Next Article in Journal
Effects of Single and Combined Ciprofloxacin and Lead Treatments on Zebrafish Behavior, Oxidative Stress, and Elements Content
Previous Article in Journal
Silk Sericin Protein Materials: Characteristics and Applications in Food-Sector Industries
Previous Article in Special Issue
DNA Sequence-Dependent Properties of Nucleosome Positioning in Regions of Distinct Chromatin States in Mouse Embryonic Stem Cells
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler

1
Biomedical Center (BMC), Molecular Biology, Faculty of Medicine, LMU Munich, Planegg-Martinsried, 82152 Munich, Germany
2
Laboratory of Biochemistry, Faculty of Food Technology and Biotechnology, University of Zagreb, 10000 Zagreb, Croatia
*
Author to whom correspondence should be addressed.
Current address: Helmholtz-Zentrum Munich, 85764 Neuherberg, Germany.
Current address: In Vitro Pharmacology, Selvita d.o.o., 10000 Zagreb, Croatia.
§
Current address: Division of Immunology and Allergy, Department of Medicine Solna, Karolinska Institutet, 17177 Stockholm, Sweden.
Int. J. Mol. Sci. 2023, 24(5), 4949; https://doi.org/10.3390/ijms24054949
Submission received: 5 December 2022 / Revised: 14 February 2023 / Accepted: 19 February 2023 / Published: 3 March 2023
(This article belongs to the Special Issue Positioning of Nucleosomes 2.0)

Abstract

Chromatin remodeling by ATP-dependent remodeling enzymes is crucial for all genomic processes, like transcription or replication. Eukaryotes harbor many remodeler types, and it is unclear why a given chromatin transition requires more or less stringently one or several remodelers. As a classical example, removal of budding yeast PHO8 and PHO84 promoter nucleosomes upon physiological gene induction by phosphate starvation essentially requires the SWI/SNF remodeling complex. This dependency on SWI/SNF may indicate specificity in remodeler recruitment, in recognition of nucleosomes as remodeling substrate or in remodeling outcome. By in vivo chromatin analyses of wild type and mutant yeast under various PHO regulon induction conditions, we found that overexpression of the remodeler-recruiting transactivator Pho4 allowed removal of PHO8 promoter nucleosomes without SWI/SNF. For PHO84 promoter nucleosome removal in the absence of SWI/SNF, an intranucleosomal Pho4 site, which likely altered the remodeling outcome via factor binding competition, was required in addition to such overexpression. Therefore, an essential remodeler requirement under physiological conditions need not reflect substrate specificity, but may reflect specific recruitment and/or remodeling outcomes.

1. Introduction

The packaging of eukaryotic genomes into chromatin, especially into nucleosomes consisting of 147 base pairs (bp) of DNA wrapped around a histone octamer [1,2], is primarily repressive to all processes that require access to DNA, like transcription or replication [3]. Therefore, in contrast to prokaryotes [4], the default state of eukaryotic genomes corresponds to an “off-state” and most genome activities necessitate opening (“remodeling”) of chromatin structure and its nucleosome constituents [5]. This fits to the regulatory requirements of multicellular eukaryotes where only a small fraction of the genome is expressed in each cell. Unicellular eukaryotes, like the budding yeast Saccharomyces cerevisiae, are atypical in this regard, as they constitutively express most of their genes. Accordingly, the nucleosome organization at most yeast promoters corresponds to an “open door policy,” [6] where a nuclease hypersensitive site (HSS) (for discussion of the alternative terms nucleosome-depleted region (NDR) versus nucleosome-free region (NFR) see [7,8]) of up to 150 bp length just upstream of the transcription start site allows access to the transcription machinery [5,8,9]. Nonetheless, some genes are repressed under standard growth conditions and become induced upon specific, often environmentally triggered, signaling. The promoters of these inducible genes are often kept in a repressed state by positioned nucleosomes over functional elements, like the TATA and UAS (upstream activating sequence, i.e., yeast enhancers) elements, and nucleosome remodeling is a crucial prerequisite [10] for their activation [11,12].
Promoters of the phosphate response (PHO) genes in S. cerevisiae are paradigmatic for this latter type (reviewed in [13,14]). PHO signaling is a nutrient-dependent regulatory pathway that responds to intracellular inorganic phosphate (Pi) levels [15,16]. The principal transactivator Pho4 activates numerous PHO genes constituting the PHO regulon. Of these, the PHO5, PHO8 and PHO84 genes serve since many years as models for nucleosome remodeling mechanisms in the course of promoter opening and transcriptional activation upon gene induction and are highly instructive for analogous mechanisms in multicellular eukaryotes. Under conditions of high phosphate supply (+Pi conditions), Pho4 is phosphorylated by the Pho80/Pho85 cyclin/cyclin-dependent kinase complex. This phosphorylation prevents gene activation by Pho4 as it expedites nuclear export and prevents nuclear reimport of Pho4, as well as hampers the interaction with Pho4′s cooperative binding partner Pho2 [17,18,19,20,21,22]. Upon Pi removal (−Pi conditions) and concomitant decrease of intracellular Pi levels, Pho80/Pho85 are inhibited by Pho81, and non-phosphorylated Pho4 accumulates in the nucleus, binds to its binding sites, the UASp elements (upstream activating sequence phosphate regulated), triggers promoter chromatin remodeling [23] and transactivates transcription [24]. Accordingly, deletion of PHO80 or PHO85 [25] or out-titration of the Pho80/Pho85 kinase activity by PHO4 overexpression [23] circumvents the actual PHO signalling pathway and leads to PHO gene induction even at +Pi conditions.
A long series of studies in many labs, especially regarding the PHO5 promoter (reviewed in [13]), elucidated the promoter chromatin opening mechanism in exceptional detail. Pho4 recruits via its activation domain [26,27] chromatin modifying enzymes, like the SAGA complex [28,29], that lead to transient hyperacetylation of promoter nucleosome histones [30,31]. Pho4 also recruits, directly or indirectly, ATP-dependent chromatin remodeling enzymes, for example, the SWI/SNF complex [27,29,32]. Such “remodelers” translocate, assemble and disassemble nucleosomes, as well as change their composition with regard to histone variants [33,34,35,36,37], by using the energy of ATP hydrolysis. They are at the core of the promoter-opening mechanism.
One fundamental question regarding remodelers deals with their specificity and essential versus redundant roles. Many remodeling complexes in yeast, like ISW1a, ISW1b, ISW2, INO80, RSC and SWI/SNF, are able to slide nucleosomes along the DNA, but only two of these, RSC and SWI/SNF, are able to disassemble nucleosomes from the DNA [34,36,37]. The RSC complex is the only remodeler essential for viability in yeast [38], while all others can be deleted, even several of them at the same time [39], arguing that their functions are not essential or can be compensated by other remodelers. The SWR1 complex is an example of highly specialized, non-essential but non-compensated function as only this remodeler exchanges canonical histone H2A for the variant histone H2A.Z (Htz1 in yeast) in vivo [40]. Nucleosomes in an swr1 deletion strain hardly contain any Htz1 despite expression of Htz1 [41].
While it seems clear–although mechanistically still unexplained–that the SWR1 complex exerts a very specific activity that no other remodeler can provide, it is much less clear why a certain remodeling process, like promoter chromatin opening upon induction, should essentially depend on one particular remodeler even though others exert the same or very similar activities, at least in vitro.
To address this question, we turned to the PHO8 and PHO84 promoters in budding yeast. At both promoters, there are nucleosomes that cannot be removed in the absence of SWI/SNF activity, even under full physiological induction conditions [42,43,44]. This encompasses all PHO8 promoter nucleosomes and therefore prevents PHO8 activation, while it relates to only the so-called “upstream nucleosome” (see below) at the PHO84 promoter without much effect on full PHO84 expression. In addition to SWI/SNF, the INO80 complex is also involved in opening both promoters, but not in such an essential way [42,45]. Curiously, even though both promoters depend stringently on SWI/SNF they do not require the RSC complex [46], which would seem an appropriate substitute for SWI/SNF, as both these remodeling complexes belong to the same remodeler family, show very similar activities in terms of nucleosome sliding and disassembly in vitro [34,36,37] and co-operate at other inducible promoters [47,48].
This essential requirement for SWI/SNF during physiological induction of the PHO8 and PHO84 promoters is in stark contrast to the remodeler requirements at the PHO5 promoter [46]. Five different remodelers from all four major remodeler families (SWI/SNF, CHD, ISWI, INO80 families [49]) are redundantly involved in opening PHO5 promoter chromatin, i.e., the remodelers SWI/SNF, RSC, INO80, Isw1, and Chd1 [31,32,44,45,46,50,51,52].
As all three PHO promoters are coactivated by the same transactivator Pho4, their different dependencies on chromatin cofactors for chromatin opening seemed unlikely due to different recruitment specificities, i.e., in principle, the same set of cofactors should be recruited to each promoter. Instead, it seems possible that there is something particular, maybe linked to DNA sequence or histone modifications, about some nucleosomes that caused the strict SWI/SNF dependency of PHO8 and PHO84 promoter nucleosome remodeling in vivo. Conversely, SWI/SNF may possess a mechanistically unique activity. Maybe only this remodeler was able to remodel these particular nucleosomes and/or only SWI/SNF could remove these nucleosomes as remodeling outcome, whereas others would (re-)generate the nucleosome pattern of the repressed state so that on time average, it seemed as if they did not remodel such nucleosomes. Indeed, the chromatin state of the PHO8 promoter and of the upstream nucleosome at the PHO84 promoter in snf2 mutants, where SWI/SNF activity is abolished, always displayed a pattern similar to the repressed state in wt cells [42,43], i.e., other non-SWI/SNF remodelers always regenerated this state after replication.
Mechanistically, the stringent SWI/SNF requirement for remodeling PHO8 and PHO84 promoter nucleosomes could reflect at least three different scenarios. First, such particular nucleosomes may need an especially high local remodeling activity and SWI/SNF may be the only remodeler recruited by Pho4 to sufficiently high local levels. Second, only the SWI/SNF complex may efficiently accept such nucleosomes as substrates for remodeling. Third, other remodelers may also remodel such nucleosomes, but only SWI/SNF removes them in the end while the others tend to put them back so that on time average it seems as if they do not remodel such nucleosomes. Thus, the problem could lie in either the local remodeler concentration, in the nucleosome as substrate, or in the remodeler-specific remodeling outcome. In metaphorical terms, the question is if SWI/SNF is the only screwdriver ready at hand to unscrew that screw (recruitment specificity), or if SWI/SNF is the only screwdriver that fits that screw (substrate specificity), or if SWI/SNF is the only screwdriver that will unscrew while other screwdrivers mostly tighten that screw (remodeling outcome specificity). The first scenario should allow SWI/SNF-independent remodeling upon enhanced recruitment of other remodelers, while the second and third scenarios should not allow it. Such strict mechanistic dependency would contrast with the finding that remodelers of different families were all able to remodel nucleosomes of widely different intrinsic stabilities in vitro [53]. Nonetheless, some aspects of nucleosome properties and remodeler functions in vivo may be missed by such in vitro studies. The third scenario would be in line with in vitro demonstrations that different remodelers lead to different remodeling outcomes, e.g., nucleosome sliding, eviction or compositional changes [34,36,37,54] and generate different steady state nucleosome positioning on the same DNA sequence [55,56,57]. Conversely, changing the DNA sequence in a nucleosome can alter remodeling outcomes and remodeler preferences. As a prominent example, the RSC complex prefers remodeling nucleosomes that contain poly(dA:dT) sequences [58] and removes them in a directional way, i.e., in the 5′ direction from the poly(dA) sequence [56]. In retrospect, this explains our earlier observation that introduction of poly(dA:dT) sequences into the “upstream nucleosome” at the PHO84 promoter relaxed its SWI/SNF requirement or remodeling in vivo [42]. The poly(dA:dT)-containing nucleosome likely became a preferred substrate for RSC, which circumvented the SWI/SNF requirement.
To distinguish these scenarios, we asked if it was possible to circumvent the strict SWI/SNF requirement for nucleosome remodeling at the PHO8 and PHO84 promoters. We found two conditions, insertion of an intranucleosomal UASp element or overexpression of PHO4 that, each on its own, led to PHO8 promoter nucleosome remodeling in the absence of SWI/SNF activity, while PHO84 promoter nucleosome remodeling required the combination of both. This argues against substrate specificity but for recruitment strength and/or remodeling outcome specificity underlying the otherwise strict SWI/SNF requirement at both promoters.

