Protective Effects of Human Pericyte-like Adipose-Derived Mesenchymal Stem Cells on Human Retinal Endothelial Cells in an In Vitro Model of Diabetic Retinopathy: Evidence for Autologous Cell Therapy
Abstract
1. Introduction
2. Results
2.1. Effect of ASCs and P-ASCs on Transendothelial Electrical Resistance Impaired by HG
2.2. ASC and P-ASC Effects on Junction Protein Expression
2.3. ASC and P-ASC Modulation of mRNA Levels of Pro-Inflammatory Cytokines and VEGF in HRECs in NG and HG Conditions
2.4. ASC and P-ASC Modulation of TGF-β1-mRNA Levels in HRECs in NG and HG Conditions
2.5. ASC and P-ASC Modulation of the ERK1/2/cPLA2/COX-2 Axis in HRECs in NG and HG Conditions
2.6. ASC and P-ASC Modulation of PDGF-B/PDGFR-β Axis Crosstalk in HRECs in NG and HG Conditions
3. Discussion
4. Materials and Methods
4.1. Cell Cultures
4.1.1. Human Retinal Endothelial Cells (HRECs)
4.1.2. Human Adipose Stem Cells (ASCs)
4.1.3. Pericyte-like Differentiation of ASCs (P-ASCs)
4.1.4. HRECs/ASC and HRECs/P-ASC Co-Cultures
4.2. Immunofluorescence Assays
4.3. Transendothelial Electrical Resistance (TEER) Measurement
4.4. Extraction of Total mRNA and Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR)
4.5. Immunoblot Analyses
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Antonetti, D.A.; Klein, R.; Gardner, T.W. Diabetic retinopathy. N. Engl. J. Med. 2012, 366, 1227–1239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rossino, M.G.; Dal Monte, M.; Casini, G. Relationships Between Neurodegeneration and Vascular Damage in Diabetic Retinopathy. Front. Neurosci. 2019, 13, 1172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duh, E.J.; Sun, J.K.; Stitt, A.W. Diabetic retinopathy: Current understanding, mechanisms, and treatment strategies. JCI Insight 2017, 2, e93751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Lo, A.C.Y. Diabetic Retinopathy: Pathophysiology and Treatments. Int. J. Mol. Sci. 2018, 19, 1816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, E.S.; Sorenson, C.M.; Sheibani, N. Diabetes and retinal vascular dysfunction. J. Ophthalmic Vis. Res. 2014, 9, 362–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beltramo, E.; Porta, M. Pericyte loss in diabetic retinopathy: Mechanisms and consequences. Curr. Med. Chem. 2013, 20, 3218–3225. [Google Scholar] [CrossRef] [Scilit]
- Caporarello, N.; D’Angeli, F.; Cambria, M.T.; Candido, S.; Giallongo, C.; Salmeri, M.; Lombardo, C.; Longo, A.; Giurdanella, G.; Anfuso, C.D.; et al. Pericytes in Microvessels: From “Mural” Function to Brain and Retina Regeneration. Int. J. Mol. Sci. 2019, 20, 6351. [Google Scholar] [CrossRef] [Scilit]
- Giurdanella, G.; Anfuso, C.D.; Olivieri, M.; Lupo, G.; Caporarello, N.; Eandi, C.M.; Drago, F.; Bucolo, C.; Salomone, S. Aflibercept, bevacizumab and ranibizumab prevent glucose-induced damage in human retinal pericytes in vitro, through a PLA2/COX-2/VEGF-A pathway. Biochem. Pharmacol. 2015, 96, 278–287. [Google Scholar] [CrossRef] [Scilit]
- Rubsam, A.; Parikh, S.; Fort, P.E. Role of Inflammation in Diabetic Retinopathy. Int. J. Mol. Sci. 2018, 19, 942. [Google Scholar] [CrossRef] [Scilit]
- Boss, J.D.; Singh, P.K.; Pandya, H.K.; Tosi, J.; Kim, C.; Tewari, A.; Juzych, M.S.; Abrams, G.W.; Kumar, A. Assessment of Neurotrophins and Inflammatory Mediators in Vitreous of Patients With Diabetic Retinopathy. Investig. Ophthalmol. Vis. Sci. 2017, 58, 5594–5603. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Hill, J.W.; Rosenberg, G.A. Multiple roles of metalloproteinases in neurological disorders. Prog. Mol. Biol. Transl. Sci. 2011, 99, 241–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, A.; McLamore, A.; Song, W.; McGuire, P.G. Retinal neovascularization is suppressed with a matrix metalloproteinase inhibitor. Arch. Ophthalmol. 1999, 117, 498–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ovechkin, A.V.; Tyagi, N.; Rodriguez, W.E.; Hayden, M.R.; Moshal, K.S.; Tyagi, S.C. Role of matrix metalloproteinase-9 in endothelial apoptosis in chronic heart failure in mice. J. Appl. Physiol. 2005, 99, 2398–2405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Unal, A.; Baykal, O.; Ozturk, N. Comparison of matrix metalloproteinase 9 and 14 levels in vitreous samples in diabetic and non-diabetic patients: A case control study. Int. J. Retin. Vitr. 2022, 8, 44. [Google Scholar] [CrossRef] [Scilit]
