja Musladin, Andrea Schmid, Gözde Güçlüler Akpinar, Slobodan Barbaric, and Philipp Korber. 2023. "Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler" International Journal of Molecular Sciences 24, no. 5: 4949. https://doi.org/10.3390/ijms24054949
APA StyleLieleg, C., Novacic, A., Musladin, S., Schmid, A., Akpinar, G. G., Barbaric, S., & Korber, P. (2023). Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler. International Journal of Molecular Sciences, 24(5), 4949. https://doi.org/10.3390/ijms24054949