2. Results

2.1. An Additional Intranucleosomal High-Affinity UASp Element Allows PHO8 Promoter Nucleosome Remodeling without SWI/SNF Activity

The PHO8 gene encodes an vacuolar alkaline phosphatase [59]. The PHO8 promoter in its repressed state (+Pi conditions) is organized into three positioned nucleosomes and three short HSSs (Figure 1A, [60]). The HSS closest to the gene start is just upstream of the TATA box and the other two contain the UASp2 and UASp1 elements, respectively. The consensus sequence of UASp elements is an E-box motif CACGTG and the extent of matching this motif as well as surrounding bases modulates Pho4 binding strength [61,62,63,64]. UASp2 (CACGTGG) is a high-affinity binding site, while UASp1 (CACGCTT) has low affinity and little role in transactivation as its deletion reduces induced levels of Pho8 alkaline phosphatase activity relative to wild type (wt) by only 5% [65]. Upon PHO8 induction, the −3 nucleosome flanked by the UASp elements becomes remodeled into an extended HSS of about 300 bp, as seen by increased DNaseI or MNase accessibility in indirect end labeling analyses, as well as by increased accessibility of the intranucleosomal HpaI restriction site [60]. This extended HSS and increased HpaI accessibility is not seen in snf2∆ deletion mutants lacking the Snf2 ATPase subunit of the SWI/SNF remodeling complex or if Snf2 ATPase activity is abolished by a point mutation in the snf2K798A allele (Figure 1B, [43]).
To search for conditions that could allow PHO8 promoter nucleosome removal in the absence of SWI/SNF, we focused on nucleosome −3. “Nucleosome removal” means here any loss of canonical nucleosome structure as monitored by increased accessibility to DNaseI or restriction endonucleases. At the PHO5 promoter, nucleosome remodeling is aided by the endogenous intranucleosomal UASp2 site, as it contributes binding competition between the high-affinity DNA binder Pho4 and the histone octamer to the remodeling mechanism, like a pry bar [66]. Therefore, we introduced an additional high-affinity UASp element into the −3 nucleosome of the PHO8 promoter and tested if this allowed removal of this nucleosome in the absence of SWI/SNF. Indeed, the generation of a high-affinity CACGTGG element by three point mutations within the −3 nucleosome (Figure 1A) led to increased HpaI accessibility (54 ± 3% for intranucleosomal high-affinity UASp vs. 9 ± 2% for wt promoter, Figure 1B) and increased DNaseI sensitivity (Figure 1C, HSS between −388 and −874 marker bands, see Figure 2, Figure 3, Figure 4 and Figure 5 for examples of DNaseI patterns with not removed −3 nucleosome) in this region upon –Pi induction in snf2∆ cells, which was similar to the chromatin opening extent of the wt PHO8 promoter in wt cells (61 ± 8%). This increase depended on the proper UASp sequence as a scrambled, still palindromic non-UASp element (CTCGAGG, Figure 2A, top panel) with the same GC content as the high-affinity UASp at the same position did not have this effect (17 ± 2% HpaI accessibility, Figure 2B).
At the PHO5 promoter, enhanced remodeling by the intranucleosomal UASp element was mainly due to its intranucleosomal location and not just due to increased Pho4 recruitment potential caused by the presence of an additional high-affinity UASp element [66]. To test whether this was also true at the PHO8 promoter, we turned its low affinity UASp1 element, which is not intranucleosomal but located in a constitutive HSS (Figure 1A), into a high-affinity (CACGTGG) site (Figure 2A, bottom panel). This also led to a slight increase in HpaI accessibility (29 ± 6%) but hardly any increase in DNaseI sensitivity in the region of the −3 nucleosome upon induction in snf2∆ cells (Figure 2B). The effect was clearly much less pronounced than for the intranucleosomal high-affinity UASp element (54 ± 3% HpaI accessibility).
We concluded that an additional intranucleosomal high-affinity UASp element allowed circumventing the otherwise strict dependency of PHO8 promoter nucleosome removal on SWI/SNF activity probably by additional binding competition and less so by increased Pho4 recruitment potential.

2.2. PHO4 Overexpression Is Sufficient for PHO8 Promoter Chromatin Remodeling without SWI/SNF

It is well established that the stringency of chromatin cofactor dependency for PHO5 promoter opening scales reciprocally with induction strength as mediated by the extent of Pho4 recruitment and thereby Pho4 occupancy at the promoter [32]. Therefore, we asked if enhanced Pho4 recruitment alone, beyond physiological levels and without binding competition via an intranucleosomal Pho4 site, could also allow PHO8 promoter nucleosome removal without SWI/SNF. Elevated PHO4 expression leads to substantial nuclear levels of non-phosphorylated Pho4 already under +Pi conditions and, thereby, to partial PHO induction, resulting in rather extensive chromatin opening at the PHO5, PHO8 and PHO84 promoters in wt, but not in snf2 cells (Figure 3, [23,42,45]). Combining PHO4 overexpression with –Pi conditions corresponds to boosted induction beyond physiological “full induction” conditions. Indeed, this boosted induction led to increased HpaI accessibility at the PHO8 promoter for wt cells compared to mere –Pi conditions (HpaI accessibility of 82 ± 3% with vs. 61 ± 8% without PHO4 overexpression, respectively, Figure 1B and Figure 3). Remarkably, even snf2 cells showed substantially increased DNaseI sensitivity and HpaI accessibility, consistently somewhat more extensive in the snf2K798A than in the snf2∆ mutant (59 ± 6% vs. 43 ± 9% HpaI accessibility, respectively, Figure 3). This difference between snf2 alleles was also apparent for the very limited extent of remodeling upon PHO induction without PHO4 overexpression (HpaI accessibility of 20 ± 1% for snf2K798A vs. 9 ± 2% for snf2∆, Figure 1B). Chromatin opening upon PHO4 overexpression at –Pi conditions was not significantly increased if it was combined with the intranucleosomal UASp element (HpaI accessibility of 64 ± 18% with vs. 43 ± 9% without intranucleosomal UASp, Figure 1B and Figure 3).
PHO5 promoter chromatin opening triggered by Pho4 depends on its activation domain and the viral VP16 activation domain is a less potent substitute if fused to the Pho4 DNA binding domain (DBD) [26]. Similarly, we showed here that the PHO8 promoter nucleosome removal in the absence of SWI/SNF activity was also not possible if just the Pho4 DBD without the Pho4 activation domain was overexpressed (26 ± 1% HpaI accessibility, Figure 4) and was much less extensive upon overexpression of the VP16 activation domain fused to the Pho4 DBD (HpaI accessibility of 38 ± 2% for Pho4DBD-VP16 and less DNaseI hypersensitivity vs. 59 ± 6% HpaI accessibility and full DNaseI hypersensitivity for full length Pho4, Figure 4). As the Pho4 activation domain recruits chromatin cofactors [27], we concluded that increased nuclear Pho4 levels via PHO4 overexpression led to increased recruitment of other remodeling enzyme(s) that is/are able to remodel PHO8 promoter nucleosomes in the absence of SWI/SNF.

2.3. PHO80 Deletion Is Less Effective Than PHO4 Overexpression Regarding PHO8 Promoter Nucleosome Removal without SWI/SNF

It seemed that PHO8 promoter nucleosome removal without SWI/SNF required elevated nuclear Pho4 levels. We therefore tested the pho80∆ deletion allele as another way of modulating nuclear Pho4 levels in vivo. PHO80 deletion leads to constitutive nuclear accumulation of non-phosphorylated Pho4 [17] such that PHO5 and PHO8 promoter chromatin becomes remodeled already at +Pi conditions [60,67]. We wondered if the combination of the pho80 allele with –Pi inducing conditions, leading to increased induction at the PHO5 promoter [68], would allow PHO8 promoter opening without SWI/SNF activity. However, this was hardly the case as judged by the DNaseI pattern (Figure 5) and also HpaI accessibility did not increase significantly (20 ± 1% in the corresponding snf2K798A PHO80 strain (Figure 1B) vs. 25 ± 7% in snf2K798A pho80∆ (Figure 5)). In addition, combining the pho80∆ allele with PHO4 overexpression and –Pi induction did not generate more extensive nucleosome removal than without the pho80∆ allele (HpaI accessibility of 50 ± 1% with pho80 allele (Figure 5) vs. 59 ± 6% without (Figure 3)).

