A Non-functional γ-Aminobutyric Acid Shunt Pathway in Cyanobacterium Synechocystis sp. PCC 6803 Enhances δ-Aminolevulinic Acid Accumulation under Modified Nutrient Conditions
Abstract
1. Introduction
2. Results and Discussion
2.1. Disruption of the GABA Shunt Pathway for the Production of ALA
2.2. Transcriptional Regulation of the ALA Biosynthesis Pathway in the ΔGdc Mutant Strain
2.3. Cyanobacterial Growth and ALA Production in the Presence of LA
3. Materials and Methods
3.1. Strains and Culture Conditions
3.2. Construction of the ΔGdc Strain
3.3. Experimental Treatments and Analysis of Metabolites
3.4. Total RNA Extraction and Gene Expression Analysis
3.5. Statistics
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vranova, V.; Rejsek, K.; Skene, K.R.; Formanek, P. Non-protein amino acids: Plant, soil and ecosystem interactions. Plant Soil. 2011, 342, 31–48. [Google Scholar] [CrossRef]
- Kang, Z.; Zhang, J.; Zhou, J.; Qi, Q.; Du, G.; Chen, J. Recent advances in microbial production of δ-aminolevulinic acid and vitamin B12. Biotechnol. Adv. 2012, 30, 1533–1542. [Google Scholar] [CrossRef] [PubMed]
- Jantaro, S.; Kanwal, S. Low molecular weight nitrogenous compounds (GABA and polyamines) in blue green algae, In Algal green Chemistry: Recent Progress in Biotechnology; Rastogi, R.P., Madamwar, D., Pandey, A., Eds.; Elsevier B.V.: Amsterdam, The Netherlands, 2017; pp. 149–169. [Google Scholar]
- Su, A.; Yu, Q.; Luo, Y.; Yang, J.; Wang, E.; Yua, H. Metabolic engineering of microorganisms for the production of multifunctional non-protein amino acids: γ-aminobutyric acid and δ-aminolevulinic acid. Microb. Biotechnol. 2021, 14, 2279–2290. [Google Scholar] [CrossRef] [PubMed]
- Jiang, M.; Hong, K.; Mao, Y.; Ma, H.; Chen, T.; Wang, Z. Natural 5-aminolevulinic acid: Sources, biosynthesis, detection and applications. Front. Bioeng. Biotechnol. 2022, 10, 841443. [Google Scholar] [CrossRef]
- Rieble, S.; Beale, S.I. Purification of glutamyl-tRNA reductase from Synechocystis sp. PCC 6803. J. Biol. Chem. 1991, 266, 9740–9745. [Google Scholar] [CrossRef]
- Zhang, J.; Kang, Z.; Chen, J.; Du, G. Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli. Sci. Rep. 2015, 5, 8584. [Google Scholar] [CrossRef]
- Kanwal, S.; Incharoensakdi, A. The role of GAD pathway for regulation of GABA accumulation and C/N balance in Synechocystis sp. PCC6803. J. Appl. Phycol. 2019, 31, 3503–3514. [Google Scholar] [CrossRef]
- Cui, Z.; Zhu, Z.; Zhang, J.; Jiang, Z.; Liu, Y.; Wang, Q.; Hou, J.; Qi, Q. Efficient 5-aminolevulinic acid production through reconstructing the metabolic pathway in SDH-deficient Yarrowia lipolytica. Biochem. Eng. J. 2021, 174, 108125. [Google Scholar] [CrossRef]
- Zhu, C.; Chen, J.; Wang, Y.; Wang, L.; Guo, X.; Chen, N.; Zheng, P.; Sun, J.; Ma, Y. Enhancing 5-aminolevulinic acid tolerance and production by engineering the antioxidant defense system of Escherichia coli. Biotechnol. Bioeng. 2019, 116, 2018–2028. [Google Scholar] [CrossRef]
- Yu, X.; Jin, H.; Liu, W.; Wang, Q.; Qi, Q. Engineering Corynebacterium glutamicum to produce 5-aminolevulinic acid from glucose. Microb. Cell Fact. 2015, 14, 183. [Google Scholar] [CrossRef]