- Aiello, L.P.; Avery, R.L.; Arrigg, P.G.; Keyt, B.A.; Jampel, H.D.; Shah, S.T.; Pasquale, L.R.; Thieme, H.; Iwamoto, M.A.; Park, J.E.; et al. Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders. N. Engl. J. Med. 1994, 331, 1480–1487. [Google Scholar] [CrossRef] [Scilit]
- Shibuya, M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. J. Biochem. Mol. Biol. 2006, 39, 469–478. [Google Scholar] [CrossRef] [Scilit]
- Osaadon, P.; Fagan, X.J.; Lifshitz, T.; Levy, J. A review of anti-VEGF agents for proliferative diabetic retinopathy. Eye 2014, 28, 510–520. [Google Scholar] [CrossRef] [Scilit]
- Feeney, S.A.; Simpson, D.A.; Gardiner, T.A.; Boyle, C.; Jamison, P.; Stitt, A.W. Role of vascular endothelial growth factor and placental growth factors during retinal vascular development and hyaloid regression. Investig. Ophthalmol. Vis. Sci. 2003, 44, 839–847. [Google Scholar] [CrossRef] [Scilit]
- Penn, J.S.; Madan, A.; Caldwell, R.B.; Bartoli, M.; Caldwell, R.W.; Hartnett, M.E. Vascular endothelial growth factor in eye disease. Prog. Retin. Eye Res. 2008, 27, 331–371. [Google Scholar] [CrossRef] [Scilit]
- Vinores, S. Breakdown of the blood–retinal barrier. Encycl. Eye 2010, 216, 216–222. [Google Scholar]
- Lindahl, P.; Johansson, B.R.; Leveen, P.; Betsholtz, C. Pericyte loss and microaneurysm formation in PDGF-B-deficient mice. Science 1997, 277, 242–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanlandewijck, M.; He, L.; Mae, M.A.; Andrae, J.; Ando, K.; Del Gaudio, F.; Nahar, K.; Lebouvier, T.; Lavina, B.; Gouveia, L.; et al. A molecular atlas of cell types and zonation in the brain vasculature. Nature 2018, 554, 475–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitahara, H.; Kajikawa, S.; Ishii, Y.; Yamamoto, S.; Hamashima, T.; Azuma, E.; Sato, H.; Matsushima, T.; Shibuya, M.; Shimada, Y.; et al. The Novel Pathogenesis of Retinopathy Mediated by Multiple RTK Signals is Uncovered in Newly Developed Mouse Model. EBioMedicine 2018, 31, 190–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, Y.; Jin, X.; Wang, Q.S.; Wei, S.H.; Hou, B.K.; Li, H.Y.; Zhang, M.N.; Li, Z.H. The involvement of high mobility group 1 cytokine and phospholipases A2 in diabetic retinopathy. Lipids Health Dis. 2014, 13, 156. [Google Scholar] [CrossRef] [Scilit]
- Canning, P.; Kenny, B.A.; Prise, V.; Glenn, J.; Sarker, M.H.; Hudson, N.; Brandt, M.; Lopez, F.J.; Gale, D.; Luthert, P.J.; et al. Lipoprotein-associated phospholipase A2 (Lp-PLA2) as a therapeutic target to prevent retinal vasopermeability during diabetes. Proc. Natl. Acad. Sci. USA 2016, 113, 7213–7218. [Google Scholar] [CrossRef] [Scilit]
- Lupo, G.; Motta, C.; Giurdanella, G.; Anfuso, C.D.; Alberghina, M.; Drago, F.; Salomone, S.; Bucolo, C. Role of phospholipases A2 in diabetic retinopathy: In vitro and in vivo studies. Biochem. Pharmacol. 2013, 86, 1603–1613. [Google Scholar] [CrossRef] [Scilit]
- Giurdanella, G.; Lupo, G.; Gennuso, F.; Conti, F.; Furno, D.L.; Mannino, G.; Anfuso, C.D.; Drago, F.; Salomone, S.; Bucolo, C. Activation of the VEGF-A/ERK/PLA2 Axis Mediates Early Retinal Endothelial Cell Damage Induced by High Glucose: New Insight from an In Vitro Model of Diabetic Retinopathy. Int. J. Mol. Sci. 2020, 21, 7528. [Google Scholar] [CrossRef] [Scilit]
- Alikhani, M.; Roy, S.; Graves, D.T. FOXO1 plays an essential role in apoptosis of retinal pericytes. Mol. Vis. 2010, 16, 408–415. [Google Scholar]