2.4. RSC Rather Hinders Than Helps Circumventing the SWI/SNF Requirement for PHO8 Promoter Nucleosome Removal under Conditions of PHO4 Overexpression

RSC is the other member of the SWI/SNF remodeler family in yeast [49] that cooperates with SWI/SNF in remodeling at the PHO5 promoter [46] as well as at other highly expressed genes in yeast [47,48], and may provide the other remodeling activity in the absence of SWI/SNF for remodeling of the PHO8 promoter −3 nucleosome upon PHO4 overexpression. However, there were also observations that may argue the opposite way. We showed that RSC depletion via a temperature-sensitive sth1td degron allele at 37 °C did not affect PHO8 promoter opening upon physiological induction [46]. Moreover, RSC ablation via a temperature-sensitive rsc3-ts allele at 37 °C led to some PHO8 promoter nucleosome removal already under +Pi conditions as seen by increased HpaI accessibility (47% in rsc3-ts [69]) and an altered DNaseI cleavage pattern similar to opened chromatin upon –Pi induction, even in the absence of Pho4 (rsc3-ts pho4 double mutant, [69]).
We wished to clarify RSC’s role in PHO8 promoter nucleosome remodeling in the absence of SWI/SNF. RSC ablation on its own (sth1td allele) and in the presence of SWI/SNF increased HpaI accessibility at –Pi and 37°C conditions to a similar relative extent (86 ± 5% for sth1td vs. 71 ± 8% for wt (Figure 6)) as did PHO4 overexpression in the wt background at –Pi and 30 °C (82 ± 3% with (Figure 3) vs. 61 ± 8% without PHO4 overexpression (Figure 1B)). Therefore, removing RSC had a similar effect as elevated Pho4 levels, which suggested that RSC is not only not needed for chromatin opening at the PHO8 promoter, at least in the presence of SWI/SNF, but may even counteract opening. Its absence allowed partial remodeling under repressive [69] and an increased remodeling extent under inducing conditions (Figure 6).
To follow up on this, we asked if nucleosome remodeling would proceed to a higher degree in the absence of SWI/SNF if we combined it with RSC removal. We tested PHO8 promoter opening at the HpaI site in an snf2∆ sth1td double mutant with PHO4 overexpression upon –Pi induction and at 37 °C. Under these conditions, the HpaI site in the snf2∆ sth1td strain was slightly but significantly more open than in the snf2∆ strain (58 ± 2% vs. 52 ± 3% (Figure 6)). This argues that RSC is not one of the other remodelers, but rather hindrance than help for remodeling of the PHO8 promoter −3 nucleosome in the absence of SWI/SNF.

2.5. Combining PHO4 Overexpression with an Additional High-Affinity Intranucleosomal UASp Element Is Necessary to Allow Partial PHO84 Promoter Opening without SWI/SNF

The PHO84 gene encodes a high-affinity Pi transporter of the plasma membrane [70]. Its promoter is among the strongest PHO promoters and harbors five UASp elements (UASpA to UASpE, [64]). Similar to the PHO5 and PHO8 promoters, it also undergoes extensive chromatin remodeling upon induction by phosphate starvation [42,68]. At +Pi conditions, two high-affinity Pho4 sites (UASpC/D) reside in a constitutive short HSS. This HSS is flanked by two well-positioned nucleosomes (the “upstream” and “downstream” nucleosomes, respectively (Figure 7A)) that each harbor a low affinity Pho4 site (UASpB and UASpE, respectively). The TATA box region has an ambiguous nucleosome organization of intermediate accessibility. Upon –Pi induction, the complete PHO84 promoter region, including the upstream and downstream nucleosomes, as well as most of the TATA box region, turns into an extensive HSS of ~500 bp length of virtually full nuclease accessibility. This chromatin remodeling and gene induction is mainly driven by the UASpC/D/E elements with very little contribution of the UASpA/B elements.
As remodeling of the upstream nucleosome at the PHO84 promoter depends strictly on the SWI/SNF complex [42], similar to PHO8 promoter nucleosome remodeling [43], we asked if this dependency could be circumvented in a similar manner as we found here for the PHO8 promoter. We first tried the combination of –Pi induction and PHO4 overexpression. In contrast to the PHO8 promoter, this did not allow remodeling of the upstream nucleosome in snf2∆ or snf2K798A cells as monitored by HhaI accessibility (4 ± 1% in snf2∆ and 11 ± 3% in snf2K798A cells (Figure 7B)), which probes specifically the SWI/SNF-dependent upstream nucleosome [42], and by DNaseI indirect end labeling (Figure 7B). Second, we turned the intranucleosomal low affinity UASpB element (CACGTTG), located in the “upstream” nucleosome, via a single point mutation into a high affinity site (CACGTGG, Figure 7A). This also did not allow remodeling of the upstream nucleosome in snf2∆ cells upon overnight phosphate starvation (HhaI accessibility of 8 ± 2 % (Figure 8)).
Only the combination of the high-affinity UASpB site with PHO4 overexpression and –Pi induction led to partial remodeling of the upstream nucleosome in the absence of SWI/SNF, as seen by 31 ± 1% HhaI accessibility and a DNaseI pattern in the region of the upstream nucleosome that resembled the open state (Figure 8, compare with the DNaseI pattern of the open state in wt under –Pi conditions in Figure 7B).
We concluded that PHO84 promoter upstream nucleosome remodeling depended more strictly on SWI/SNF than remodeling at the PHO8 promoter. Circumventing the SWI/SNF dependency at the PHO84 promoter required the combination of enhanced Pho4 recruitment and an intranucleosomal high-affinity Pho4 site and even then remained only partial.

3. Discussion

Our study contributes to one of the central questions regarding chromatin remodeling mechanisms: why do certain chromatin transitions depend on specific chromatin cofactors in a more or less stringent way? The differential SWI/SNF requirement for the PHO5, PHO8 and PHO84 promoters served since many years as an example for the difference between relaxed versus essential requirement although these promoters depend on the same transcriptional transactivator Pho4 [13]. Part of this discussion was the assumption that there may be something special about PHO8 and PHO84 promoter nucleosomes so that only SWI/SNF and not even the closely related [49] and more abundant [71] RSC remodeling complex, which is still active in snf2 mutants, could remodel such nucleosomes. This aspect of nucleosome substrate and remodeling specificity in PHO promoter chromatin opening mechanisms has to be re-considered, as we now demonstrate conditions for PHO8 and PHO84 promoter nucleosome removal without SWI/SNF in vivo. We summarize these conditions in Table 1.
Regarding the PHO8 promoter, the so far seemingly essential SWI/SNF requirement for nucleosome removal does not reflect a mechanistic specialty of this particular remodeling enzyme that would exclusively be able to remodel these special nucleosomes in vivo. Instead, we showed via boosted induction strength upon PHO4 overexpression that the SWI/SNF requirement at this promoter has to join the ranks of the many chromatin cofactors, e.g., Ino80, Gcn5, Asf1, that are involved in PHO promoter chromatin opening to a degree that reciprocally scales with induction strength [32,42,45,72,73]. Remodelers other than SWI/SNF were able to remodel PHO8 promoter nucleosomes, but seem to be recruited less efficiently or remodel less effectively so that their activity became apparent only upon increased Pho4 levels. At present, we do not know for sure if the other remodeler(s) is/are directly recruited by Pho4, as would be similar to remodeler recruitment by Gcn4 [47], but the strong effects of PHO4 overexpression and the dependency on the Pho4 activation domain argue in this direction. We also cannot distinguish if this forced recruitment leads to the same amount of local activity of other remodeler(s) that then remodel(s) with the same effectiveness as otherwise SWI/SNF does. We also do not know if the forced recruitment has to bring in (much) more of the other remodeler(s) as its/their specific remodeling activity per remodeler molecule may be lower than that of SWI/SNF. This will be difficult to distinguish, as it depends on accurate determination of local remodeler occupancy in vivo. Monitoring remodeler occupancy at PHO promoters by chromatin immunoprecipitation (ChIP) or other techniques is notoriously unreliable. For example, RSC binding to the PHO5, PHO8 and PHO84 promoters was detected by anti-Rsc9-ChIP-chip [74] and anti-Sth1-CUT & RUN [75], but not by native anti-Sth1-ChIP-seq [76] or anti-Rsc8-ChEC-seq [77]. Further, one would have to compare occupancies among remodelers, but all these techniques have unknown and difficult-to-calibrate remodeler-specific efficiencies.
Nonetheless, our data clearly show that forced induction strength allows circumventing the so far seemingly essential SWI/SNF requirement for PHO8 promoter opening. In addition, we also found that the remodeling outcome could be changed for the non-SWI/SNF remodeler(s) by introduction of an intranucleosomal high-affinity UASp, even at physiological induction strength. As only the intranucleosomal UASp and not just an additional UASp in the neighboring linker region showed this effect, this approach unlikely amounts to just another way of increased recruitment of Pho4 and consequently of other remodelers at the promoter. Instead, this likely is another case where binding competition between the specific DNA binding factor Pho4 and the histone octamer potentiates or alters chromatin remodeling outcome, as we showed previously at the PHO5 promoter [66]. The effect here is even more pronounced as binding competition not only makes a difference between weak versus strong remodeling at the PHO5, but between no and almost full opening at the PHO8 promoter.
At the PHO84 promoter, the SWI/SNF-dependency for remodeling of the upstream nucleosome probably corresponds to a combination of recruitment and remodeling outcome specificity as only the combination of forced induction and introduction of intranucleosomal high-affinity UASp element led to partial remodeling without SWI/SNF. It may seem surprising that remodeling at the PHO84 promoter looked rather extensive by DNaseI indirect end labeling but rather partial by restriction enzyme accessibility (Figure 8). This is due to the very limited digestion degrees employed for DNaseI indirect end labeling so that the patterns reflect the most nuclease-sensitive chromatin states while the majority of templates are still undigested in the region of interest (see strong bands in upper part of lanes for all DNaseI patterns). Therefore, DNaseI patterns are good for demonstrating if hypersensitive regions are generated and for showing how they look. However, this technique has to be complemented by a more quantitative assay, like restriction enzyme accessibility, to monitor which fraction of chromatin templates was actually remodeled. Accordingly, this “partially open” PHO84 promoter upstream nucleosome upon phosphate starvation and PHO4 overexpression in snf2∆ cells and in the presence of the intranucleosomal high-affinity UASp likely means that this nucleosome is fully remodeled for some templates, but only in a smaller fraction than in wt cells under full induction conditions.
For sure, remodeling of PHO8 and PHO84 promoter nucleosomes without SWI/SNF calls for one or several other remodeling enzyme(s). At the PHO8 promoter, the RSC complex is unlikely to contribute to the other remodeler(s), but rather, seems to counteract them. RSC opposes PHO8 promoter opening with or without SWI/SNF, as HpaI accessibility was always higher upon RSC depletion. The effect was not large, but was significant, and may amount to another example of remodeler-specific remodeling outcome. In this sense, and in line with our earlier conclusions [69], we suggest that the outcome of PHO8 promoter chromatin remodeling by RSC may correspond to the nucleosome positioning pattern of the repressed, whereas the outcome of remodeling by SWI/SNF corresponds to the pattern of the induced state. RSC activity would be dominant at the promoter under +Pi conditions, as it is globally much more abundant than SWI/SNF [71]. Upon PHO induction, Pho4 binds at the promoter and recruits SWI/SNF [27,32] and thereby increases local SWI/SNF levels so that SWI/SNF would overcome/outcompete the RSC activity and remodel this nucleosome in its SWI/SNF-specific way [78], leading to the extended hypersensitive site. Accordingly, if RSC is ablated, the remodeling outcome by SWI/SNF is increased under inducing conditions, as shown here (Figure 6), and already, the global SWI/SNF levels without Pho4-mediated local recruitment under +Pi conditions led to partial nucleosome remodeling [69]. Conversely, other remodelers in the absence of SWI/SNF would also have to overcome RSC. Indeed, we noticed (Figure 3) that the ATPase-dead version of the SWI/SNF complex (snf2K798A) allowed a bit more opening by other remodelers than the complete absence of the SWI/SNF complex (snf2∆). This tendency was the other way around at the PHO5 promoter where chromatin opening was more impaired in the snf2K798A than in the snf2∆ mutant [45]. These slight differences between both SWI/SNF-inactivating alleles at these two promoters may reflect that both SWI/SNF and RSC contain bromodomains [35] and compete for binding to acetylated histones that are present at both promoters during induction [30,31]. Therefore, we suggest that a nonfunctional SWI/SNF complex that still binds to acetylated histones hinders RSC’s positive role during PHO5 promoter, but hinders RSC’s negative role during PHO8 promoter opening.
While RSC is no help for PHO8 promoter opening, we cannot exclude that RSC may have a role at the PHO84 promoter in the presence of the intranucleosomal high-affinity UASp, as argued above regarding a possible change of remodeling outcome due to the addition of binding competition.
As we showed that also the INO80 complex [42,45] has a role in physiological opening of the PHO8 and PHO84 promoters, we speculate that INO80 contributes to the other remodeling activity in the absence of SWI/SNF. Nonetheless, also other remodelers like Isw1 or Chd1 may contribute, as we showed for the PHO5 promoter [46]. Our finding that SWI/SNF-independent PHO8 promoter chromatin opening could be achieved either by increased recruitment or by additional binding competition may suggest that the other remodeler(s) differ(s) in the former vs. the latter case. These questions will be addressed in a future study.
In summary, this and future studies that investigate differential chromatin cofactor requirements across genomic loci help to understand the diversification of specificity in recruitment, substrate and remodeling outcome in the evolution of remodeler ATPases and other chromatin cofactors and their more or less essential roles in physiological remodeling pathways.