- Anderson, S.L.; McIntosh, L. Light-activated heterotrophic growth of the cyanobacterium Synechocystis sp. strain PCC 6803: A blue-light-requiring process. J. Bacteriol. 1991, 9, 2761–2767. [Google Scholar] [CrossRef]
- Morris, J.N.; Crawford, T.S.; Jeffs, A.; Stockwell, P.A.; Eaton-Rye, J.J.; Summerfield, T.C. Whole genome re-sequencing of two “wild-type” strains of the model cyanobacterium Synechocystis sp. PCC 6803. N. Z. J. Bot. 2014, 52, 36–47. [Google Scholar] [CrossRef]
- Zhang, S.; Bryant, D.A. The tricarboxylic acid cycle in cyanobacteria. Science 2012, 334, 1551–1553. [Google Scholar] [CrossRef]
- Kipe-Nolt, J.A.; Stevens, S.E. Biosynthesis of δ-aminolevulinic acid from glutamate in Agmenellum quadruplicatum. Plant Physiol. 1980, 65, 126–128. [Google Scholar] [CrossRef] [PubMed]
- Kisaka, H.; Kida, T.; Miwa, T. Antisense suppression of glutamate decarboxylase in tomato (Lycopersicon esculentum L.) results in accumulation of glutamate in transgenic tomato fruits. Plant Biotech. 2006, 23, 267–274. [Google Scholar] [CrossRef]
- Kanwal, S.; Khetkorn, W.; Incharoensakdi, A. GABA accumulation in response to different nitrogenous compounds in unicellular cyanobacterium Synechocystis sp. PCC 6803. Curr. Microbiol. 2015, 70, 96–102. [Google Scholar] [CrossRef] [PubMed]
- Jaishankar, J.; Srivastava, P. Molecular Basis of Stationary Phase Survival and Applications. Front. Microbiol. 2017, 8, 2000. [Google Scholar] [CrossRef]
- Nishikawa, S.; Murooka, Y. 5-Aminolevulinic acid: Production by fermentation, and agricultural and biomedical applications. Biotechnol. Genet. Eng. Rev. 2001, 18, 149–170. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Zhang, G.; Li, X.; Zhang, J. Microbial production and applications of 5-aminolevulinic acid. Appl. Microbiol. Biotechnol. 2014, 98, 7349–7357. [Google Scholar] [CrossRef]
- Wu, Y.; Jin, X.; Liao, W.; Hu, L.; Dawuda, M.M.; Zhao, X.; Tang, Z.; Gong, T.; Yu, J. 5-Aminolevulinic acid (ALA) alleviated salinity stress in cucumber seedlings by enhancing chlorophyll synthesis pathway. Front. Plant Sci. 2018, 9, 635. [Google Scholar] [CrossRef]
- Liu, D.; Wu, L.; Naeem, M.S.; Liu, H.; Deng, X.; Xu, L.; Zhang, F. 5-Aminolevulinic acid enhances photosynthetic gas exchange, chlorophyll fluorescence and antioxidant system in oilseed rape under drought stress. Acta Physiol. Plant. 2013, 35, 2747–2759. [Google Scholar] [CrossRef]
- Beale, S.I. The biosynthesis of δ-aminolevulinic acid in Chlorella. Plant Physiol. 1970, 45, 504–506. [Google Scholar] [CrossRef]
- Troxler, R.F.; Brown, A.S. Metabolism of δ-aminolevulinic acid in red and blue-green algae. Plant Physiol. 1975, 55, 463–467. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kipe-Nolt, J.A.; Stevens, S.J.; Stevens, C.L. Biosynthesis of δ-aminolevulinic acid by blue-green algae (cyanobacteria). J. Bacteriol. 1978, 135, 286–288. [Google Scholar] [CrossRef] [PubMed]
- Rieble, S.; Beale, S.I. Transformation of glutamate to δ-aminolevulinic acid by soluble extracts of Synechocystis sp. PCC 6803 and other oxygenic prokaryotes. J. Biol. Chem. 1988, 263, 8861–8871. [Google Scholar] [CrossRef]