- Baker, C.W.; Glassman, A.R.; Beaulieu, W.T.; Antoszyk, A.N.; Browning, D.J.; Chalam, K.V.; Grover, S.; Jampol, L.M.; Jhaveri, C.D.; Melia, M.; et al. Effect of Initial Management With Aflibercept vs Laser Photocoagulation vs Observation on Vision Loss Among Patients With Diabetic Macular Edema Involving the Center of the Macula and Good Visual Acuity: A Randomized Clinical Trial. JAMA 2019, 321, 1880–1894. [Google Scholar] [CrossRef] [Scilit]
- Hinkle, J.W.; Mahmoudzadeh, R.; Kuriyan, A.E. Cell-based therapies for retinal diseases: A review of clinical trials and direct to consumer “cell therapy” clinics. Stem Cell Res. Ther. 2021, 12, 538. [Google Scholar] [CrossRef] [Scilit]
- Mannino, G.; Russo, C.; Longo, A.; Anfuso, C.D.; Lupo, G.; Lo Furno, D.; Giuffrida, R.; Giurdanella, G. Potential therapeutic applications of mesenchymal stem cells for the treatment of eye diseases. World J. Stem Cells 2021, 13, 632–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, A.; Jaganathan, B.G. Stem Cell Therapy for Retinal Degeneration: The Evidence to Date. Biologics 2021, 15, 299–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fiori, A.; Hammes, H.P.; Bieback, K. Adipose-derived mesenchymal stromal cells reverse high glucose-induced reduction of angiogenesis in human retinal microvascular endothelial cells. Cytotherapy 2020, 22, 261–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mannino, G.; Longo, A.; Gennuso, F.; Anfuso, C.D.; Lupo, G.; Giurdanella, G.; Giuffrida, R.; Lo Furno, D. Effects of High Glucose Concentration on Pericyte-Like Differentiated Human Adipose-Derived Mesenchymal Stem Cells. Int. J. Mol. Sci. 2021, 22, 4604. [Google Scholar] [CrossRef] [Scilit]
- Blank, F.; Rothen-Rutishauser, B.; Gehr, P. Dendritic cells and macrophages form a transepithelial network against foreign particulate antigens. Am. J. Respir. Cell Mol. Biol. 2007, 36, 669–677. [Google Scholar] [CrossRef] [Scilit]
- Davidson, M.K.; Russ, P.K.; Glick, G.G.; Hoffman, L.H.; Chang, M.S.; Haselton, F.R. Reduced expression of the adherens junction protein cadherin-5 in a diabetic retina. Am. J. Ophthalmol. 2000, 129, 267–269. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Xu, X.; Elliott, M.H.; Zhu, M.; Le, Y.Z. Muller cell-derived VEGF is essential for diabetes-induced retinal inflammation and vascular leakage. Diabetes 2010, 59, 2297–2305. [Google Scholar] [CrossRef] [Scilit]
- Mastari, E.S.; Widjaja, S.S.; Siregar, Y.; Sari, M.I. Role of MMP-9 in Diabetic Retinopathy. J. Drug Deliv. Ther. 2020, 10, 122–124. [Google Scholar] [CrossRef] [Scilit]
- Hachana, S.; Larrivee, B. TGF-beta Superfamily Signaling in the Eye: Implications for Ocular Pathologies. Cells 2022, 11, 2336. [Google Scholar] [CrossRef] [Scilit]
- Adki, K.M.; Kulkarni, Y.A. Potential Biomarkers in Diabetic Retinopathy. Curr. Diabetes Rev. 2020, 16, 971–983. [Google Scholar] [CrossRef] [Scilit]
- Forrester, J.V.; Kuffova, L.; Delibegovic, M. The Role of Inflammation in Diabetic Retinopathy. Front. Immunol. 2020, 11, 583687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cummings, B.S.; McHowat, J.; Schnellmann, R.G. Phospholipase A(2)s in cell injury and death. J. Pharmacol. Exp. Ther. 2000, 294, 793–799. [Google Scholar] [PubMed]
- Leslie, C.C. Cytosolic phospholipase A(2): Physiological function and role in disease. J. Lipid Res. 2015, 56, 1386–1402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lupo, G.; Motta, C.; Salmeri, M.; Spina-Purrello, V.; Alberghina, M.; Anfuso, C.D. An in vitro retinoblastoma human triple culture model of angiogenesis: A modulatory effect of TGF-beta. Cancer Lett. 2014, 354, 181–188. [Google Scholar] [CrossRef] [Scilit]
- Park, D.Y.; Lee, J.; Kim, J.; Kim, K.; Hong, S.; Han, S.; Kubota, Y.; Augustin, H.G.; Ding, L.; Kim, J.W.; et al. Plastic roles of pericytes in the blood-retinal barrier. Nat. Commun. 2017, 8, 15296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hellstrom, M.; Kalen, M.; Lindahl, P.; Abramsson, A.; Betsholtz, C. Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse. Development 1999, 126, 3047–3055. [Google Scholar] [CrossRef] [Scilit]