4. Materials and Methods

4.1. Strains, Media, Plasmids and Strain Construction

Saccharomyces cerevisiae strains used in this study are listed in Table 2. Strains CY397 ura3 and CY408 ura3 were derived from CY397 and CY408 after selection on 5-fluoroorotic acid (5-FOA)-containing medium and confirmed for uracil auxotrophy. Strain CY39780 was generated by transformation of CY397 with a linear DNA fragment of the pho8 locus where a LEU2 marker gene cassette was inserted into the PHO80 coding region. Strain CY407 pho8::KAN and CY397 pho8::KAN were generated by transformation of CY407 or CY397, respectively, with a linear DNA fragment generated by PCR using genomic DNA of strain Y04315 (EUROSCARF strain) as template and the primers 5′-CTTGCTAGCAACAATAGGCG-3′ and 5′-AGGAAGAAGTTGGCTGGTAG-3′. Successful disruption of the genomic PHO8 ORF was confirmed by Southern blotting as hybridization with a probe hybridizing in the mid-coding region of the PHO8 gene no longer gave a signal.
For repressive conditions (high phosphate, +Pi), yeast strains were grown at 30 °C in YPDA medium (YPD with 0.1 g/liter adenine plus 1 g/l KH2PO4) for strains without and in YNB selection medium supplemented with the required amino acids for strains with plasmids. Phosphate starvation conditions always corresponded to incubation in phosphate-free synthetic medium with or without lack of amino acids for plasmid selection [45,80]. For transfer to phosphate-free medium, cells were grown and washed in water and resuspended in the phosphate-free medium. If not indicated otherwise, phosphate starvation was overnight.
For results at 37 °C in Figure 6, all strains were grown in YNB medium supplemented with 1 g/l KH2PO4 (YNBP) either lacking uracil for strains with the sth1td allele or without selection for all other strains. All strains were first grown to logarithmic phase at 24 °C and then shifted to 37 °C and either YNBP or phosphate-free medium prewarmed to 37 °C (without uracil for sth1td containing strains) over night. For each experiment involving the sth1td allele, the respective temperature-sensitivity phenotype was confirmed by growth arrest at 37 °C for more than 12 h after shifting back from phosphate-free to +Pi medium, i.e., YNBP minus uracil medium.
The Pho4 overexpression plasmid pP4-70L corresponds to YEpP4 (=pP4-70U [26]) but carries the LEU2 instead of the URA3 marker [45]. Plasmids pP4-72 and pP4-72V encode the DNA-binding domain of Pho4 only or a fusion of the Pho4 DNA binding domain with the activation domain of VP16, respectively, under control of the PHO4 promoter, as described in [26]. Plasmids pP8apain intra UASp_high, pP8apain UASp1_high and pP8apain intra UASp_scrambled were generated by QuikChange mutagenesis (Stratagene) of plasmid pP8apain (=pCB/wt(LEU2) derivative with PHO8 insert as described in [81]), and plasmid pCB84a-Bhi by QuikChange mutagenesis of pCB84 or pCB84Dmut, respectively [42] using mutagenesis primers, as listed in Table 3. The DNA sequence of the mutated PHO8 and PHO84 promoter region was confirmed by Sanger sequencing.

4.2. Chromatin Analysis

The preparation of yeast nuclei and chromatin analysis of nuclei by DNaseI indirect end labeling and restriction endonuclease accessibility assays were done as previously described [10,46,80,82,83]. In brief, chromatin digested with DNaseI and deproteinized was secondarily cleaved with BglII or SspI for PHO8 and PHO84, respectively. DNA fragments separated on a 1.5% agarose gel (Loening buffer: 40 mM Tris, 12 mM NaOAc, 36.4 mM acetic acid, 1 mM EDTA) were transferred onto a Nylon membrane (Biodyne®, PALL Corporation) by Southern blotting and specifically visualized with a probe abutting the respective restriction site. The probe for the chromosomal PHO84 locus was a PCR product corresponding to bases −1083 to −1428 from the ATG of the PHO84 ORF, the probe for the PHO8 locus was a PCR product corresponding to bases +78 to +568 from the ATG of the PHO8 ORF. To monitor the PHO84 plasmid locus, secondary cleavage for DNase I indirect end labeling was done with HindIII and the probe for the plasmid locus corresponded to the HindIII-BamHI fragment of pBR322. Probes were labeled with [α-32P]dCTP using the kit PrimeIt II (Stratagene). The four marker bands (lane M) were generated by double digests with HindIII and either ClaI, AgeI, ApaI, or BsBI (from top to bottom in the lanes) for PHO84, and BglII and either EcoRV, NdeI, HindIII, or SacI (from top to bottom in the lanes) for PHO8. Hybridized membranes were exposed to X-ray films (Fuji Super RX). Films were scanned with an Epson Perfection V700 scanner, either in color or gray scale mode. Scans were imported into Adobe Photoshop CS6 and processed by conversion into grayscale format. Sometimes linear level adjustment was applied to the entire image. Figure layout was done with Adobe Illustrator CS6 and Affinity Designer 1.10.5.1342. Sometimes, parts of the image were rearranged or different exposure times of the same blot were combined, as indicated in the figures and figure legend and Supplementary Materials where original blot images are shown (Supplementary Figures S1–S7). For restriction nuclease accessibility assays, chromatin was incubated with HpaI or HhaI and deproteinized DNA was cleaved with restriction enzymes that frame the HpaI or HhaI cleavage site: BglII/EcoRVfor HpaI at PHO8 or HindIII for HhaI at PHO84. We controlled that the restriction enzyme concentration was not limiting by using two enzyme concentrations that differed at least 2-fold (75 and 150 U for HpaI, 60 and 240 U for HhaI). The resulting DNA fragments were resolved in agarose gels and Southern blotted as for DNaseI mapping. Probes for the PHO8 and PHO8 chromosomal locus were the same as for DNase I mapping. To monitor HhaI accessibility at the PHO84 plasmid locus, BamHI and EcoRV were used for secondary cleavage and a PCR product from −557 to −310 from the ATG of the PHO84 ORF on the plasmid locus was used as probe. Quantification of the percentage of cleaved DNA was done by PhosphorImager analysis (Fuji FLA3000, Fujifilm imaging plate, BAS-MP) with Aida Image analyzer software v.4.27 (Raytest). The restriction enzyme accessibility [%] was calculated as the quotient [cut/ (cut + uncut)]. Error bars show either the range of two or the standard deviation of more than two biological replicates.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24054949/s1.