- Kanwal, S.; Rastogi, R.P.; Incharoensakdi, A. Glutamate decarboxylase activity and gamma-aminobutyric acid content in Synechocystis sp. PCC 6803 under osmotic stress and different carbon sources. J. Appl. Phycol. 2014, 26, 2327–2333. [Google Scholar] [CrossRef]
- Mikkat, S.; Effmert, U.; Hagemann, M. Uptake and use of the osmoprotective compounds trehalose, glucosylglycerol and sucrose by the cyanobacterium Synechocystis sp. PCC6803. Arch. Microbiol. 1997, 167, 112–118. [Google Scholar] [CrossRef]
- Hendry, J.I.; Prasannan, C.; Ma, F.; Möllers, K.B.; Jaiswal, D.; Digmurti, M.; Allen, D.K.; Frigaard, N.-U.; Dasgupta, S.; Wangikar, P.P. Rerouting of carbon flux in a glycogen mutant of cyanobacteria assessed via isotopically non-stationary 13 C metabolic flux analysis. Biotechnol. Bioeng. 2017, 114, 2298–2308. [Google Scholar] [CrossRef]
- Yi, Y.C.; Shih, I.T.; Yu, T.H.; Lee, Y.J.; Ng, I.S. Challenges and opportunities of bioprocessing 5-aminolevulinic acid using genetic and metabolic engineering: A critical review. Bioresour. Bioprocess. 2021, 8, 100. [Google Scholar] [CrossRef]
- Zhang, B.; Ye, B.C. Pathway engineering in Corynebacterium glutamicum S9114 for 5-aminolevulinic acid production. 3 Biotech 2018, 8, 247. [Google Scholar] [CrossRef]
- Eisenhut, M.; Bauwe, H.; Hagemann, M. Glycine accumulation is toxic for the cyanobacterium Synechocystis sp. strain PCC 6803, but can be compensated by supplementation with magnesium ions. FEMS Microbiol. Lett. 2007, 277, 232–237. [Google Scholar] [CrossRef] [PubMed]
- Martínez, J.L.; Petranovic, D.; Nielsen, J. Heme metabolism in stress regulation and protein production: From Cinderella to a key player. Bioengineered 2016, 7, 112–115. [Google Scholar] [CrossRef]
- Steward, F.C.; Durzan, D.J. Metabolism of nitrogenous compounds. In Plant Physiology; Steward, F.C., Ed.; Academic Press: New York, NY, USA, 1965; pp. 379–686. [Google Scholar]
- Quintero, M.J.; Montesinos, M.L.; Herrero, A.; Flores, E. Identification of genes encoding amino acid permeases by inactivation of selected ORFs from the Synechocystis genomic sequence. Genome Res. 2001, 11, 2034–2040. [Google Scholar] [CrossRef] [PubMed]
- Knoop, H.; Gründel, M.; Zilliges, Y.; Lehmann, R.; Hoffmann, S.; Lockau, W.; Steuer, R. Flux balance analysis of cyanobacterial metabolism: The metabolic network of Synechocystis sp. PCC 6803. PLoS Comput. Biol. 2013, 9, e1003081. [Google Scholar] [CrossRef] [PubMed]
- Falkner, G.; Horner, F. pH Changes in the cytoplasm of the blue-green alga Anacystis nidulans caused by light-dependent proton flux into the thylakoid space. Plant Physiol. 1976, 58, 717–718. [Google Scholar] [CrossRef]
- Shelp, B.J.; Bown, A.W.; McLean, M.D. Metabolism and functions of gamma-aminobutyric acid. Trends Plant Sci. 1999, 4, 446–452. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, R.; Tanaka, A. Tetrapyrrole biosynthesis in higher plants. Annu. Rev. Plant Biol. 2007, 58, 321–346. [Google Scholar] [CrossRef]
- Saikeur, A.; Choorit, W.; Prasertsan, P.; Kantachote, D.; Sasaki, K. Influence of precursors and inhibitor on the production of extracellular 5-aminolevulinic acid and biomass by Rhodopseudomonas palustris KG31. Biosci. Biotechnol. Biochem. 2009, 73, 987–992. [Google Scholar] [CrossRef]