- Kazlauskas, A. PDGFs and their receptors. Gene 2017, 614, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Tuekprakhon, A.; Sangkitporn, S.; Trinavarat, A.; Pawestri, A.R.; Vamvanij, V.; Ruangchainikom, M.; Luksanapruksa, P.; Pongpaksupasin, P.; Khorchai, A.; Dambua, A.; et al. Intravitreal autologous mesenchymal stem cell transplantation: A non-randomized phase I clinical trial in patients with retinitis pigmentosa. Stem Cell Res. Ther. 2021, 12, 52. [Google Scholar] [CrossRef] [Scilit]
- Dai, R.; Wang, Z.; Samanipour, R.; Koo, K.I.; Kim, K. Adipose-Derived Stem Cells for Tissue Engineering and Regenerative Medicine Applications. Stem Cells Int. 2016, 2016, 6737345. [Google Scholar] [CrossRef] [Scilit]
- Shingyochi, Y.; Orbay, H.; Mizuno, H. Adipose-derived stem cells for wound repair and regeneration. Expert Opin Biol. Ther. 2015, 15, 1285–1292. [Google Scholar] [CrossRef] [Scilit]
- Zuk, P.A.; Zhu, M.; Ashjian, P.; De Ugarte, D.A.; Huang, J.I.; Mizuno, H.; Alfonso, Z.C.; Fraser, J.K.; Benhaim, P.; Hedrick, M.H. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell 2002, 13, 4279–4295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Planat-Benard, V.; Menard, C.; Andre, M.; Puceat, M.; Perez, A.; Garcia-Verdugo, J.M.; Penicaud, L.; Casteilla, L. Spontaneous cardiomyocyte differentiation from adipose tissue stroma cells. Circ. Res. 2004, 94, 223–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aurich, H.; Sgodda, M.; Kaltwasser, P.; Vetter, M.; Weise, A.; Liehr, T.; Brulport, M.; Hengstler, J.G.; Dollinger, M.M.; Fleig, W.E.; et al. Hepatocyte differentiation of mesenchymal stem cells from human adipose tissue in vitro promotes hepatic integration in vivo. Gut 2009, 58, 570–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sommese, L.; Zullo, A.; Schiano, C.; Mancini, F.P.; Napoli, C. Possible Muscle Repair in the Human Cardiovascular System. Stem Cell Rev. Rep. 2017, 13, 170–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Miguel, M.P.; Fuentes-Julian, S.; Blazquez-Martinez, A.; Pascual, C.Y.; Aller, M.A.; Arias, J.; Arnalich-Montiel, F. Immunosuppressive properties of mesenchymal stem cells: Advances and applications. Curr. Mol. Med. 2012, 12, 574–591. [Google Scholar] [CrossRef] [Scilit]
- Giuseppina Onesti, M.; Carella, S.; Ceccarelli, S.; Marchese, C.; Scuderi, N. The Use of Human Adipose-Derived Stem Cells in the Treatment of Physiological and Pathological Vulvar Dystrophies. Stem Cells Int. 2016, 2016, 2561461. [Google Scholar] [CrossRef] [Scilit]
- Ceccarelli, S.; Pontecorvi, P.; Anastasiadou, E.; Napoli, C.; Marchese, C. Immunomodulatory Effect of Adipose-Derived Stem Cells: The Cutting Edge of Clinical Application. Front. Cell Dev. Biol. 2020, 8, 236. [Google Scholar] [CrossRef] [Scilit]
- Srinivasan, B.; Kolli, A.R.; Esch, M.B.; Abaci, H.E.; Shuler, M.L.; Hickman, J.J. TEER measurement techniques for in vitro barrier model systems. J. Lab Autom. 2015, 20, 107–126. [Google Scholar] [CrossRef] [Scilit]
- Ye, L.; Song, J.; Zheng, Y.; Zhong, M.; Liu, J.; Zhu, D.; Hu, S. New mechanism for mesenchymal stem cell microvesicle to restore lung permeability: Intracellular S1P signaling pathway independent of S1P receptor-1. Stem Cell Res. Ther. 2022, 13, 496. [Google Scholar] [CrossRef] [Scilit]
- Korff, T.; Kimmina, S.; Martiny-Baron, G.; Augustin, H.G. Blood vessel maturation in a 3-dimensional spheroidal coculture model: Direct contact with smooth muscle cells regulates endothelial cell quiescence and abrogates VEGF responsiveness. FASEB J. 2001, 15, 447–457. [Google Scholar] [CrossRef] [Scilit]
- Pati, S.; Khakoo, A.Y.; Zhao, J.; Jimenez, F.; Gerber, M.H.; Harting, M.; Redell, J.B.; Grill, R.; Matsuo, Y.; Guha, S.; et al. Human mesenchymal stem cells inhibit vascular permeability by modulating vascular endothelial cadherin/beta-catenin signaling. Stem Cells Dev. 2011, 20, 89–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sweeney, M.; Foldes, G. It Takes Two: Endothelial-Perivascular Cell Cross-Talk in Vascular Development and Disease. Front. Cardiovasc. Med. 2018, 5, 154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H. Pericyte-Endothelial Interactions in the Retinal Microvasculature. Int. J. Mol. Sci. 2020, 21, 7413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McGuire, P.G.; Rangasamy, S.; Maestas, J.; Das, A. Pericyte-derived sphingosine 1-phosphate induces the expression of adhesion proteins and modulates the retinal endothelial cell barrier. Arterioscler. Thromb. Vasc. Biol. 2011, 31, e107–e115. [Google Scholar] [CrossRef] [Scilit]
- Lampugnani, M.G.; Orsenigo, F.; Gagliani, M.C.; Tacchetti, C.; Dejana, E. Vascular endothelial cadherin controls VEGFR-2 internalization and signaling from intracellular compartments. J. Cell Biol. 2006, 174, 593–604. [Google Scholar] [CrossRef] [Scilit]
- Navaratna, D.; McGuire, P.G.; Menicucci, G.; Das, A. Proteolytic degradation of VE-cadherin alters the blood-retinal barrier in diabetes. Diabetes 2007, 56, 2380–2387. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.S.; Kim, Y.G.; Cho, H.J.; Park, J.; Jeong, H.; Lee, S.E.; Lee, S.P.; Kang, H.J.; Kim, H.S. Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin Phosphorylation. Sci. Rep. 2016, 6, 29393. [Google Scholar] [CrossRef] [Scilit]
- Ting, K.K.; Zhao, Y.; Shen, W.; Coleman, P.; Yam, M.; Chan-Ling, T.; Li, J.; Moller, T.; Gillies, M.; Vadas, M.A.; et al. Therapeutic regulation of VE-cadherin with a novel oligonucleotide drug for diabetic eye complications using retinopathy mouse models. Diabetologia 2019, 62, 322–334. [Google Scholar] [CrossRef] [Scilit]
- Vermette, D.; Hu, P.; Canarie, M.F.; Funaro, M.; Glover, J.; Pierce, R.W. Tight junction structure, function, and assessment in the critically ill: A systematic review. Intensive Care Med. Exp. 2018, 6, 37. [Google Scholar] [CrossRef] [Scilit]
- Tornavaca, O.; Chia, M.; Dufton, N.; Almagro, L.O.; Conway, D.E.; Randi, A.M.; Schwartz, M.A.; Matter, K.; Balda, M.S. ZO-1 controls endothelial adherens junctions, cell-cell tension, angiogenesis, and barrier formation. J. Cell Biol. 2015, 208, 821–838. [Google Scholar] [CrossRef] [Scilit]
- Lazzara, F.; Longo, A.M.; Giurdanella, G.; Lupo, G.; Platania, C.B.M.; Rossi, S.; Drago, F.; Anfuso, C.D.; Bucolo, C. Vitamin D(3) preserves blood retinal barrier integrity in an in vitro model of diabetic retinopathy. Front. Pharmacol. 2022, 13, 971164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teodoro, J.S.; Nunes, S.; Rolo, A.P.; Reis, F.; Palmeira, C.M. Therapeutic Options Targeting Oxidative Stress, Mitochondrial Dysfunction and Inflammation to Hinder the Progression of Vascular Complications of Diabetes. Front. Physiol. 2018, 9, 1857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kusuhara, S.; Fukushima, Y.; Ogura, S.; Inoue, N.; Uemura, A. Pathophysiology of Diabetic Retinopathy: The Old and the New. Diabetes Metab. J. 2018, 42, 364–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Semeraro, F.; Morescalchi, F.; Cancarini, A.; Russo, A.; Rezzola, S.; Costagliola, C. Diabetic retinopathy, a vascular and inflammatory disease: Therapeutic implications. Diabetes Metab. 2019, 45, 517–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Busik, J.V.; Mohr, S.; Grant, M.B. Hyperglycemia-induced reactive oxygen species toxicity to endothelial cells is dependent on paracrine mediators. Diabetes 2008, 57, 1952–1965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakurai, E.; Taguchi, H.; Anand, A.; Ambati, B.K.; Gragoudas, E.S.; Miller, J.W.; Adamis, A.P.; Ambati, J. Targeted disruption of the CD18 or ICAM-1 gene inhibits choroidal neovascularization. Investig. Ophthalmol. Vis. Sci. 2003, 44, 2743–2749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, Y.; Li, R.; Du, J.; Li, X.; Zhao, L.; Long, L.; Li, D.; Lu, S. Tumor necrosis factor-alpha and diabetic retinopathy: Review and meta-analysis. Clin. Chim. Acta 2018, 485, 210–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hang, H.; Yuan, S.; Yang, Q.; Yuan, D.; Liu, Q. Multiplex bead array assay of plasma cytokines in type 2 diabetes mellitus with diabetic retinopathy. Mol. Vis. 2014, 20, 1137–1145. [Google Scholar]
- Demircan, N.; Safran, B.G.; Soylu, M.; Ozcan, A.A.; Sizmaz, S. Determination of vitreous interleukin-1 (IL-1) and tumour necrosis factor (TNF) levels in proliferative diabetic retinopathy. Eye 2006, 20, 1366–1369. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Biarnes Costa, M.; Gerhardinger, C. IL-1beta is upregulated in the diabetic retina and retinal vessels: Cell-specific effect of high glucose and IL-1beta autostimulation. PLoS ONE 2012, 7, e36949. [Google Scholar] [CrossRef] [Scilit]
- Yun, J.H. Interleukin-1beta induces pericyte apoptosis via the NF-kappaB pathway in diabetic retinopathy. Biochem. Biophys. Res. Commun. 2021, 546, 46–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vincent, J.A.; Mohr, S. Inhibition of caspase-1/interleukin-1beta signaling prevents degeneration of retinal capillaries in diabetes and galactosemia. Diabetes 2007, 56, 224–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.; Gandhi, J.K.; Zhong, X.; Wei, Y.; Gong, J.; Duh, E.J.; Vinores, S.A. TNFalpha is required for late BRB breakdown in diabetic retinopathy, and its inhibition prevents leukostasis and protects vessels and neurons from apoptosis. Investig. Ophthalmol. Vis. Sci. 2011, 52, 1336–1344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez, M.L.; Perez, S.; Mena-Molla, S.; Desco, M.C.; Ortega, A.L. Oxidative Stress and Microvascular Alterations in Diabetic Retinopathy: Future Therapies. Oxid. Med. Cell Longev. 2019, 2019, 4940825. [Google Scholar] [CrossRef] [Scilit]
- Joussen, A.M.; Poulaki, V.; Qin, W.; Kirchhof, B.; Mitsiades, N.; Wiegand, S.J.; Rudge, J.; Yancopoulos, G.D.; Adamis, A.P. Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo. Am. J. Pathol. 2002, 160, 501–509. [Google Scholar] [CrossRef] [Scilit]
- Croll, S.D.; Ransohoff, R.M.; Cai, N.; Zhang, Q.; Martin, F.J.; Wei, T.; Kasselman, L.J.; Kintner, J.; Murphy, A.J.; Yancopoulos, G.D.; et al. VEGF-mediated inflammation precedes angiogenesis in adult brain. Exp. Neurol. 2004, 187, 388–402. [Google Scholar] [CrossRef] [Scilit]
- Lee, T.H.; Avraham, H.; Lee, S.H.; Avraham, S. Vascular endothelial growth factor modulates neutrophil transendothelial migration via up-regulation of interleukin-8 in human brain microvascular endothelial cells. J. Biol. Chem. 2002, 277, 10445–10451. [Google Scholar] [CrossRef] [Scilit]
- Hajmousa, G.; Przybyt, E.; Pfister, F.; Paredes-Juarez, G.A.; Moganti, K.; Busch, S.; Kuipers, J.; Klaassen, I.; van Luyn, M.J.A.; Krenning, G.; et al. Human adipose tissue-derived stromal cells act as functional pericytes in mice and suppress high-glucose-induced proinflammatory activation of bovine retinal endothelial cells. Diabetologia 2018, 61, 2371–2385. [Google Scholar] [CrossRef] [Scilit]
- Elshaer, S.L.; Evans, W.; Pentecost, M.; Lenin, R.; Periasamy, R.; Jha, K.A.; Alli, S.; Gentry, J.; Thomas, S.M.; Sohl, N.; et al. Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2(Akita) mouse. Stem Cell Res. Ther. 2018, 9, 322. [Google Scholar] [CrossRef] [Scilit]
- van Hinsbergh, V.W.; Engelse, M.A.; Quax, P.H. Pericellular proteases in angiogenesis and vasculogenesis. Arterioscler. Thromb. Vasc. Biol. 2006, 26, 716–728. [Google Scholar] [CrossRef] [Scilit]
- Giebel, S.J.; Menicucci, G.; McGuire, P.G.; Das, A. Matrix metalloproteinases in early diabetic retinopathy and their role in alteration of the blood-retinal barrier. Lab Investig. 2005, 85, 597–607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yildirim, N.; Sahin, A.; Erol, N.; Kara, S.; Uslu, S.; Topbas, S. The relationship between plasma MMP-9 and TIMP-2 levels and intraocular pressure elevation in diabetic patients after intravitreal triamcinolone injection. J. Glaucoma 2008, 17, 253–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, M.; Kashiwagi, K.; Iizuka, Y.; Tanaka, Y.; Imai, M.; Tsukahara, S. Matrix metalloproteinases in human diabetic and nondiabetic vitreous. Retina 2001, 21, 28–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goumans, M.J.; Liu, Z.; ten Dijke, P. TGF-beta signaling in vascular biology and dysfunction. Cell Res. 2009, 19, 116–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobolyi, A.; Vincze, C.; Pal, G.; Lovas, G. The neuroprotective functions of transforming growth factor beta proteins. Int. J. Mol. Sci. 2012, 13, 8219–8258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carvalho, R.L.; Itoh, F.; Goumans, M.J.; Lebrin, F.; Kato, M.; Takahashi, S.; Ema, M.; Itoh, S.; van Rooijen, M.; Bertolino, P.; et al. Compensatory signalling induced in the yolk sac vasculature by deletion of TGFbeta receptors in mice. J. Cell Sci. 2007, 120, 4269–4277. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Feng, Z.; Han, X.; Xing, Y.; Zhang, X. Downregulation of acylglycerol kinase suppresses high-glucose-induced endothelial-mesenchymal transition in human retinal microvascular endothelial cells through regulating the LPAR1/TGF-beta/Notch signaling pathway. Can. J. Physiol. Pharmacol. 2022, 100, 142–150. [Google Scholar] [CrossRef] [Scilit]
- Tuleta, I.; Frangogiannis, N.G. Diabetic fibrosis. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166044. [Google Scholar] [CrossRef] [Scilit]
- El-Asrar, A.M.; Missotten, L.; Geboes, K. Expression of cyclo-oxygenase-2 and downstream enzymes in diabetic fibrovascular epiretinal membranes. Br. J. Ophthalmol. 2008, 92, 1534–1539. [Google Scholar] [CrossRef] [Scilit]
- Brust, A.K.; Ulbrich, H.K.; Seigel, G.M.; Pfeiffer, N.; Grus, F.H. Effects of Cyclooxygenase Inhibitors on Apoptotic Neuroretinal Cells. Biomark. Insights 2008, 3, 387–402. [Google Scholar] [CrossRef] [Scilit]
- Radi, Z.A.; Render, J.A. The pathophysiologic role of cyclo-oxygenases in the eye. J. Ocul. Pharmacol. Ther. 2008, 24, 141–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayalasomayajula, S.P.; Kompella, U.B. Celecoxib, a selective cyclooxygenase-2 inhibitor, inhibits retinal vascular endothelial growth factor expression and vascular leakage in a streptozotocin-induced diabetic rat model. Eur. J. Pharmacol. 2003, 458, 283–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anfuso, C.D.; Motta, C.; Giurdanella, G.; Arena, V.; Alberghina, M.; Lupo, G. Endothelial PKCalpha-MAPK/ERK-phospholipase A2 pathway activation as a response of glioma in a triple culture model. A new role for pericytes? Biochimie 2014, 99, 77–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caporarello, N.; Salmeri, M.; Scalia, M.; Motta, C.; Parrino, C.; Frittitta, L.; Olivieri, M.; Toscano, M.A.; Anfuso, C.D.; Lupo, G. Role of cytosolic and calcium independent phospholipases A(2) in insulin secretion impairment of INS-1E cells infected by S. aureus. FEBS Lett. 2015, 589, 3969–3976. [Google Scholar] [CrossRef] [Scilit]
- Giurdanella, G.; Motta, C.; Muriana, S.; Arena, V.; Anfuso, C.D.; Lupo, G.; Alberghina, M. Cytosolic and calcium-independent phospholipase A(2) mediate glioma-enhanced proangiogenic activity of brain endothelial cells. Microvasc. Res. 2011, 81, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Benjamin, L.E.; Hemo, I.; Keshet, E. A plasticity window for blood vessel remodelling is defined by pericyte coverage of the preformed endothelial network and is regulated by PDGF-B and VEGF. Development 1998, 125, 1591–1598. [Google Scholar] [CrossRef] [Scilit]
- Stenzel, D.; Nye, E.; Nisancioglu, M.; Adams, R.H.; Yamaguchi, Y.; Gerhardt, H. Peripheral mural cell recruitment requires cell-autonomous heparan sulfate. Blood 2009, 114, 915–924. [Google Scholar] [CrossRef] [Scilit]
- Shen, J.; Xu, G.; Zhu, R.; Yuan, J.; Ishii, Y.; Hamashima, T.; Matsushima, T.; Yamamoto, S.; Takatsuru, Y.; Nabekura, J.; et al. PDGFR-beta restores blood-brain barrier functions in a mouse model of focal cerebral ischemia. J. Cereb. Blood Flow Metab. 2019, 39, 1501–1515. [Google Scholar] [CrossRef] [Scilit]
- Lo Furno, D.; Mannino, G.; Pellitteri, R.; Zappala, A.; Parenti, R.; Gili, E.; Vancheri, C.; Giuffrida, R. Conditioned Media From Glial Cells Promote a Neural-Like Connexin Expression in Human Adipose-Derived Mesenchymal Stem Cells. Front. Physiol. 2018, 9, 1742. [Google Scholar] [CrossRef] [Scilit]
- Mannino, G.; Gennuso, F.; Giurdanella, G.; Conti, F.; Drago, F.; Salomone, S.; Furno, D.L.; Bucolo, C.; Giuffrida, R. Pericyte-like differentiation of human adipose-derived mesenchymal stem cells: An in vitro study. World J. Stem Cells 2020, 12, 1152–1170. [Google Scholar] [CrossRef] [Scilit]
- Salmeri, M.; Motta, C.; Anfuso, C.D.; Amodeo, A.; Scalia, M.; Toscano, M.A.; Alberghina, M.; Lupo, G. VEGF receptor-1 involvement in pericyte loss induced by Escherichia coli in an in vitro model of blood brain barrier. Cell Microbiol. 2013, 15, 1367–1384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anfuso, C.D.; Giurdanella, G.; Motta, C.; Muriana, S.; Lupo, G.; Ragusa, N.; Alberghina, M. PKCalpha-MAPK/ERK-phospholipase A2 signaling is required for human melanoma-enhanced brain endothelial cell proliferation and motility. Microvasc. Res. 2009, 78, 338–357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Sequence (5′-3′) |
|---|---|
| VEGF-A | Fw: ATCTTCAAGCCATCCTGTGTGC |
| Rv: GAGGTTTGATCCGCATAATCTG | |
| IL10 | Fw: GACTTTAAGGGTTACCTGGGTTG |
| Rv: TCACATGCGCCTTGATGTCTG | |
| IL-1β | Fw: AGCTACGAATCTCCGACCAC |
| Rv: CGTTATCCCATGTGTCGAAGAA | |
| TGF-β1 | Fw: CGTCTGCTGAGGCTCAAGT |
| Rv: CGCCAGGAATTGTTGCTGTA | |
| TNF-α | Fw: AGCCCATGTTGTAGCAAACC |
| Rv: TGAGGTACAGGCCCTCTGAT | |
| MMP-9 | Fw: CACTGTCCACCCCTCAGAGC |
| Rv: GCCAACTTGTCGGCGATAAGG | |
| PDGF-β | Fw: TGA TCT CCA ACG CCT GCT |
| Rv: TCA TGT TCA GGT CCA ACT CG | |
| PDGFR-B | Fw: TCA GCA AGG ACA CCA TG |
| Rv: CCG AGC AGG TCA GAA CGA AG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lupo, G.; Agafonova, A.; Cosentino, A.; Giurdanella, G.; Mannino, G.; Lo Furno, D.; Romano, I.R.; Giuffrida, R.; D’Angeli, F.; Anfuso, C.D. Protective Effects of Human Pericyte-like Adipose-Derived Mesenchymal Stem Cells on Human Retinal Endothelial Cells in an In Vitro Model of Diabetic Retinopathy: Evidence for Autologous Cell Therapy. Int. J. Mol. Sci. 2023, 24, 913. https://doi.org/10.3390/ijms24020913
Lupo G, Agafonova A, Cosentino A, Giurdanella G, Mannino G, Lo Furno D, Romano IR, Giuffrida R, D’Angeli F, Anfuso CD. Protective Effects of Human Pericyte-like Adipose-Derived Mesenchymal Stem Cells on Human Retinal Endothelial Cells in an In Vitro Model of Diabetic Retinopathy: Evidence for Autologous Cell Therapy. International Journal of Molecular Sciences. 2023; 24(2):913. https://doi.org/10.3390/ijms24020913
Chicago/Turabian StyleLupo, Gabriella, Aleksandra Agafonova, Alessia Cosentino, Giovanni Giurdanella, Giuliana Mannino, Debora Lo Furno, Ivana Roberta Romano, Rosario Giuffrida, Floriana D’Angeli, and Carmelina Daniela Anfuso. 2023. "Protective Effects of Human Pericyte-like Adipose-Derived Mesenchymal Stem Cells on Human Retinal Endothelial Cells in an In Vitro Model of Diabetic Retinopathy: Evidence for Autologous Cell Therapy" International Journal of Molecular Sciences 24, no. 2: 913. https://doi.org/10.3390/ijms24020913
APA StyleLupo, G., Agafonova, A., Cosentino, A., Giurdanella, G., Mannino, G., Lo Furno, D., Romano, I. R., Giuffrida, R., D’Angeli, F., & Anfuso, C. D. (2023). Protective Effects of Human Pericyte-like Adipose-Derived Mesenchymal Stem Cells on Human Retinal Endothelial Cells in an In Vitro Model of Diabetic Retinopathy: Evidence for Autologous Cell Therapy. International Journal of Molecular Sciences, 24(2), 913. https://doi.org/10.3390/ijms24020913