Author Contributions

Conceptualization, S.B. and P.K.; Formal analysis, C.L., A.N., S.M. and P.K.; Funding acquisition, S.B. and P.K.; Investigation, C.L., A.N., S.M., A.S. and G.G.A.; Methodology, C.L., A.N., S.M., A.S. and G.G.A.; Supervision, S.B. and P.K.; Validation, C.L., A.N., S.M., A.S. and G.G.A.; Visualization, C.L., A.N., S.M. and P.K.; Writing—original draft, S.B. and P.K.; Writing—review & editing, C.L., A.N., P.K. and S.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants of the German Research Foundation (DFG) [SFB/TR5-M6, SFB1064-A04 and KO 2945/1-1 to P.K.] and by the Amgen Foundation [Amgen Scholarship to G.G.A.].

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We are grateful to Franziska Ertel, who supervised G.G.A. during her stay as an Amgen Scholar in the group of P.K.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Luger, K.; Mader, A.W.; Richmond, R.K.; Sargent, D.F.; Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 1997, 389, 251–260. [Google Scholar] [CrossRef] [PubMed]
  2. Kornberg, R.D.; Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 1999, 98, 285–294. [Google Scholar] [CrossRef] [PubMed]
  3. Bell, O.; Tiwari, V.K.; Thoma, N.H.; Schubeler, D. Determinants and dynamics of genome accessibility. Nat. Rev. Genet. 2011, 12, 554–564. [Google Scholar] [CrossRef]
  4. Struhl, K. Fundamentally different logic of gene regulation in eukaryotes and prokaryotes. Cell 1999, 98, 1–4. [Google Scholar] [CrossRef]
  5. Lai, W.K.M.; Pugh, B.F. Understanding nucleosome dynamics and their links to gene expression and DNA replication. Nat. Rev. Mol. Cell Biol. 2017, 18, 548–562. [Google Scholar] [CrossRef]
  6. Morse, R.H. Transcription factor access to promoter elements. J. Cell Biochem. 2007, 102, 560–570. [Google Scholar] [CrossRef] [PubMed]
  7. Barnes, T.; Korber, P. The Active Mechanism of Nucleosome Depletion by Poly(dA:dT) Tracts In Vivo. Int. J. Mol. Sci. 2021, 22, 8233. [Google Scholar] [CrossRef]
  8. Rossi, M.J.; Kuntala, P.K.; Lai, W.K.M.; Yamada, N.; Badjatia, N.; Mittal, C.; Kuzu, G.; Bocklund, K.; Farrell, N.P.; Blanda, T.R.; et al. A high-resolution protein architecture of the budding yeast genome. Nature 2021, 592, 309–314. [Google Scholar] [CrossRef] [PubMed]
  9. Yuan, G.C.; Liu, Y.J.; Dion, M.F.; Slack, M.D.; Wu, L.F.; Altschuler, S.J.; Rando, O.J. Genome-scale identification of nucleosome positions in S. cerevisiae. Science 2005, 309, 626–630. [Google Scholar] [CrossRef]
  10. Fascher, K.D.; Schmitz, J.; Horz, W. Structural and functional requirements for the chromatin transition at the PHO5 promoter in Saccharomyces cerevisiae upon PHO5 activation. J. Mol. Biol. 1993, 231, 658–667. [Google Scholar] [CrossRef]
  11. Tirosh, I.; Barkai, N. Two strategies for gene regulation by promoter nucleosomes. Genome Res. 2008, 18, 1084–1091. [Google Scholar] [CrossRef] [PubMed]
  12. Cairns, B.R. The logic of chromatin architecture and remodelling at promoters. Nature 2009, 461, 193–198. [Google Scholar] [CrossRef] [PubMed]
  13. Korber, P.; Barbaric, S. The yeast PHO5 promoter: From single locus to systems biology of a paradigm for gene regulation through chromatin. Nucleic Acids Res. 2014, 42, 10888–10902. [Google Scholar] [CrossRef] [PubMed]
  14. Rando, O.J.; Winston, F. Chromatin and transcription in yeast. Genetics 2012, 190, 351–387. [Google Scholar] [CrossRef]
  15. Wykoff, D.D.; O’Shea, E.K. Phosphate transport and sensing in Saccharomyces cerevisiae. Genetics 2001, 159, 1491–1499. [Google Scholar] [CrossRef]
  16. Auesukaree, C.; Homma, T.; Tochio, H.; Shirakawa, M.; Kaneko, Y.; Harashima, S. Intracellular phosphate serves as a signal for the regulation of the PHO pathway in Saccharomyces cerevisiae. J. Biol. Chem. 2004, 279, 17289–17294. [Google Scholar] [CrossRef]
  17. O’Neill, E.M.; Kaffman, A.; Jolly, E.R.; O’Shea, E.K. Regulation of PHO4 nuclear localization by the PHO80-PHO85 cyclin-CDK complex. Science 1996, 271, 209–212. [Google Scholar] [CrossRef]
  18. Kaffman, A.; Herskowitz, I.; Tjian, R.; O’Shea, E.K. Phosphorylation of the transcription factor PHO4 by a cyclin-CDK complex, PHO80-PHO85. Science 1994, 263, 1153–1156. [Google Scholar] [CrossRef]
  19. Kaffman, A.; Rank, N.M.; O’Shea, E.K. Phosphorylation regulates association of the transcription factor Pho4 with its import receptor Pse1/Kap121. Genes Dev. 1998, 12, 2673–2683. [Google Scholar] [CrossRef]
  20. Komeili, A.; O’Shea, E.K. Roles of phosphorylation sites in regulating activity of the transcription factor Pho4. Science 1999, 284, 977–980. [Google Scholar] [CrossRef]
  21. Barbaric, S.; Munsterkotter, M.; Goding, C.; Horz, W. Cooperative Pho2-Pho4 interactions at the PHO5 promoter are critical for binding of Pho4 to UASp1 and for efficient transactivation by Pho4 at UASp2. Mol. Cell. Biol. 1998, 18, 2629–2639. [Google Scholar] [CrossRef] [PubMed]
  22. Barbarić, S.; Münsterkötter, M.; Svaren, J.; Hörz, W. The homeodomain protein Pho2 and the basic-helix-loop-helix protein Pho4 bind DNA cooperatively at the yeast PHO5 promoter. Nucleic Acids Res. 1996, 24, 4479–4486. [Google Scholar] [CrossRef] [PubMed]
  23. Fascher, K.D.; Schmitz, J.; Horz, W. Role of trans-activating proteins in the generation of active chromatin at the PHO5 promoter in S. cerevisiae. EMBO J. 1990, 9, 2523–2528. [Google Scholar] [CrossRef]
  24. McAndrew, P.C.; Svaren, J.; Martin, S.R.; Horz, W.; Goding, C.R. Requirements for chromatin modulation and transcription activation by the Pho4 acidic activation domain. Mol. Cell. Biol. 1998, 18, 5818–5827. [Google Scholar] [CrossRef] [PubMed]
  25. Lemire, J.M.; Willcocks, T.; Halvorson, H.O.; Bostian, K.A. Regulation of repressible acid phosphatase gene transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 1985, 5, 2131–2141. [Google Scholar]
  26. Svaren, J.; Schmitz, J.; Horz, W. The transactivation domain of Pho4 is required for nucleosome disruption at the PHO5 promoter. EMBO J. 1994, 13, 4856–4862. [Google Scholar] [CrossRef]
  27. Neely, K.E.; Hassan, A.H.; Brown, C.E.; Howe, L.; Workman, J.L. Transcription activator interactions with multiple SWI/SNF subunits. Mol. Cell. Biol. 2002, 22, 1615–1625. [Google Scholar] [CrossRef]
  28. Barbaric, S.; Reinke, H.; Hörz, W. Multiple Mechanistically Distinct Functions of SAGA at the PHO5 Promoter. Mol. Cell Biol. 2003, 23, 3468–3476. [Google Scholar] [CrossRef]
  29. Adkins, M.W.; Williams, S.K.; Linger, J.; Tyler, J.K. Chromatin disassembly from the PHO5 promoter is essential for the recruitment of the general transcription machinery and coactivators. Mol. Cell. Biol. 2007, 27, 6372–6382. [Google Scholar] [CrossRef]
  30. Reinke, H.; Gregory, P.D.; Horz, W. A transient histone hyperacetylation signal marks nucleosomes for remodeling at the PHO8 promoter in vivo. Mol. Cell 2001, 7, 529–538. [Google Scholar] [CrossRef]
  31. Reinke, H.; Horz, W. Histones are first hyperacetylated and then lose contact with the activated PHO5 promoter. Mol. Cell 2003, 11, 1599–1607. [Google Scholar] [CrossRef] [PubMed]
  32. Dhasarathy, A.; Kladde, M.P. Promoter occupancy is a major determinant of chromatin remodeling enzyme requirements. Mol. Cell. Biol. 2005, 25, 2698–2707. [Google Scholar] [CrossRef] [PubMed]
  33. Narlikar, G.J.; Sundaramoorthy, R.; Owen-Hughes, T. Mechanisms and Functions of ATP-Dependent Chromatin-Remodeling Enzymes. Cell 2013, 154, 490–503. [Google Scholar] [CrossRef]
  34. Bartholomew, B. Regulating the chromatin landscape: Structural and mechanistic perspectives. Annu. Rev. Biochem. 2014, 83, 671–696. [Google Scholar] [CrossRef]
  35. Clapier, C.R.; Cairns, B.R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 2009, 78, 273–304. [Google Scholar] [CrossRef] [PubMed]
  36. Clapier, C.R.; Iwasa, J.; Cairns, B.R.; Peterson, C.L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 2017, 18, 407–422. [Google Scholar] [CrossRef]
  37. Zhou, C.Y.; Johnson, S.L.; Gamarra, N.I.; Narlikar, G.J. Mechanisms of ATP-Dependent Chromatin Remodeling Motors. Annu. Rev. Biophys. 2016, 45, 153–181. [Google Scholar] [CrossRef]
  38. Cairns, B.R.; Lorch, Y.; Li, Y.; Zhang, M.; Lacomis, L.; Erdjument-Bromage, H.; Tempst, P.; Du, J.; Laurent, B.; Kornberg, R.D. RSC, an essential, abundant chromatin-remodeling complex. Cell 1996, 87, 1249–1260. [Google Scholar] [CrossRef]
  39. Tsukiyama, T.; Palmer, J.; Landel, C.C.; Shiloach, J.; Wu, C. Characterization of the imitation switch subfamily of ATP-dependent chromatin-remodeling factors in Saccharomyces cerevisiae. Genes Dev. 1999, 13, 686–697. [Google Scholar] [CrossRef]
  40. Mizuguchi, G.; Shen, X.; Landry, J.; Wu, W.H.; Sen, S.; Wu, C. ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 2004, 303, 343–348. [Google Scholar] [CrossRef]
  41. Zhang, H.; Roberts, D.N.; Cairns, B.R. Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 2005, 123, 219–231. [Google Scholar] [CrossRef]