- Lee, S.; Ryu, J.; Kim, S.Y.; Jeon, J.; Song, J.Y.; Cho, H.-T.; Choi, S.-B.; Choi, D.; de Marsac, N.T.; Park, Y.-I. Transcriptional regulation of the respiratory genes in the cyanobacterium Synechocystis sp. PCC 6803 during the early response to glucose feeding. Plant Physiol. 2007, 145, 1018–1030. [Google Scholar] [CrossRef]
- Wilde, A.; Hihara, Y. Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis. Biochim. Biophys. Acta (BBA)-Bioenerg. 2016, 1857, 296–308. [Google Scholar] [CrossRef] [PubMed]
- Forchhammer, K.; Selim, K.A. Carbon/nitrogen homeostasis control in cyanobacteria. FEMS Microbiol. Rev. 2020, 44, 33–53. [Google Scholar] [CrossRef] [PubMed]
- Kanwal, S.; Incharoensakdi, A. Characterization of glutamate decarboxylase from Synechocystis sp. PCC6803 and its role in nitrogen metabolism. Plant Physiol. Biochem. 2016, 99, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Ano, A.; Funahashi, H.; Nakao, K.; Nishizawa, Y. Effects of Levulinic acid on 5-aminolevulinic acid production in heterotrophic cultures on Chlorella regularis YA-603. J. Biosci. Bioeng. 2000, 89, 176–180. [Google Scholar] [CrossRef] [PubMed]
- Anderson, T.; Briseid, T.; Nesbakken, T.; Ormerod, J.; Sirevaag, R.; Thorud, M. Mechanism of systhesis of 5-aminolevulinic acid in purple, green and blue-green bacteria. FEMS Microbiol. Lett. 1983, 19, 303–306. [Google Scholar] [CrossRef]
- Rippka, R.; Deruelles, J.; Waterbury, J.B.; Herdman, M.; Stanier, R.Y. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 1979, 111, 1–61. [Google Scholar] [CrossRef]
- Kanwal, S.; Incharoensakdi, A. GABA synthesis mediated by γ-aminobutanal dehydrogenase in Synechocystis sp. PCC6803 with disrupted glutamate and α-ketoglutarate decarboxylase genes. Plant Sci. 2020, 290, 110287. [Google Scholar] [CrossRef]
- Jantaro, S.; Baebprasert, W.; Piyamawadee, C.; Sodsuay, O.; Incharoensakdi, A. Exogenous spermidine alleviates UV-induced growth inhibition of Synechocystis sp. PCC 6803 via reduction of hydrogen peroxide and malonaldehyde levels. Appl. Biochem. Biotechnol. 2014, 173, 1145–1156. [Google Scholar] [CrossRef]
Name | Target Sequence ID | Sequence 5′→3′ | Purpose of Primer | Amplified Fragment Length (bp) |
---|---|---|---|---|
gdcF-KpnI | sll1641 | GCTCTAGAATGGTGCATAAAAAAATTG | Forward primer for Gdc | 1415 |
gdcR-KpnI | CTCGAGATGGCTAAAGTGGGA | Reverse primer for Gdc | ||
KanKp-F | N.A. | GGTACCAAGCCACGTTGTGT | Forward primer for the KanR cassette interrupting Gdc | 1220 |
KanKp-R | GGTACCTGAGGTCTGCCTCG | Reverse primer for the KanR cassette interrupting Gdc | ||
F-gts | sll0179 | TATAACCTGGCAGTGGTGGTG | Forward primer used in the qPCR reaction for Gts | 190 |
R-gts | CCCCGTCTCGCTTAGATAAT | Reverse primer used in the qPCR reaction for Gts | ||
F-gtr | slr1808 | AAGCGCTAACCCATCTGC | Forward primer used in the qPCR reaction for Gtr | 152 |
R-gtr | GGGAATATTGCCAGTTTCAGA | Reverse primer used in the qPCR reaction for Gtr | ||
F-gsa | sll0017 | CTATGGTGGTCGGGAAGAA | Forward primer used in the qPCR reaction for Gsa | 193 |
R-gsa | AGCCGCAGCTAGTAAACCAT | Reverse primer used in the qPCR reaction for Gsa | ||
F-pbs | sll1994 | TATCCCTTGTTTGCCGTTC | Forward primer used in the qPCR reaction for Pbs | 174 |
R-pbs | CGTGGCATCGGTATCCTTAT | Reverse primer used in the qPCR reaction for Pbs | ||
F-gdc | sll1641 | AACGTCCAGGTTTGTTGGGAAA | Forward primer used in the qPCR reaction for Gdc | 166 |
R-gdc | TGCCGTCAAAGGTGCTACCT | Reverse primer used in the qPCR reaction for Gdc | ||
F-gdh | slr0710 | TGAAGTTGCTAATGGGCC | Forward primer used in the qPCR reaction for Gdh | 179 |
R-gdh | CCTTCAGGCGATCGTTAACTT | Reverse primer used in the qPCR reaction for Gdh |
Microorganisms | Carbon/Nitrogen Source | ALA Production (µM) | References |
---|---|---|---|
Synechocystis ΔGdc | Glucose | 0.055 | This study |
Synechocystis ΔGdc | Glutamate | 0.044 | This study |
Chlorella vulgaris | CO2 | 1400 | [23] |
Agmemnellum quadruplicatum | Glutamate | 0.225 | [15] |
Chlorella regularis | Glucose and yeast extract | 3860 | [45] |
Anacystis nidulans | Glutamate | 0.38 | [46] |
Rhodobacter sphaeroides | Succinate and glycine | 0.75 | [46] |
Rhodopseudomonas palustris KG31 | Glutamate and acetate | 180 | [40] |
Genotype | Source or Reference | |
---|---|---|
Strains | ||
E. coli DH5α | F-φ80lacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk-, mk+), phoA supE44, λ-, thi-1, gyrA96, relA1 | Stored in lab |
Synechocystis PCC6803 | Wild-type, naturally transformable | Pasteur culture collection |
ΔGdc | Synechocystis with Gdc disrupted by the KanR cassette | Synechocystis strain generated in this work |
Plasmids | ||
pGEM®-T easy | Cloning vector, AmpR, lacZ, 3′-A overhangs, mcr | Promega |
pGdc | pGEM®-T easy vector containing Gdc | This study |
pGdckan | pGEM®-T easy vector containing Gdc disrupted by the KanR cassette | This study |
pUC4K | Source of the KanR cassette | Amersham |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kanwal, S.; De-Eknamkul, W. A Non-functional γ-Aminobutyric Acid Shunt Pathway in Cyanobacterium Synechocystis sp. PCC 6803 Enhances δ-Aminolevulinic Acid Accumulation under Modified Nutrient Conditions. Int. J. Mol. Sci. 2023, 24, 1213. https://doi.org/10.3390/ijms24021213
Kanwal S, De-Eknamkul W. A Non-functional γ-Aminobutyric Acid Shunt Pathway in Cyanobacterium Synechocystis sp. PCC 6803 Enhances δ-Aminolevulinic Acid Accumulation under Modified Nutrient Conditions. International Journal of Molecular Sciences. 2023; 24(2):1213. https://doi.org/10.3390/ijms24021213
Chicago/Turabian StyleKanwal, Simab, and Wanchai De-Eknamkul. 2023. "A Non-functional γ-Aminobutyric Acid Shunt Pathway in Cyanobacterium Synechocystis sp. PCC 6803 Enhances δ-Aminolevulinic Acid Accumulation under Modified Nutrient Conditions" International Journal of Molecular Sciences 24, no. 2: 1213. https://doi.org/10.3390/ijms24021213
APA StyleKanwal, S., & De-Eknamkul, W. (2023). A Non-functional γ-Aminobutyric Acid Shunt Pathway in Cyanobacterium Synechocystis sp. PCC 6803 Enhances δ-Aminolevulinic Acid Accumulation under Modified Nutrient Conditions. International Journal of Molecular Sciences, 24(2), 1213. https://doi.org/10.3390/ijms24021213