  42. Wippo, C.J.; Krstulovic, B.S.; Ertel, F.; Musladin, S.; Blaschke, D.; Sturzl, S.; Yuan, G.C.; Horz, W.; Korber, P.; Barbaric, S. Differential cofactor requirements for histone eviction from two nucleosomes at the yeast PHO84 promoter are determined by intrinsic nucleosome stability. Mol. Cell. Biol. 2009, 29, 2960–2981. [Google Scholar] [CrossRef]
  43. Gregory, P.D.; Schmid, A.; Zavari, M.; Munsterkotter, M.; Horz, W. Chromatin remodelling at the PHO8 promoter requires SWI-SNF and SAGA at a step subsequent to activator binding. EMBO J. 1999, 18, 6407–6414. [Google Scholar] [CrossRef] [PubMed]
  44. Brown, C.R.; Mao, C.; Falkovskaia, E.; Law, J.K.; Boeger, H. In vivo role for the chromatin-remodeling enzyme SWI/SNF in the removal of promoter nucleosomes by disassembly rather than sliding. J. Biol. Chem. 2011, 286, 40556–40565. [Google Scholar] [CrossRef]
  45. Barbaric, S.; Luckenbach, T.; Schmid, A.; Blaschke, D.; Horz, W.; Korber, P. Redundancy of chromatin remodeling pathways for the induction of the yeast PHO5 promoter in vivo. J. Biol. Chem. 2007, 282, 27610–27621. [Google Scholar] [CrossRef]
  46. Musladin, S.; Krietenstein, N.; Korber, P.; Barbaric, S. The RSC chromatin remodeling complex has a crucial role in the complete remodeler set for yeast PHO5 promoter opening. Nucleic Acids Res. 2014, 42, 4270–4282. [Google Scholar] [CrossRef] [PubMed]
  47. Rawal, Y.; Qiu, H.; Hinnebusch, A.G. Distinct functions of three chromatin remodelers in activator binding and preinitiation complex assembly. PLoS Genet. 2022, 18, e1010277. [Google Scholar] [CrossRef]
  48. Rawal, Y.; Chereji, R.V.; Qiu, H.; Ananthakrishnan, S.; Govind, C.K.; Clark, D.J.; Hinnebusch, A.G. SWI/SNF and RSC cooperate to reposition and evict promoter nucleosomes at highly expressed genes in yeast. Genes Dev. 2018, 32, 695–710. [Google Scholar] [CrossRef] [PubMed]
  49. Flaus, A.; Martin, D.M.; Barton, G.J.; Owen-Hughes, T. Identification of multiple distinct Snf2 subfamilies with conserved structural motifs. Nucleic Acids Res. 2006, 34, 2887–2905. [Google Scholar] [CrossRef]
  50. Ehrensberger, A.H.; Kornberg, R.D. Isolation of an activator-dependent, promoter-specific chromatin remodeling factor. Proc. Natl. Acad. Sci. USA 2011, 108, 10115–10120. [Google Scholar] [CrossRef]
  51. Steger, D.J.; Haswell, E.S.; Miller, A.L.; Wente, S.R.; O’Shea, E.K. Regulation of chromatin remodeling by inositol polyphosphates. Science 2003, 299, 114–116. [Google Scholar] [CrossRef] [PubMed]
  52. Huang, S.; O’Shea, E.K. A systematic high-throughput screen of a yeast deletion collection for mutants defective in PHO5 regulation. Genetics 2005, 169, 1859–1871. [Google Scholar] [CrossRef] [PubMed]
  53. Partensky, P.D.; Narlikar, G.J. Chromatin remodelers act globally, sequence positions nucleosomes locally. J. Mol. Biol. 2009, 391, 12–25. [Google Scholar] [CrossRef] [PubMed]
  54. Clapier, C.R. Sophisticated Conversations between Chromatin and Chromatin Remodelers, and Dissonances in Cancer. Int. J. Mol. Sci. 2021, 22, 5578. [Google Scholar] [CrossRef]
  55. Rippe, K.; Schrader, A.; Riede, P.; Strohner, R.; Lehmann, E.; Langst, G. DNA sequence- and conformation-directed positioning of nucleosomes by chromatin-remodeling complexes. Proc. Natl. Acad. Sci. USA 2007, 104, 15635–15640. [Google Scholar] [CrossRef]
  56. Krietenstein, N.; Wal, M.; Watanabe, S.; Park, B.; Peterson, C.L.; Pugh, B.F.; Korber, P. Genomic Nucleosome Organization Reconstituted with Pure Proteins. Cell 2016, 167, 709–721.e712. [Google Scholar] [CrossRef]
  57. Oberbeckmann, E.; Niebauer, V.; Watanabe, S.; Farnung, L.; Moldt, M.; Schmid, A.; Cramer, P.; Peterson, C.L.; Eustermann, S.; Hopfner, K.P.; et al. Ruler elements in chromatin remodelers set nucleosome array spacing and phasing. Nat. Commun. 2021, 12, 3232. [Google Scholar] [CrossRef]
  58. Lorch, Y.; Maier-Davis, B.; Kornberg, R.D. Role of DNA sequence in chromatin remodeling and the formation of nucleosome-free regions. Genes Dev. 2014, 28, 2492–2497. [Google Scholar] [CrossRef]
  59. Kaneko, Y.; Hayashi, N.; Toh-e, A.; Banno, I.; Oshima, Y. Structural characteristics of the PHO8 gene encoding repressible alkaline phosphatase in Saccharomyces cerevisiae. Gene 1987, 58, 137–148. [Google Scholar]
  60. Barbaric, S.; Fascher, K.D.; Horz, W. Activation of the weakly regulated PHO8 promoter in S. cerevisiae: Chromatin transition and binding sites for the positive regulatory protein PHO4. Nucleic Acids Res. 1992, 20, 1031–1038. [Google Scholar] [CrossRef]
  61. Ogawa, N.; Hayashi, N.; Saito, H.; Noguchi, K.; Yamashita, Y.; Oshima, Y. Regulatory Circuits for Phosphatase Genes in Saccharomyces cerevisiae: Specific cis-Acting Sites in PHO Promoters for Binding the Positive Regulator Pho4p. In Phosphate in Microorganisms; Torriani-Gorini, A., Yagil, E., Silver, S., Eds.; ASM: Washington, DC, USA, 1994; pp. 56–62. [Google Scholar]
  62. Hayashi, N.; Oshima, Y. Specific cis-acting sequence for PHO8 expression interacts with PHO4 protein, a positive regulatory factor, in Saccharomyces cerevisiae. Mol. Cell. Biol. 1991, 11, 785–794. [Google Scholar] [PubMed]
  63. Zhou, X.; O’Shea, E.K. Integrated approaches reveal determinants of genome-wide binding and function of the transcription factor Pho4. Mol. Cell 2011, 42, 826–836. [Google Scholar] [CrossRef]
  64. Ogawa, N.; Saitoh, H.; Miura, K.; Magbanua, J.P.V.; Bunya, M.; Harashima, S.; Oshima, Y. Structure and distribution of specific cis-elements for transcriptional regulation of PHO84 in Saccharomyces cerevisiae. Mol. Gen. Genet. 1995, 249, 406–416. [Google Scholar] [CrossRef] [PubMed]
  65. Münsterkötter, M.; Barbaric, S.; Hörz, W. Transcriptional regulation of the yeast PHO8 promoter in comparison to the coregulated PHO5 promoter. J. Biol. Chem. 2000, 275, 22678–22685. [Google Scholar] [CrossRef] [PubMed]
  66. Ertel, F.; Dirac-Svejstrup, A.B.; Hertel, C.B.; Blaschke, D.; Svejstrup, J.Q.; Korber, P. In vitro reconstitution of PHO5 promoter chromatin remodeling points to a role for activator-nucleosome competition in vivo. Mol. Cell. Biol. 2010, 30, 4060–4076. [Google Scholar] [CrossRef]
  67. Schmid, A.; Fascher, K.D.; Hörz, W. Nucleosome disruption at the yeast PHO5 promoter upon PHO5 induction occurs in the absence of DNA replication. Cell 1992, 71, 853–864. [Google Scholar] [CrossRef]
  68. Lam, F.H.; Steger, D.J.; O’Shea, E.K. Chromatin decouples promoter threshold from dynamic range. Nature 2008, 453, 246–250. [Google Scholar] [CrossRef]
  69. Wippo, C.J.; Israel, L.; Watanabe, S.; Hochheimer, A.; Peterson, C.L.; Korber, P. The RSC chromatin remodelling enzyme has a unique role in directing the accurate positioning of nucleosomes. EMBO J. 2011, 30, 1277–1288. [Google Scholar] [CrossRef]
  70. Bun-Ya, M.; Nishimura, M.; Harashima, S.; Oshima, Y. The PHO84 gene of Saccharomyces cerevisiae encodes an inorganic phosphate transporter. Mol. Cell. Biol. 1991, 11, 3229–3238. [Google Scholar]
  71. Ghaemmaghami, S.; Huh, W.K.; Bower, K.; Howson, R.W.; Belle, A.; Dephoure, N.; O’Shea, E.K.; Weissman, J.S. Global analysis of protein expression in yeast. Nature 2003, 425, 737–741. [Google Scholar] [CrossRef]
  72. Barbaric, S.; Walker, J.; Schmid, A.; Svejstrup, J.Q.; Horz, W. Increasing the rate of chromatin remodeling and gene activation--a novel role for the histone acetyltransferase Gcn5. EMBO J. 2001, 20, 4944–4951. [Google Scholar] [CrossRef] [PubMed]
  73. Korber, P.; Barbaric, S.; Luckenbach, T.; Schmid, A.; Schermer, U.J.; Blaschke, D.; Horz, W. The histone chaperone Asf1 increases the rate of histone eviction at the yeast PHO5 and PHO8 promoters. J. Biol. Chem. 2006, 281, 5539–5545. [Google Scholar] [CrossRef] [PubMed]
  74. Venters, B.J.; Pugh, B.F. A canonical promoter organization of the transcription machinery and its regulators in the Saccharomyces genome. Genome Res. 2009, 19, 360–371. [Google Scholar] [CrossRef]
  75. Skene, P.J.; Henikoff, S. An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. eLife 2017, 6, e21856. [Google Scholar] [CrossRef] [PubMed]
  76. Ramachandran, S.; Zentner, G.E.; Henikoff, S. Asymmetric nucleosomes flank promoters in the budding yeast genome. Genome Res. 2015, 25, 381–390. [Google Scholar] [CrossRef]
  77. Kubik, S.; O’Duibhir, E.; de Jonge, W.J.; Mattarocci, S.; Albert, B.; Falcone, J.L.; Bruzzone, M.J.; Holstege, F.C.P.; Shore, D. Sequence-Directed Action of RSC Remodeler and General Regulatory Factors Modulates +1 Nucleosome Position to Facilitate Transcription. Mol. Cell 2018, 71, 89–102. [Google Scholar] [CrossRef]
  78. Dechassa, M.L.; Sabri, A.; Pondugula, S.; Kassabov, S.R.; Chatterjee, N.; Kladde, M.P.; Bartholomew, B. SWI/SNF has intrinsic nucleosome disassembly activity that is dependent on adjacent nucleosomes. Mol. Cell 2010, 38, 590–602. [Google Scholar] [CrossRef]
  79. Richmond, E.; Peterson, C.L. Functional analysis of the DNA-stimulated ATPase domain of yeast SWI2/SNF2. Nucleic Acids Res. 1996, 24, 3685–3692. [Google Scholar] [CrossRef]
  80. Almer, A.; Rudolph, H.; Hinnen, A.; Horz, W. Removal of positioned nucleosomes from the yeast PHO5 promoter upon PHO5 induction releases additional upstream activating DNA elements. EMBO J. 1986, 5, 2689–2696. [Google Scholar] [CrossRef]
  81. Hertel, C.B.; Langst, G.; Horz, W.; Korber, P. Nucleosome stability at the yeast PHO5 and PHO8 promoters correlates with differential cofactor requirements for chromatin opening. Mol. Cell. Biol. 2005, 25, 10755–10767. [Google Scholar] [CrossRef]
  82. Gregory, P.D.; Horz, W. Mapping chromatin structure in yeast. Methods Enzymol. 1999, 304, 365–376. [Google Scholar] [PubMed]
  83. Gregory, P.D.; Barbaric, S.; Horz, W. Analyzing chromatin structure and transcription factor binding in yeast. Methods 1998, 15, 295–302. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Introduction of an additional intranucleosomal high-affinity Pho4 binding site (UASp) allows nucleosome remodeling at the PHO8 promoter in the absence of SWI/SNF activity. (A) Schematics, approximately to scale, of the nucleosome organization at the PHO8 promoter in the repressed and induced state (broken arrows show direction and start of transcription in the repressed (blunt arrow) or induced (pointed arrow) state, respectively). Large open circles denote positioned nucleosomes, numbered relatively to transcription start. Horizontal bars represent hypersensitive sites (HSS), dashed circles ambiguous nucleosome organization, small circles high (closed small circles)- or low (open small circles)-affinity UASp and “T” the TATA box position. The position of the HpaI site used for restriction enzyme accessibility assays is indicated as well the position (colored arrow) where the new high-affinity UASp element was introduced in the −3 nucleosome on a plasmid according to the indicated sequence changes. (B) HpaI accessibility values for the indicated genotypes, all after overnight incubation in phosphate-free medium (−Pi). “high affinity UASp” stands for the newly introduced intranucleosomal UASp in the plasmid locus shown in panel A. “o/x PHO4” stands for PHO4 overexpression. Average values and error bars (standard deviation) derived from two or more biological replicates are shown. (C) DNaseI indirect end labeling for the PHO8 plasmid locus and indicated genotypes, all after overnight incubation in phosphate-free medium (−Pi). Ramps on top of the lanes denote increasing DNaseI concentration. Vertical bars in-between lanes indicate hypersensitive regions. Marker fragments (lane M) were generated by double digests with EcoRV (−874 relative to PHO8 ATG) or NdeI (−388) or HindIII (−160) or SacI (+61) each with BglII (+571). The approximate position of the HpaI site is indicated.
Figure 1. Introduction of an additional intranucleosomal high-affinity Pho4 binding site (UASp) allows nucleosome remodeling at the PHO8 promoter in the absence of SWI/SNF activity. (A) Schematics, approximately to scale, of the nucleosome organization at the PHO8 promoter in the repressed and induced state (broken arrows show direction and start of transcription in the repressed (blunt arrow) or induced (pointed arrow) state, respectively). Large open circles denote positioned nucleosomes, numbered relatively to transcription start. Horizontal bars represent hypersensitive sites (HSS), dashed circles ambiguous nucleosome organization, small circles high (closed small circles)- or low (open small circles)-affinity UASp and “T” the TATA box position. The position of the HpaI site used for restriction enzyme accessibility assays is indicated as well the position (colored arrow) where the new high-affinity UASp element was introduced in the −3 nucleosome on a plasmid according to the indicated sequence changes. (B) HpaI accessibility values for the indicated genotypes, all after overnight incubation in phosphate-free medium (−Pi). “high affinity UASp” stands for the newly introduced intranucleosomal UASp in the plasmid locus shown in panel A. “o/x PHO4” stands for PHO4 overexpression. Average values and error bars (standard deviation) derived from two or more biological replicates are shown. (C) DNaseI indirect end labeling for the PHO8 plasmid locus and indicated genotypes, all after overnight incubation in phosphate-free medium (−Pi). Ramps on top of the lanes denote increasing DNaseI concentration. Vertical bars in-between lanes indicate hypersensitive regions. Marker fragments (lane M) were generated by double digests with EcoRV (−874 relative to PHO8 ATG) or NdeI (−388) or HindIII (−160) or SacI (+61) each with BglII (+571). The approximate position of the HpaI site is indicated.
Ijms 24 04949 g001
Figure 2. Neither introduction of an intranucleosomal scrambled non-UASp site nor of an additional internucleosomal high-affinity UASp site allowed PHO8 promoter opening without SWI/SNF activity. (A) Schematics analogous to Figure 1A showing the sequence changes for introduction of the scrambled non-UASp site in the −3 nucleosome (top) and the conversion of the low affinity UASp1 site into a high-affinity site (bottom) in the plasmid locus. (B) DNaseI indirect end labeling for the PHO8 plasmid locus analogous to Figure 1C for the indicated genotypes and growth condition (−Pi). Corresponding HpaI accessibility values analogous to Figure 1B are given below the blots. The condition −Pi snf2∆ intranucl. high aff. UASp is a biological replicate of the same condition in Figure 1C.
Figure 2. Neither introduction of an intranucleosomal scrambled non-UASp site nor of an additional internucleosomal high-affinity UASp site allowed PHO8 promoter opening without SWI/SNF activity. (A) Schematics analogous to Figure 1A showing the sequence changes for introduction of the scrambled non-UASp site in the −3 nucleosome (top) and the conversion of the low affinity UASp1 site into a high-affinity site (bottom) in the plasmid locus. (B) DNaseI indirect end labeling for the PHO8 plasmid locus analogous to Figure 1C for the indicated genotypes and growth condition (−Pi). Corresponding HpaI accessibility values analogous to Figure 1B are given below the blots. The condition −Pi snf2∆ intranucl. high aff. UASp is a biological replicate of the same condition in Figure 1C.
Ijms 24 04949 g002
Figure 3. Overexpression of PHO4 allowed opening of the PHO8 promoter in the absence of SWI/SNF activity. DNaseI indirect end labeling analysis analogous to Figure 1C for the indicated genotypes and either logarithmic growth in phosphate-containing (+Pi) or overnight incubation in phosphate-free (−Pi) medium. Corresponding HpaI accessibility values analogous to Figure 1B are indicated below the blots. Thin dashed vertical lines indicate that gel lanes were combined from films with different exposure times of the same blot in Adobe Photoshop CS6.
Figure 3. Overexpression of PHO4 allowed opening of the PHO8 promoter in the absence of SWI/SNF activity. DNaseI indirect end labeling analysis analogous to Figure 1C for the indicated genotypes and either logarithmic growth in phosphate-containing (+Pi) or overnight incubation in phosphate-free (−Pi) medium. Corresponding HpaI accessibility values analogous to Figure 1B are indicated below the blots. Thin dashed vertical lines indicate that gel lanes were combined from films with different exposure times of the same blot in Adobe Photoshop CS6.
Ijms 24 04949 g003
Figure 4. PHO8 promoter opening in the absence of SWI/SNF activity by PHO4 overexpression depends on the Pho4 activation domain. DNaseI indirect end labeling and corresponding HpaI accessibility values analogous to Figure 1B,C for the indicated genotypes and growth conditions. Short dashed vertical bar denotes not fully hypersensitive region. Thin dashed vertical lines, as in Figure 3. The condition –Pi snf2K798A + o/x PHO4 full length is a technical replicate of the condition −Pi snf2K798A + o/x PHO4 shown in Figure 3.
Figure 4. PHO8 promoter opening in the absence of SWI/SNF activity by PHO4 overexpression depends on the Pho4 activation domain. DNaseI indirect end labeling and corresponding HpaI accessibility values analogous to Figure 1B,C for the indicated genotypes and growth conditions. Short dashed vertical bar denotes not fully hypersensitive region. Thin dashed vertical lines, as in Figure 3. The condition –Pi snf2K798A + o/x PHO4 full length is a technical replicate of the condition −Pi snf2K798A + o/x PHO4 shown in Figure 3.
Ijms 24 04949 g004
Figure 5. Enhanced induction by pho80∆ deletion allele only weakly increases PHO8 promoter opening in the absence of SWI/SNF activity. DNaseI indirect end labeling and corresponding HpaI accessibility values analogous to Figure 1B,C for the indicated genotypes and growth conditions. Thin dashed vertical line, as in Figure 3. Thick dashed vertical line separates samples electrophoresed in different gels.
Figure 5. Enhanced induction by pho80∆ deletion allele only weakly increases PHO8 promoter opening in the absence of SWI/SNF activity. DNaseI indirect end labeling and corresponding HpaI accessibility values analogous to Figure 1B,C for the indicated genotypes and growth conditions. Thin dashed vertical line, as in Figure 3. Thick dashed vertical line separates samples electrophoresed in different gels.
Ijms 24 04949 g005
Figure 6. RSC does not help but rather hinders PHO8 promoter nucleosome remodeling with or without SWI/SNF. HpaI accessibility values analogous to Figure 1B for the indicated genotypes and growth conditions.
Figure 6. RSC does not help but rather hinders PHO8 promoter nucleosome remodeling with or without SWI/SNF. HpaI accessibility values analogous to Figure 1B for the indicated genotypes and growth conditions.
Ijms 24 04949 g006
Figure 7. PHO4 overexpression does not allow remodeling of the upstream nucleosome at the PHO84 promoter in the absence of SWI/SNF activity. (A) Schematics, approximately to scale, of the nucleosome organization at the PHO84 promoter analogous to Figure 1A. “up” and “down” denotes the nucleosomes “upstream” and “downstream” of the constitutive HSS bearing the UASpC/D elements, respectively. The position of the HhaI site used for restriction enzyme accessibility assays is indicated as well the position (colored arrow) where the new high-affinity UASp element was introduced in the −3 nucleosome on a plasmid according to the indicated sequence changes. (B) DNaseI indirect end labeling, as in Figure 2B, but for the chromosomal PHO84 locus and genotypes, all after overnight incubation in phosphate-free medium (−Pi). Vertical bars next to lanes indicate hypersensitive regions, the oval the positioned upstream nucleosome at the PHO84 promoter. Marker fragments (lane M) were generated by double digests with HindIII (−1451) and either ClaI (+159) or AgeI (−174) or ApaI (−533) or BsrBI (−719). The approximate position of the HhaI cleavage site is indicated. Thick dashed vertical line, as in Figure 5. Thin dashed line separates lanes of the same gel but horizontally moved together after cutting away intervening lanes in Affinity Designer 1.10.5.1342.
Figure 7. PHO4 overexpression does not allow remodeling of the upstream nucleosome at the PHO84 promoter in the absence of SWI/SNF activity. (A) Schematics, approximately to scale, of the nucleosome organization at the PHO84 promoter analogous to Figure 1A. “up” and “down” denotes the nucleosomes “upstream” and “downstream” of the constitutive HSS bearing the UASpC/D elements, respectively. The position of the HhaI site used for restriction enzyme accessibility assays is indicated as well the position (colored arrow) where the new high-affinity UASp element was introduced in the −3 nucleosome on a plasmid according to the indicated sequence changes. (B) DNaseI indirect end labeling, as in Figure 2B, but for the chromosomal PHO84 locus and genotypes, all after overnight incubation in phosphate-free medium (−Pi). Vertical bars next to lanes indicate hypersensitive regions, the oval the positioned upstream nucleosome at the PHO84 promoter. Marker fragments (lane M) were generated by double digests with HindIII (−1451) and either ClaI (+159) or AgeI (−174) or ApaI (−533) or BsrBI (−719). The approximate position of the HhaI cleavage site is indicated. Thick dashed vertical line, as in Figure 5. Thin dashed line separates lanes of the same gel but horizontally moved together after cutting away intervening lanes in Affinity Designer 1.10.5.1342.
Ijms 24 04949 g007
Figure 8. The combination of PHO4 overexpression with introduction of an additional intranucleosomal high-affinity Pho4 binding site (high-affinity UASpB) allows partial remodeling of the upstream nucleosome at the PHO84 promoter in the absence of SWI/SNF activity. DNaseI indirect end labeling for the plasmid PHO84 locus in snf2∆ cells (CY407) as in Figure 7B after overnight incubation in phosphate-free medium (−Pi). “+ high aff. UASpB” corresponds to plasmid pCB84a-Bhi, where UASpB is mutated to a high-affinity UASp element according to Figure 7A. No marker for the plasmid locus was included in the gel on the right hand side, but the position of the HhaI site was estimated according to similar published gels (Figure 3B,C in ref. [42]). Even without exact calibration of band gel positions it is clear that the protected region corresponding to the upstream nucleosome (see left hand side of figure) is not detected in the gel on the right hand side.
Figure 8. The combination of PHO4 overexpression with introduction of an additional intranucleosomal high-affinity Pho4 binding site (high-affinity UASpB) allows partial remodeling of the upstream nucleosome at the PHO84 promoter in the absence of SWI/SNF activity. DNaseI indirect end labeling for the plasmid PHO84 locus in snf2∆ cells (CY407) as in Figure 7B after overnight incubation in phosphate-free medium (−Pi). “+ high aff. UASpB” corresponds to plasmid pCB84a-Bhi, where UASpB is mutated to a high-affinity UASp element according to Figure 7A. No marker for the plasmid locus was included in the gel on the right hand side, but the position of the HhaI site was estimated according to similar published gels (Figure 3B,C in ref. [42]). Even without exact calibration of band gel positions it is clear that the protected region corresponding to the upstream nucleosome (see left hand side of figure) is not detected in the gel on the right hand side.
Ijms 24 04949 g008
Table 1. Summary of main results.
Table 1. Summary of main results.
Relevant Cis Promoter FeaturesRelevant Trans FactorsNucleosome Remodeling
upon–Pi Induction?
PHO8 PromoterPHO84 Promoter Upstream Nucl.
wtwtyesyes
wtno SWI/SNFnono
intranucleosomal high-affinity UASpno SWI/SNFyesno
wtno SWI/SNF
PHO4 overexpression
yesno
wtno SWI/SNF
PHO4 overexpression
depleted RSC
yesn.d.
wtno SWI/SNF
PHO4-DBD overexpression
non.d.
high-affinity UASp1no SWI/SNFnon.a.
wtno SWI/SNF, no Pho80non.d.
wtno SWI/SNF, no Pho80
PHO4 overexpression
yesn.d.
intranucleosomal high-affinity UASpno SWI/SNF
PHO4 overexpression
yesyes
Abbreviations: “nucl.”: nucleosome, “PHO4-DBD”: DNA binding domain of Pho4, “n.d.”: not determined; “n.a.”: not applicable.
Table 2. Strains used in this study.
Table 2. Strains used in this study.
Strain NameGenotypeShort HandSource
CY337MATa ura3-52 lys2-801 ade2-101 leu2-Δ1 his3-Δ200CY wild type[79]
CY338CY337 pho4::URA3pho4∆[42]
CY397MATα swi2∆::HIS3 swi2(K798A)-HA-6HIS::URA3 HO-lacZsnf2K798A[79]
CY397 pho8::KANCY397 pho8::KanMX4snf2K798A pho8∆This study
CY397 uraCY397 ura3 (after selection on 5-FOA plates) This study
CY407CY337 snf2::HIS3snf2[79]
CY407 pho8::KANCY407 pho8::KanMX4snf2∆ pho8∆This study
CY337 sth1tdCY337 sth1Δ::pCUP1-sth1td::URA3sth1td[46]
CY407 sth1tdCY407 sth1Δ::pCUP1-sth1td::URA3snf2∆sth1td[46]
CY39780CY397 pho80::LEU2snf2K798A pho80∆Hörz group, unpublished
CY408CY407 pho4::URA3 snf2∆ pho4∆[30]
CY408 uraCY408 ura3 (after selection on 5-FOA plates) This study
BY4741
(=EUROSCARF Y00000)
MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0BY wild typeEUROSCARF
Y04315BY4741 pho8::KanMX4pho8∆EUROSCARF
Table 3. Plasmids and primers used in this study.
Table 3. Plasmids and primers used in this study.
PlasmidSource/Mutagenesis PrimersMarker
pP4-70L
(PHO4 o/x)
[45]LEU2
pP4-70U
(PHO4 o/x)
[26]URA3
pP4-72
(PHO4-DBD o/x)
[26]URA3
pP4-72V
(PHO4-DBD-VP16 o/x)
[26]URA3
pP8apain
intraUASp_high
this study 5′GTAATCCTAATTTGAGCTCTACACAATACCACACGTGGGTTAACAGCTACTGCA3′
5′TGCAGTAGCTGTTAACCCACGTGTGGTATTGTGTAGAGCTCAAATTAGGATTAC3′
LEU2
pP8apain
UASp1_high
this study 5′GATAAGAAGGAAAAATTATATTCCACGTGCGGGTAAAGGCAAGGAAGAATC3′
GATTCTTCCTTGCCTTTACCCGCACGTGGAATATAATTTTTCCTTCTTATC
LEU2
pP8apain
intraUASp_ scrambled
this study
5′CTCTACACAATACCACTCGAGGGTTAACAGCTACTGC3′
5′GCAGTAGCTGTTAACCCTCGAGTGGTATTGTGTAGAG3′
LEU2
pCB84a-Bhithis study
5′CAGTATTACGCACGTGGGTGCTGTTATAGGC3′
5′GCCTATAACAGCACCCACGTGCGTAATACTG3′
LEU2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lieleg, C.; Novacic, A.; Musladin, S.; Schmid, A.; Akpinar, G.G.; Barbaric, S.; Korber, P. Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler. Int. J. Mol. Sci. 2023, 24, 4949. https://doi.org/10.3390/ijms24054949

AMA Style

Lieleg C, Novacic A, Musladin S, Schmid A, Akpinar GG, Barbaric S, Korber P. Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler. International Journal of Molecular Sciences. 2023; 24(5):4949. https://doi.org/10.3390/ijms24054949

Chicago/Turabian Style

Lieleg, Corinna, Ana Novacic, Sanja Musladin, Andrea Schmid, Gözde Güçlüler Akpinar, Slobodan Barbaric, and Philipp Korber. 2023. "Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler" International Journal of Molecular Sciences 24, no. 5: 4949. https://doi.org/10.3390/ijms24054949

APA Style

Lieleg, C., Novacic, A., Musladin, S., Schmid, A., Akpinar, G. G., Barbaric, S., & Korber, P. (2023). Nucleosome Remodeling at the Yeast PHO8 and PHO84 Promoters without the Putatively Essential SWI/SNF Remodeler. International Journal of Molecular Sciences, 24(5), 4949. https://doi.org/10.3390/ijms24054949

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop