Next Article in Journal
Pharmacological Prevention of Ectopic Erythrophagocytosis by Cilostazol Mitigates Ferroptosis in NASH
Previous Article in Journal
Epigenetic Regulation in Lean Nonalcoholic Fatty Liver Disease
Previous Article in Special Issue
BRAF, TERT and HLA-G Status in the Papillary Thyroid Carcinoma: A Clinicopathological Association Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 16
10.3390/ijms241612858
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

HLA-G Gene Variability Is Associated with Papillary Thyroid Carcinoma Morbidity and the HLA-G Protein Profile

by
Bruna C. Bertol
1,2,*,
Guilherme Debortoli
3,
Fabrício C. Dias
4,
Jéssica N. G. de Araújo
5,
Luana S. M. Maia
4,
Bibiana S. de Almeida
4,
Nathalie L. de Figueiredo-Feitosa
6,
Luiz Carlos C. de Freitas
7,
Erick C. Castelli
8,
Celso T. Mendes-Junior
9,
Vivian N. Silbiger
5,
Léa M. Z. Maciel
6 and
Eduardo A. Donadi
1,4,*
1
Postgraduate Program of Basic and Applied Immunology, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto 14049-900, Brazil
2
Princess Margaret Cancer Centre, University Health Network, Toronto, ON M5G 2M9, Canada
3
Department of Anthropology, University of Toronto at Mississauga, Mississauga, ON L5L 1C6, Canada
4
Division of Clinical Immunology, Department of Medicine, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto 14049-900, Brazil
5
Department of Clinical Analysis and Toxicology, Federal University of Rio Grande do Norte, Natal 59012-570, Brazil
6
Division of Endocrinology and Metabolism, Department of Medicine, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto 14049-900, Brazil
7
Department of Ophthalmology, Otorhinolaryngology and Head and Neck Surgery, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto 14049-900, Brazil
8
Department of Pathology, School of Medicine, São Paulo State University, Botucatu 18618-687, Brazil
9
Departamento de Química, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto 14049-900, Brazil
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(16), 12858; https://doi.org/10.3390/ijms241612858
Submission received: 16 July 2023 / Revised: 7 August 2023 / Accepted: 15 August 2023 / Published: 16 August 2023
(This article belongs to the Special Issue Research Advances in Immunogenetics)
Versions Notes

Abstract

:
Human leukocyte antigen (HLA)-G is an immune checkpoint molecule that is highly expressed in papillary thyroid carcinoma (PTC). The HLA-G gene presents several functional polymorphisms distributed across the coding and regulatory regions (5′URR: 5′ upstream regulatory region and 3′UTR: 3′ untranslated region) and some of them may impact HLA-G expression and human malignancy. To understand the contribution of the HLA-G genetic background in PTC, we studied the HLA-G gene variability in PTC patients in association with tumor morbidity, HLA-G tissue expression, and plasma soluble (sHLA-G) levels. We evaluated 185 PTC patients and 154 healthy controls. Polymorphic sites defining coding, regulatory and extended haplotypes were characterized by sequencing analyses. HLA-G tissue expression and plasma soluble HLA-G levels were evaluated by immunohistochemistry and ELISA, respectively. Compared to the controls, the G0104a(5′URR)G*01:04:04(coding)UTR-03(3’UTR) extended haplotype was underrepresented in the PTC patients, while G0104a(5′URR)G*01:04:01(coding)UTR-03(3′UTR) was less frequent in patients with metastatic and multifocal tumors. Decreased HLA-G tissue expression and undetectable plasma sHLA-G were associated with the G010102a(5′URR)G*01:01:02:01(coding)UTR-02(3′UTR) extended haplotype. We concluded that the HLA-G variability was associated with PTC development and morbidity, as well as the magnitude of the encoded protein expression at local and systemic levels.

1. Introduction

Thyroid cancer (TC) is the most common endocrine malignancy, and its incidence has markedly increased during the past few decades [1]. Differentiated thyroid carcinomas (DTCs) are the most frequent ones, originating from thyroid follicular cells. Among DTCs, papillary thyroid carcinoma (PTC) comprises about 80% of cases [2]. Although the majority of PTC patients present a good prognosis when adequately treated with the standard therapy (i.e., surgery and selective use of radioactive iodine (RAI)) [3], some patients present an aggressive tumor behavior [4]. Due to the frequent inconclusive diagnosis of TC, a substantial number of people undergo unnecessary partial or total thyroidectomy, with them being exposed to an avoidable risk [5].
Over the past two decades, considerable progress has been made in the understanding of the molecular mechanisms associated with DTC development. The elucidation of genetic and epigenetic events affecting key signaling pathways, such as the mitogen-activated protein kinase (MAPK) pathway, and the role of these mediators in thyroid carcinogenesis has brought beneficial clinical management to DTC patients [6]. More recently, the development of kinase inhibition-based therapies, which allow for the targeting of tumor cells, are considered a novel tool for personalized medicine in TC [7]. Despite this progress, there are still limitations concerning the detection of malignant cases and the prediction of unfavorable outcomes [4]. Studies on TC have reported several candidate genes, including those associated with the regulation of inflammation and the immune response [8].
Human leucocyte antigen-G (HLA-G) is a unique non-classical immunomodulatory major histocompatibility complex (MHC) class Ib molecule [9] that is physiologically expressed in the thymus, cornea, pancreas, erythroid and endothelial precursors, and in trophoblastic cells at the maternal–fetal interface. In pathological conditions, HLA-G is expressed in a great number of tumors [10], particularly in PTC [11,12]. The mechanisms that stimulate HLA-G expression in the context of cancer are complex, depending on the individual’s genetic background [13] and various environmental factors such as hypoxia, stress, hormones, and specific cytokines [14]. HLA-G expression in tumor cells is deleterious to the host because of its interaction with leukocyte receptors, particularly ILT-2 and ILT-4, which downregulate the cytotoxic activity of CD8+ T and natural killer (NK) cells and inhibit antigen presentation, lymphocyte proliferation, and antibody formation [15,16]. Alternative splicing membrane-bound (HLA-G1, -G2, -G3, and -G4) and soluble (HLA-G5, -G6, and -G7) HLA-G isoforms may also present immunomodulatory properties [17].
The main feature that distinguishes HLA-G from classical class I genes is the limited variability at the coding region. The overall structure of the HLA-G alleles has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or are observed in introns [18]. Currently, 117 alleles encoding 38 different proteins have been reported by the International Immunogenetics Database (IMGT, 3.52.0) [19,20,21]. Nucleotide/amino acid variability at the coding region may produce conformational changes in the molecule, which may modify its principal functions, i.e., interaction with cell receptors, isoform production, modulation of the immune response, and the ability to couple peptides [13]. On the other hand, nucleotide variability at the HLA-G regulatory regions (5′ upstream regulatory region: 5′URR and 3′ untranslated region: 3′UTR) may potentially influence the targeting of transcriptional and post-transcriptional elements, affecting the HLA-G gene and protein expression [22,23]. Accordingly, these variation sites along the HLA-G gene have been reported in pre-eclampsia [24], cancer [25,26], transplants [27], and autoimmune [28,29], chronic inflammatory [30], and infectious disorders [31,32]. In some of these conditions, the HLA-G gene variability potentially affected the magnitude of HLA-G expression [23,33,34].
Considering that (i) HLA-G is a well-recognized immune checkpoint molecule [9], (ii) HLA-G is expressed in several thyroidal disorders, especially in PTC, but it is not in histologically normal thyroid specimens [12], (iii) the HLA-G gene has several nucleotide variation sites at the regulatory regions that have been associated with the magnitude of molecule production [18], and (iv) the study of the HLA-G variation sites in PTC has mostly focused at the 3′UTR of the gene [35], we evaluated the complete HLA-G gene variability (5′URR, coding, 3′UTR, and extended haplotypes) in PTC patients in association with the clinical, histopathological, and tumor features and with the HLA-G protein expression profile. We identified HLA-G-specific regions and/or extended haplotypes associated with: (i) PTC histological and prognosis features, (ii) HLA-G expression in tumor specimens, and (iii) soluble plasma HLA-G detection before thyroidectomy.

2. Results

2.1. HLA-G Gene Variability in PTC Patients and Control Subjects

For HLA-G gene nucleotide variability analyses, we evaluated 151 PTC patients and 154 unrelated healthy controls from the same geographical region. All detected HLA-G polymorphic sites fit the Hardy–Weinberg expectations and present strong linkage disequilibrium (LD) (p < 0.05), indicating that the alleles do not segregate randomly, justifying the haplotype inferences. Association analyses were conducted considering the three major HLA-G gene segments, taken individually (5′URR, coding, and 3’UTR) (Table S1), and as extended (5′URR/coding/3′UTR) haplotypes (Table 1).
Considering the HLA-G 5′URR, 19 different haplotypes were found, 14 in PTC patients and 17 in the controls. The G010102a haplotype was the most frequent (32.95%), followed by G010101a (21.15%) in the total population. Compared to the control group, the frequency of the G0104a haplotype was underrepresented in PTC patients (odds ratio (OR) = 0.5273, 95% confidence interval (95% CI) = 0.3221–0.8632, p = 0.0109).
Twenty-three different HLA-G coding region haplotypes were observed for the whole group of individuals, of which 17 were observed among the PTC patients and 20 were observed among the controls. In total, the G*01:01:01:01 haplotype was the most frequent (20.66%), followed by G*01:01:02:01 (17.21%). PTC patients presented a lower frequency of the G*01:04:04 haplotype when compared to the controls (OR = 0.4488, 95% CI = 0.2221–0.9068, p = 0.0285).
A total of 14 different HLA-G 3′UTR haplotypes were identified, 10 in the PTC group and 13 in the control group, of which UTR-02 and UTR-01 haplotypes were the most frequent in the whole group (28.85% and 22.95%, respectively). In the PTC group, the UTR-01 haplotype was overrepresented (19.48%) (OR = 1.4895, 95% CI = 1.0180–2.1793; p = 0.0433), whereas the UTR-03 haplotype was underrepresented (OR = 0.4917, 95% CI = 0.3016–0.8015, p = 0.0041) when compared to the control group.
We identified 50 different HLA-G extended haplotypes, 32 among the PTC patients and 40 among the controls. The G010101a(5′URR)G*01:01:01:01(coding)UTR-01(3’UTR) haplotype was the most frequent (19.51%), followed by G010102a(5′URR)G*01:01:02:01(coding)UTR-02(3’UTR) (16.23%), considering the total studied group. Compared to the controls, the G0104a(5′URR)G*01:04:04(coding)UTR-03(3’UTR) haplotype was underrepresented in the PTC patients (OR = 0.4488; 95% CI = 0.2221–0.9068; p = 0.0285).

2.2. HLA-G Gene Variability and Histopathological Features of PTC

To assess whether the HLA-G gene variability is associated with histopathological features related to PTC severity and prognosis, we analyzed the whole group of 185 PTC patients from two different geographical regions of Brazil (Table S2 for the HLA-G gene segments individually; Table 2 and Table S3 for the HLA-G extended haplotypes).
Considering the HLA-G 5′URR, the G0104a haplotype was underrepresented among patients presenting tumor multicentricity (OR = 0.3360, 95% CI = 0.1446–0.7810, p = 0.0089) compared to patients without this manifestation. The G*01:01:02:01 and G*01:04:01 coding region haplotypes were more frequently associated with poor incomplete response to therapy (OR = 2.0732; 95% CI = 1.0646–4.0374; p = 0.0392 and OR = 3.2484; 95% CI = 1.1552–9.1345; p = 0.0279, respectively). At the HLA-G 3′UTR segment, the frequency of UTR-02 was increased among patients presenting multicentricity (OR = 1.6759, 95% CI = 1.0616–2.6456, p = 0.0328), whereas the haplotype UTR-03 was less frequent (OR = 0.4106, 95% CI = 0.1912–0.8815, p = 0.0200) in these patients. Finally, the G0104a(5′URR)G*01:04:01(coding)UTR-03(3′UTR) extended haplotype was associated with the absence of multifocal (OR = 0.2842, 95% CI = 0.0821–0.9836, p = 0.0362) and metastatic tumors (OR = 0.2520, 95% CI = 0.0577–1.1015, p = 0.0492); i.e., this extended haplotype protected against these features.

2.3. HLA-G Gene Variability and HLA-G Tumor Expression in PTC

We performed three previous studies concerning HLA-G in PTC: (i) a retrospective study evaluating only the HLA-G tissue expression in a different cohort of patients exhibiting several thyroidal disorders, including PTC (n = 72) [12], (ii) a retrospective study evaluating only the HLA-G 3′UTR segment in the same cohort of patients with different thyroidal disorders [35], and finally (iii) a prospective study using a new enlarged cohort of patients (n = 183) to assess HLA-G together with BRAFV600E and TERT promoter mutations in PTC outcomes [11], markers individually associated with unfavorable tumor features and accelerated progression, remarkably in co-existence [7,11]. In the present study, we took advantage of the previous prospective study regarding HLA-G tissue expression in an increased number of PTC specimens to revisit the influence of the HLA-G gene variability (5′URR, coding, 3′UTR, and 5′URR/coding/3′UTR extended haplotypes) on the magnitude of the encoded protein expression (n = 170) (Table 3 and Table S4).
The HLA-G 5′URR G010101c haplotype was overrepresented in tumors presenting high HLA-G expression (>50% of positive tumor cells in PTC specimens) (OR = 6.3125, 95% CI = 0.8189–48.6592, p = 0.0457), while the coding region G*01:01:02:01 haplotype was associated with low HLA-G expression (≤50%) (OR = 0.4783, 95% CI = 0.2752–0.8311, p = 0.0111). Considering the extended haplotypes, increased HLA-G tumor expression was associated with the G010101c(5′URR)G*01:01:01:05(coding)UTR-04(3′UTR) haplotype (OR = 6.3125, 95% CI = 0.8189–48.6592, p = 0.0457), while the G010102a(5′URR)G*01:01:02:01(coding)UTR-02(3′UTR) haplotype was associated with decreased expression (OR = 0.5113, 95% CI = 0.2913–0.8974, p = 0.0230). However, we should emphasize that the associations with high HLA-G tissue expression (the G010101c haplotype and the extended G010101c(5′URR)G*01:01:01:05(coding)UTR-04(3′UTR) haplotype) exhibited a very broad CI, including the number 1.

2.4. HLA-G Gene Variability and Soluble HLA-G Expression in PTC

A previous study was published evaluating plasma soluble HLA-G (sHLA-G) levels in PTC patients before and after thyroidectomy and the reciprocal influence of HLA-G and cytokines [36] by studying the same cohort of patients evaluated in this series. Thus, we also investigated the influence of the entire HLA-G gene variability on the sHLA-G plasma detection of PTC patients at the pre-thyroidectomy time (n = 84) (Table 4 and Table S5).
The 3′UTR UTR-18 haplotype was overrepresented in PTC patients exhibiting detectable plasma sHLA-G (OR = 12.6848, 95% CI = 0.7030–228.8785, p = 0.0295); however, it is worth mentioning the wide CI of this association, including the number 1. In contrast, the coding region G*01:01:02:01 haplotype (OR = 0.3658, 95% CI = 0.1546–0.8648, p = 0.0228), UTR-02 (OR = 0.4954, 95% CI = 0.2547–0.9636, p = 0.0453) and the G010102a(5′URR)G*01:01:02:01(coding)UTR-02(3′UTR) extended haplotype (OR = 0.3658, 95% CI = 0.1546–0.8648, p = 0.0228) were associated with PTC exhibiting no detectable plasma sHLA-G at the pre-thyroidectomy time.

3. Discussion

Most TCs are differentiated tumors and, therefore, are associated with a low mortality rate [4]. However, 20–30% of these patients develop persistent or recurrent disease, most commonly in association with cervical and locoregional lymph nodes (LNs), requiring additional therapy and surgical intervention, which may increase morbidity [37]. The identification of patients presenting risk factors associated with aggressive disease can guide tumor management and prevent the overtreatment of patients with low-risk tumors [4]. Thus, many studies aiming to understand the role of genetic features in tumorigenesis and their effects on clinical DTC outcomes have so far been conducted to assess pre-operative diagnosis, prognosis, and treatment [38].
HLA-G gene polymorphisms have been studied in several types of human malignancies and have been associated with risk and predictive factors, and most of these studies are limited to evaluating single polymorphisms at the HLA-G regulatory gene segments (i.e., 5′URR and/or 3′UTR) [34]. Although many polymorphic sites along the HLA-G gene are in LD, a single polymorphism or a specific coding region haplotype may be associated with distinct regulatory region haplotypes [39], indicating that the typing of the entire gene is more adequate to investigate the HLA-G gene’s association with human tumors [23]. Indeed, in this study, we evaluated the HLA-G gene regions separately and as extended haplotypes in terms of their association with HLA-G tissue expression, sHLA-G plasma detection, and PTC outcomes.
The neo-expression of HLA-G in human tissues that constitutively do not express the molecule, as is the case of the thyroid, depends on the combination of factors present in the tumor milieu, such as environmental and hormonal factors, as well as genetic factors, including transcription and post-transcriptional factors [14]. These transcriptional and post-transcriptional factors may be differentially affected by the polymorphisms located at the 5′URR and 3′UTR of the HLA-G gene, respectively [9], yielding differential HLA-G expression in physiological and pathological conditions [40]. The HLA-G coding variability may affect the differential pattern of alternative splicing, leukocyte–receptor interaction, and peptide coupling [41,42]. We and other groups have previously reported that HLA-G is commonly expressed in PTC specimens [11,12], while sHLA-G plasma levels are frequently absent or detected at low levels [36,43]. The contrasting profile between the high HLA-G expression in the tumor microenvironment and the low plasma sHLA-G levels in PTC patients is still poorly understood. Both local modulatory factors and individual genetic features may account for the increased expression of HLA-G in the tumor microenvironment.
Undoubtedly, the HLA-G 3′UTR gene segment is the most studied one in terms of disease susceptibility and morbidity, particularly with respect to the presence (insertion or “Ins”) or absence (deletion or “Del”) of a 14-base-pair (14-bp) fragment, in which the 14-bp Del has been associated with increased HLA-G expression, whereas the 14-bp Ins has been associated with decreased HLA-G expression [44]. In this series, we reported that the HLA-G UTR-01 haplotype was overrepresented in PTC patients compared to controls. Since UTR-01 contains the 14-bp Del and is associated with increased sHLA-G levels even in healthy individuals [45,46], patients carrying the UTR-01 haplotype may have an additional risk of PTC development. In contrast, the UTR-03 haplotype that also contains the 14-bp Del was associated with protection against PTC development, as well as the G0104a(5′URR)G*01:04:04(coding)UTR-03(3’UTR) extended haplotype. Considering that the HLA-G 3′UTR and the 5′URR segments present several elements that have been functionally studied, exhibiting potential roles in HLA-G production [40,45], the evaluation of a single polymorphism inside a specific gene region or a single gene region may only explore partial content of the HLA-G and disease association.
With respect to the association of HLA-G variability with clinical features, we observed that PTC patients carrying the (i) 5′URR G0104a haplotype, (ii) 3′UTR UTR-03 haplotype, and (iii) G0104a(5′URR)G*01:04:01(coding)UTR-03(3′UTR) extended haplotype exhibited clinical benefit with respect to PTC development, since their frequencies were underrepresented in patients exhibiting metastatic and multifocal tumors. Cervical lymph node metastases (LNMs) are the main way through which PTC spread cancer cells [47] and present a worse prognosis due to a more frequent recurrence rate [48]. Tumor recurrence in the LNs after primary PTC treatment had an independent and significant negative effect on survival in patients aged over 45 years [47]. Although PTC metastasis is usually uncommon, it is associated with high mortality [49]. Nevertheless, the presence of neck LNM upon diagnosis was one of the most important factors associated with a greater risk of having distant metastases in a Brazilian cohort [50]. Additionally, multicentricity also represents a significant risk factor for disease progression in TC and increases the risk of disease recurrence [51]. In contrast, UTR-02 was associated with a risk of multicentricity, which is in agreement with our previous finding evaluating a smaller cohort of PTC patients [35].
Regarding the association between HLA-G gene variability with HLA-G tissue expression, we observed that the coding G*01:01:02:01 and the 3′UTR UTR-02 haplotypes individually or assembled as the G010102a(5′URR)G*01:01:02:01(coding)UTR-02(3′UTR) extended haplotype exhibited an association with low HLA-G expression in PTC specimens. Individuals carrying UTR-02 have already been described as low sHLA-G producers [46]. In contrast, the 5′URR G010101c haplotype and the G010101c(5′URR)G*01:01:01:05(coding)UTR-04(3′UTR) extended haplotype were associated with greater HLA-G expression in the PTC specimens. While UTR-04 has been associated with intermediate plasma sHLA-G levels in healthy Brazilian and French individuals [45], functional studies have reported that cells transfected with distinct HLA-G 5′URR yielded differential responses in the presence of HLA-G inducers or repressors. For instance, an HLA-G+ cell line (choriocarcinoma JEG-3) transfected with the G010101c haplotype significantly increased the luciferase activity cultured in the presence of interferon (IFN)-β when compared to non-treated transfectants [40]. Therefore, as mentioned previously, distinct HLA-G 5′URR, under the influence of diverse transcription factors may differentially induce gene expression. The balance between transcriptional (primarily acting at the 5′URR segment) and post-transcriptional (primarily acting at the 3′UTR segment) factors present in the PTC microenvironment may determine the magnitude of HLA-G tumor expression, corroborating the need to evaluate the entire gene variability.
Concerning sHLA-G detection, we observed that UTR-18 was associated with detectable sHLA-G, whereas the G010102a(5′URR)G*01:01:02:01(coding)UTR-02(3′UTR) extended haplotype was associated with undetectable sHLA-G expression. The HLA-G UTR-02 haplotype is composed of the 14-bp Ins and +3142G; both variations were previously associated with low mRNA availability and decreased HLA-G expression, whereas the UTR-18 haplotype is composed of the 14-bp Del and +3142C associated with high HLA-G expression [45,52]. Additionally, an HLA-G+ cell line (melanoma FON+) transfected with the G010102a haplotype exhibited the lowest promoter activity among all other 5′URR haplotypes when compared to the empty vector [40].
A recent paper published by our research group characterized the entire HLA-G genetic variability in 4640 individuals from 88 different population samples across the globe from four datasets [53]. The study detected 442 different variants encompassing approximately 7870 nucleotides surrounding the HLA-G locus. These variants are arranged into 514 different coding haplotypes or full-length sequences. According to the study, in terms of global diversity, there are 14 HLA-G alleles with global frequencies higher than 1%: G*01:01:01:01, G*01:01:01:04, G*01:01:01:05, G*01:01:01:06, G*01:01:01:08, G*01:01:02:01, G*01:01:03:03, and G*01:01:22:01 (all of them encoding the G*01:01 protein), G*01:03:01:02 (encoding the G*01:03 protein), G*01:04:01:01, G*01:04:01:02, and G*01:04:04 (encoding the G*01:04 protein), G*01:05N (the null allele), and G*01:06:01:01 (encoding the G*01:06 protein). These alleles represent 91% of all HLA-G sequences detected worldwide, and their frequencies differ in each biogeographic region [53]. All of these HLA-G alleles were found in the present study and represent 96.9% of all detected haplotypes among the Brazilian subjects from the same geographical region.
In our study, three isolated coding region haplotypes were also associated with PTC: (i) the G*01:04:04 haplotype encodes the HLA-G*01:04 molecule and was associated with protection against disease development, (ii) the G*01:01:02:01 (HLA-G*01:01 molecule) and the G*01:04:01 (HLA-G*01:04 molecule) haplotypes were associated with poor biochemical or structural evidence of persistent disease, and (iii) the G*01:01:02:01 (HLA-G*01:01 molecule) haplotype was associated with undetectable sHLA-G. Although the HLA-G molecule may couple peptides in its groove, its major role is the modulation of immune responses through its binding to leukocyte receptors located outside the peptide-binding groove, whose interactive residues are conserved among these molecules [54]. The presence of a few proteins frequently observed worldwide corroborates the role of HLA-G as an immune checkpoint molecule rather than as an antigen-presenting molecule [53]. Thus, three major reasons may account for these associations: (i) a hitchhiking effect due to the LD between HLA-G coding and regulatory regions, (ii) different coding region haplotypes may generate differential alternative splicing mechanisms, yielding distinct HLA-G isoforms, and (iii) different coding region haplotypes (e.g., the G*01:04:01 and G*01:04:04) encoding the same molecule (HLA-G*01:04) may present distinct regulatory region haplotypes [39].
One limitation of the present study is that a few associations exhibited a very broad 95% CI and/or exhibited a 95% CI that includes the number 1, particularly involving less frequent HLA-G haplotypes. In human genetic studies, sample size plays a critical role in conducting reliable analyses of polymorphisms [55]. Thus, the OR and its associated 95% CI are valuable statistical measures to assess the strength and accuracy of associations between variables. These associations suggest that, for those haplotypes, the sample size of the study is not sufficient to produce a tight 95% CI and an OR measure that is truthfully estimated. Consequently, obtaining a sufficiently larger sample size would be necessary for more precise estimations. On the other hand, most of the significant associations presented a narrow 95% CI, a finding that suggests that our sample size is sufficient to produce statistically significant OR measures, supporting the reliability of the present results.
In contrast, using a Brazilian population is an important strength of our study for its remarkable and unique genetic diversity, resulting from miscegenation among Brazilian Native Amerindian, African, and European populations [56]. Genetic studies in a diverse population can uncover unique risk or protective variants that might not be apparent in more homogeneous populations. This knowledge is essential for advancing population medicine and/or personalized medicine, including but not limited to: (i) risk prediction, (ii) disease susceptibility, diagnosis, or prognosis, (iii) drug therapy optimization to increase treatment effectiveness and minimize adverse effects, and (iv) public health strategies for disease prevention and health promotion [57,58]. It is also important to emphasize the regional variations within Brazil. There are ancestry differences between regions since the degree of European, African, and Amerindian contributions are not homogeneous [59], which can have implications for genetic studies. Taking these geographical variations into account improves the relevance and accuracy of our findings since the risk association analysis for PTC development was performed evaluating only a specific Brazilian region.

4. Materials and Methods

4.1. Studied Population

The study was conducted on 185 patients with PTC (age at diagnosis 47.2 ± 15.8 years old; 154 female = 83.2%) submitted to thyroidectomy due to or the suspicion of PTC following the ultrasound-guided fine-needle aspiration (FNA) malignant cytology of the thyroid nodule (V and VI categories; 2017 Bethesda system for reporting thyroid cytopathology) [60]. A total of 34 cases were recruited from the “Hospital Liga Norte Riograndense Contra o Câncer”, Natal-RN, Brazil, and 151 were recruited from “Hospital das Clínicas de Ribeirão Preto”, Ribeirão Preto-SP, Brazil. The patients were followed up during a median period of 67 months (interquartile range, 45.7 to 125.3 months). Disease evolution during the follow-up was monitored by clinical examination, ultrasound imaging, and biochemical measurement of serum thyroglobulin (Tg) and anti-Tg antibody (TgAb) levels.
The cytological and histopathological analyses were performed by experienced pathologists, as well as the tumor node metastasis (TNM) staging classification according to the eighth edition of the American Joint Committee on Cancer (AJCC)/Union for International Cancer Control (UICC), ranging from stages I to IV to predict the risk of mortality from DTC. Overall, the lower the TNM stage, the lesser probability of cancer spread and the lower the risk of mortality [61].
Clinical and histopathological data of all patients (i.e., age at diagnosis, tumor size, histological subtype, tumor invasion, metastasis at diagnosis, multicentricity, extrathyroidal extension, Hashimoto’s thyroiditis, and TNM staging) as well as treatment details, including surgery approach and RAI therapy), are summarized in Table 5.
The individual response to initial conventional therapy of each patient at the last follow-up was assessed according to the criteria proposed by Momesso and Tuttle 2014 [62], adopted by the 2015 American Thyroid Association (ATA) guidelines [4], taking into account patients treated with thyroid lobectomy or total thyroidectomy, accompanied or not by RAI ablation. This assessment is a risk stratification system to predict recurrence/persistence of the disease based on four categories: (i) excellent response (no clinical, biochemical, or structural/imaging evidence of disease), (ii) indeterminate response (nonspecific biochemical or structural findings that require continuous observation), (iii) incomplete biochemical response (abnormal Tg or rising TgAb levels in the absence of localizable disease), and (iv) incomplete structural response (persistent or newly identified loco-regional or distant metastases, exhibiting abnormal Tg or TgAb or not).
A group of 154 unrelated healthy blood donors (aged 34 ± 11; 84 women = 54.6%) with no personal or family history of thyroid diseases and exhibiting negative anti-peroxidase antibodies was recruited from “Hospital das Clínicas de Ribeirão Preto”, Ribeirão Preto-SP, Brazil.
All subjects gave written informed consent to participate in the study, which was approved by local human research ethics committees (processes #18022/2014, and #029/029/2015).

4.2. HLA-G Genotyping

Genomic DNA was extracted from peripheral blood leucocytes using a standard salting out procedure [63]. The HLA-G 5′URR region was amplified by polymerase chain reaction (PCR) using the forward GPROMO.S 5′-ACATTCTAGAAGCTTCACAAGAATG and reverse GPROMO.R 5′-GCCTTGGTGTTCCGTGTCT primers, as previously described [22]. The sequencing was performed using the G-908R 5′-TTCACCTCACAGTTGTAAGTGTTC, G-830F 5′-CACACGGAAACTTAGGGCTACG, G-304R 5′-GCCAAGCGTTCTGTCTCAGTGT, and GPR-247 5′-CTCAAGCGTGGCTCTCAGGGTC primers.
The HLA-G coding region was PCR-amplified using the forward 5′-TAAAGTCCTCGCTCACCCAC and reverse 5′-CACCACCGACCCTGTTAAAG primers, as previously described [42,64], encompassing exon 1 to exon 4 (including introns). The PCR products were directly sequenced using 5′-TAAAGTCCTCGCTCACCCAC, 5′-GGGAAGAGGAGACACGGA, 5′-GGCCTCATAGTCAAAGACAGG, and 5′-CACCACCGACCCTGTTAAAG primers.
The end of the coding region, which covers exons 5 and 6, was amplified along with the 3′UTR segment. DNA amplification was performed using the forward 5′-CCATGAGAGATGCAAAGTGCT and reverse 5′- TCTTCTGATAACACAGGAACTTC primers [64]. The sequencing was performed using the 5′-CCATGAGAGATGCAAAGTGCT, 5′-CCTTTAACAGGGTCGGTGGTGAGG, 5′-TCTTCTGATAACACAGGAACTTC, and 5′-GATTGAAAAGGAGGGAGCT primers.
The sequences were analyzed and compared to the reference sequence recognized by the IMGT, <http://www.ebi.ac.uk/ipd/imgt/hla/> URL (accessed on 10 November 2020). All polymorphisms detected were individually annotated, and haplotypes of each HLA-G region were initially defined. These haplotypes were further used to construct HLA-G extended haplotypes, as previously described [39,53].

4.3. HLA-G Expression

The HLA-G expression in the tumor microenvironment of the PTC specimens was evaluated in the same series of patients using an immunohistochemical assay as previously described [11]. In short, we used the primary monoclonal antibody (mAb) anti-HLA-G MEM-G/2 (EXBIO, Vestec, Czech Republic) that recognizes all soluble and membrane-bound HLA-G molecules, diluted at 1:100 [64]. From the 185 PTC patients whose DNA was sequenced for HLA-G gene variability in the present study, the HLA-G expression in the tumor was available for 170. According to the percentage of stained tumor cells, HLA-G expression was stratified into two categories: low expression (≤50% of positive tumor cells in the PTC specimens) and high expression (>50% of positive tumor cells in the PTC specimens).
Plasma sHLA-G levels were previously evaluated in the same series of PTC patients before thyroidectomy to evaluate its relationship with several cytokines [36]. We detected sHLA-G levels by using a specific sandwich ELISA [45], using MEM-G/9 mouse anti-human HLA-G mAb (1:100, EXBIO, Praha, Czech Republic) as the capture antibody and rabbit anti-human β2-microglobulin (1:10.000, DAKO, Santa Clara, CA, USA) as the detection antibody. From the 185 PTC studied patients, soluble HLA-G levels were available for 84. Samples with sHLA-G levels below the detection limit were conventionally expressed as 0 ng/mL and categorically stratified into two categories: undetectable (0 ng/mL) or detectable sHLA-G levels.

4.4. Statistical Analysis

The LD among polymorphic sites at the HLA-G gene was evaluated by Haploview® 4.2 the program [65]. Given the positive LD between the polymorphic sites, but unknown gametic phase, the PHASE algorithm [66] was used to infer the most likely haplotypes for each sample. Adherences of genotypic proportions to expectations under the Hardy–Weinberg equilibrium were tested by the exact test of Guo and Thompson [67] using ARLEQUIN 3.5 [68]. A two-tailed Fisher’s exact test was used for all comparisons, and OR and 95% CI were estimated. A 5% level of significance (α = 0.05) was considered for rejection of the null hypothesis.

5. Conclusions

The immune checkpoint HLA-G molecule is highly expressed in PTC specimens, although the impact of the HLA-G gene variability on PTC morbidity and/or the regulation of HLA-G expression in PTC was not fully understood until now. Therefore, by evaluating the entire HLA-G gene in PTC patients together with HLA-G expression in tumor specimens and sHLA-G plasma detection, we uncovered important associations between the HLA-G gene, taken as gene segments and/or as extended haplotypes, and: (i) the susceptibility to PTC development, (ii) tumor morbidity, particularly metastatic or multifocal tumors and poor response to conventional therapy, (iii) the magnitude of HLA-G expression in tumor specimens, and (iv) the presence or absence of detectable sHLA-G in pre-thyroidectomy plasma. Although several local and systemic (cytokines, hormones, hypoxia, etc.) factors contribute to both PTC development and HLA-G expression modulation, the associations reported in the present study can have significant implications in the context of PTC outcomes, particularly the identification of specific genetic markers that can serve as potential targets for personalized therapies in the future.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241612858/s1.

Author Contributions

Conceptualization, B.C.B. and E.A.D.; methodology, B.C.B., F.C.D. and E.C.C.; software, G.D., E.C.C. and C.T.M.-J.; validation, G.D., F.C.D. and N.L.d.F.-F.; formal analysis, B.C.B., G.D. and C.T.M.-J.; investigation, B.C.B., J.N.G.d.A., B.S.d.A., N.L.d.F.-F. and V.N.S.; resources, J.N.G.d.A., L.C.C.d.F., N.L.d.F.-F., E.C.C., L.S.M.M., V.N.S. and L.M.Z.M.; data curation, G.D. and N.L.d.F.-F.; writing—original draft preparation, B.C.B.; writing—review and editing, B.C.B. and E.A.D.; visualization, E.A.D.; supervision, L.M.Z.M. and E.A.D.; project administration, L.S.M.M., B.S.d.A., L.C.C.d.F., L.M.Z.M. and E.A.D.; funding acquisition, B.C.B. and E.A.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by São Paulo Research Foundation (FAPESP, grant number #2015/26556-0); Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, grant numbers #457231/2013 and #302060/2019-7), Programa Nacional de Cooperação Acadêmica (PROCAD, grant number #88881-068436/2014-1), and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, grant number #071/2013 and finance code #001).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the local Institutional Ethics Committees: Comitê de Ética em Pesquisa em Seres Humanos do Hospital das Clínicas de Ribeirão Preto e da Faculdade de Medicina de Ribeirão Preto (CEP/HCFMRP), Ribeirão Preto-SP, Brazil (protocol code #18022/2014, date of approval 25 February 2015), and Comitê de Ética em Pesquisa em Seres Humanos da Liga Norte Riograndense Contra o Câncer (CEP/LIGA), Natal-RN, Brazil (protocol code #029/029/2015, date of approval 5 November 2015).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data can be requested from the corresponding authors.

Acknowledgments

We are grateful to all patients who agreed to participate in this study and to the health staff for their assistance with the sample collection. We also thank Flávia Tremeschin de Almeida Vieira, Sandra Silva Rodrigues dos Santos, Gustavo Martelli-Palomino, and Ibrahim Sadissou for their technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Global Burden of Disease Cancer Collaboration. The Global Burden of Cancer 2013. JAMA Oncol. 2015, 1, 505–527. [Google Scholar] [CrossRef] [PubMed]
  2. Kitahara, C.M.; Sosa, J.A. The Changing Incidence of Thyroid Cancer. Nat. Rev. Endocrinol. 2016, 12, 646–653. [Google Scholar] [CrossRef] [PubMed]
  3. Ito, Y.; Jikuzono, T.; Higashiyama, T.; Asahi, S.; Tomoda, C.; Takamura, Y.; Miya, A.; Kobayashi, K.; Matsuzuka, F.; Kuma, K.; et al. Clinical Significance of Lymph Node Metastasis of Thyroid Papillary Carcinoma Located in One Lobe. World J. Surg. 2006, 30, 1821–1828. [Google Scholar] [CrossRef] [PubMed]
  4. Haugen, B.R.; Alexander, E.K.; Bible, K.C.; Doherty, G.M.; Mandel, S.J.; Nikiforov, Y.E.; Pacini, F.; Randolph, G.W.; Sawka, A.M.; Schlumberger, M.; et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid 2016, 26, 1–133. [Google Scholar] [CrossRef]
  5. Belfiore, A.; Rosa, G.L. La Fine-Needle Aspiration Biopsy of the Thyroid. Endocrinol. Metab. Clin. N. Am. 2001, 30, 361–400. [Google Scholar] [CrossRef]
  6. Nikiforov, Y.E. Molecular Analysis of Thyroid Tumors. Mod. Pathol. 2011, 24, S34–S43. [Google Scholar] [CrossRef]
  7. Ratajczak, M.; Gaweł, D.; Godlewska, M. Novel Inhibitor-Based Therapies for Thyroid Cancer—An Update. Int. J. Mol. Sci. 2021, 22, 11829. [Google Scholar] [CrossRef]
  8. Brenner, A.V.; Neta, G.; Sturgis, E.M.; Pfeiffer, R.M.; Hutchinson, A.; Yeager, M.; Xu, L.; Zhou, C.; Wheeler, W.; Tucker, M.A.; et al. Common Single Nucleotide Polymorphisms in Genes Related to Immune Function and Risk of Papillary Thyroid Cancer. PLoS ONE 2013, 8, e57243. [Google Scholar] [CrossRef]
  9. Carosella, E.D.; Rouas-Freiss, N.; Roux, D.T.-L.; Moreau, P.; LeMaoult, J. HLA-G: An Immune Checkpoint Molecule. Adv. Immunol. 2015, 127, 33–144. [Google Scholar] [CrossRef]
  10. Carosella, E.D.; Moreau, P.; LeMaoult, J.; Rouas-Freiss, N. HLA-G: From Biology to Clinical Benefits. Trends Immunol. 2008, 29, 125–132. [Google Scholar] [CrossRef]
  11. Bertol, B.C.; Massaro, J.D.; Debortoli, G.; Santos, A.L.P.; de Araújo, J.N.G.; Giorgenon, T.M.V.; Costa e Silva, M.; de Figueiredo-Feitosa, N.L.; Collares, C.V.A.; de Freitas, L.C.C.; et al. BRAF, TERT and HLA-G Status in the Papillary Thyroid Carcinoma: A Clinicopathological Association Study. Int. J. Mol. Sci. 2023, 24, 12459. [Google Scholar] [CrossRef]
  12. De Figueiredo Feitosa, N.L.; De Oliveira Crispim, J.C.; Zanetti, B.R.; Magalhães, P.K.R.; Soares, C.P.; Soares, E.G.; Neder, L.; Donadi, E.A.; Maciel, L.M.Z. HLA-G Is Differentially Expressed in Thyroid Tissues. Thyroid 2014, 24, 585–592. [Google Scholar] [CrossRef] [PubMed]
  13. Donadi, E.A.; Castelli, E.C.; Arnaiz-Villena, A.; Roger, M.; Rey, D.; Moreau, P. Implications of the Polymorphism of HLA-G on Its Function, Regulation, Evolution and Disease Association. Cell. Mol. Life Sci. 2011, 68, 369–395. [Google Scholar] [CrossRef] [PubMed]
  14. Sheu, J.; Shih, I.M. HLA-G and Immune Evasion in Cancer Cells. J. Formos. Med. Assoc. 2010, 109, 248–257. [Google Scholar] [CrossRef]
  15. Amodio, G.; Sales de Albuquerque, R.; Gregori, S. New Insights into HLA-G Mediated Tolerance. Tissue Antigens 2014, 84, 255–263. [Google Scholar] [CrossRef]
  16. Elliott, R.L. Cancer Immunotherapy “HLA-G an Important Neglected Immunosuppressive Molecule”. SOJ Immunol. 2016, 4, 2–4. [Google Scholar] [CrossRef]
  17. Paul, P.; Adrian Cabestre, F.; Ibrahim, E.C.; Lefebvre, S.; Khalil-Daher, I.; Vazeux, G.; Moya Quiles, R.M.; Bermond, F.; Dausset, J.; Carosella, E.D. Identification of HLA-G7 as a New Splice Variant of the HLA-G MRNA and Expression of Soluble HLA-G5, -G6, and -G7 Transcripts in Human Transfected Cells. Hum. Immunol. 2000, 61, 1138–1149. [Google Scholar] [CrossRef] [PubMed]
  18. Castelli, E.C.; Veiga-Castelli, L.C.; Yaghi, L.; Moreau, P.; Donadi, E.A. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene. J. Immunol. Res. 2014, 2014, 734068. [Google Scholar] [CrossRef] [PubMed]
  19. Robinson, J.; Halliwell, J.A.; Hayhurst, J.D.; Flicek, P.; Parham, P.; Marsh, S.G.E. The IPD and IMGT/HLA Database: Allele Variant Databases. Nucleic Acids Res. 2015, 43, D423–D431. [Google Scholar] [CrossRef]
  20. Robinson, J.; Barker, D.J.; Georgiou, X.; Cooper, M.A.; Flicek, P.; Marsh, S.G.E. IPD-IMGT/HLA Database. Nucleic Acids Res. 2020, 48, D948–D955. [Google Scholar]
  21. Marsh, S.G.E.; Albert, E.D.; Bodmer, W.F.; Bontrop, R.E.; Dupont, B.; Erlich, H.A.; Fernández-Viña, M.; Geraghty, D.E.; Holdsworth, R.; Hurley, C.K.; et al. Nomenclature for Factors of the HLA System, 2010. Tissue Antigens 2010, 75, 291–455. [Google Scholar] [CrossRef]
  22. Castelli, E.C.; Mendes-Junior, C.T.; Veiga-Castelli, L.C.; Roger, M.; Moreau, P.; Donadi, E.A. A Comprehensive Study of Polymorphic Sites along the HLA-G Gene: Implication for Gene Regulation and Evolution. Mol. Biol. Evol. 2011, 28, 3069–3086. [Google Scholar] [CrossRef]
  23. Dias, F.C.; Castelli, E.C.; Collares, C.V.A.; Moreau, P.; Donadi, E.A. The Role of HLA-G Molecule and HLA-G Gene Polymorphisms in Tumors, Viral Hepatitis, and Parasitic Diseases. Front. Immunol. 2015, 6, 9. [Google Scholar] [CrossRef]
  24. Tan, C.Y.; Ho, J.F.V.; Chong, Y.S.; Loganath, A.; Chan, Y.H.; Ravichandran, J.; Lee, C.G.; Chong, S.S. Paternal Contribution of HLA-G*0106 Significantly Increases Risk for Pre-Eclampsia in Multigravid Pregnancies. Mol. Hum. Reprod. 2008, 14, 317–324. [Google Scholar] [CrossRef]
  25. Silva, I.D.; Muniz, Y.C.N.; Sousa, M.C.P.S.; Silva, K.R.; Castelli, E.C.; Filho, J.C.G.; Osta, A.P.; Lima, M.I.M.; Simões, R.T. HLA-G 3′UTR Polymorphisms in High Grade and Invasive Cervico-Vaginal Cancer. Hum. Immunol. 2013, 74, 452–458. [Google Scholar] [CrossRef]
  26. Ouni, N.; Chaaben, A.B.; Kablouti, G.; Ayari, F.; Douik, H.; Abaza, H.; Gara, S.; Elgaaied-Benammar, A.; Guemira, F.; Tamouza, R. The Impact of HLA-G 3′UTR Polymorphisms in Breast Cancer in a Tunisian Population. Immunol. Investig. 2019, 48, 521–532. [Google Scholar] [CrossRef]
  27. Di Cristofaro, J.; Reynaud-Gaubert, M.; Carlini, F.; Roubertoux, P.; Loundou, A.; Basire, A.; Frassati, C.; Thomas, P.; Gomez, C.; Picard, C. HLA-G∗01:04-UTR3 Recipient Correlates with Lower Survival and Higher Frequency of Chronic Rejection after Lung Transplantation. Am. J. Transplant. 2015, 15, 2413–2420. [Google Scholar] [CrossRef]
  28. de Albuquerque, R.S.; Mendes-Junior, C.T.; Lucena-Silva, N.; da Silva, C.L.L.; Rassi, D.M.; Veiga-Castelli, L.C.; Foss-Freitas, M.C.; Foss, M.C.; Deghaide, N.H.S.; Moreau, P.; et al. Association of HLA-G 3’ Untranslated Region Variants with Type 1 Diabetes Mellitus. Hum. Immunol. 2016, 77, 358–364. [Google Scholar] [CrossRef]
  29. Catamo, E.; Addobbati, C.; Segat, L.; Sotero Fragoso, T.; Tavares Dantas, A.; de Ataide Mariz, H.; Ferreira da Rocha Junior, L.; Branco Pintoduarte, A.L.; Coelho, A.V.C.; de Moura, R.R.; et al. Comprehensive Analysis of Polymorphisms in the HLA-G 5′ Upstream Regulatory and 3′ Untranslated Regions in Brazilian Patients with Systemic Lupus Erythematosus. Tissue Antigens 2015, 85, 458–465. [Google Scholar] [CrossRef]
  30. Alves, C.C.; Arruda, L.K.P.; Oliveira, F.R.; Massaro, J.D.; Aquino, B.J.; Paz, M.A.; Castelli, E.C.; Mendes-Junior, C.T.; Donadi, E.A. Human Leukocyte Antigen-G 3’ Untranslated Region Polymorphisms Are Associated with Asthma Severity. Mol. Immunol. 2018, 101, 500–506. [Google Scholar] [CrossRef]
  31. Catamo, E.; Zupin, L.; Freato, N.; Polesello, V.; Celsi, F.; Crocè, S.L.; Masutti, F.; Pozzato, G.; Segat, L.; Crovella, S. HLA-G Regulatory Polymorphisms Are Associated with Susceptibility to HCV Infection. HLA Immune Response Genet. 2017, 89, 135–142. [Google Scholar] [CrossRef]
  32. Courtin, D.; Milet, J.; Sabbagh, A.; Massaro, J.D.; Castelli, E.C.; Jamonneau, V.; Bucheton, B.; Sese, C.; Favier, B.; Rouas-Freiss, N.; et al. HLA-G 3’ UTR-2 Haplotype Is Associated with Human African Trypanosomiasis Susceptibility. Infect. Genet. Evol. 2013, 17, 1–7. [Google Scholar] [CrossRef]
  33. Ramos, C.S.; Gonçalves, A.S.; Marinho, L.C.; Gomes Avelino, M.A.; Saddi, V.A.; Lopes, A.C.; Simões, R.T.; Wastowski, I.J. Analysis of HLA-G Gene Polymorphism and Protein Expression in Invasive Breast Ductal Carcinoma. Hum. Immunol. 2014, 75, 667–672. [Google Scholar] [CrossRef]
  34. Zhang, Y.; Yu, S.; Han, Y.; Wang, Y.; Sun, Y. Human Leukocyte Antigen-G Expression and Polymorphisms Promote Cancer Development and Guide Cancer Diagnosis/Treatment (Review). Oncol. Lett. 2017, 15, 699–709. [Google Scholar] [CrossRef]
  35. De Figueiredo-feitosa, N.L.; Palomino, G.M.; Alves, D.C.; Junior, T.M.; Donadi, E.A.; Maciel, L.M.Z. HLA-G 3’ Untranslated Region Polymorphic Sites Associated with Increased HLA-G Production Are More Frequent in Patients Exhibiting Differentiated Thyroid Tumors. Clin. Endocrinol. 2016, 86, 597–605. [Google Scholar] [CrossRef]
  36. Bertol, B.C.; de Araújo, J.N.G.; Sadissou, I.A.; Sonon, P.; Dias, F.C.; Bortolin, R.H.; de Figueiredo-Feitosa, N.L.; Conti de Freitas, L.C.; de Miranda Henrique Tarrapp, S.R.; de Oliveira Ramos, C.C.; et al. Plasma Levels of Soluble HLA-G and Cytokines in Papillary Thyroid Carcinoma before and after Thyroidectomy. Int. J. Clin. Pract. 2020, 74, e13585. [Google Scholar] [CrossRef]
  37. Mazzaferri, E.L.; Jhiang, S.M. Long-Term Impact of Initial Surgical and Medical Therapy on Papillary and Follicular Thyroid Cancer. Am. J. Med. 1994, 97, 418–428. [Google Scholar] [CrossRef]
  38. Zolotov, S. Genetic Testing in Differentiated Thyroid Carcinoma: Indications and Clinical Implications. Rambam Maimonides Med. J. 2016, 7, e0009. [Google Scholar] [CrossRef]
  39. Castelli, E.C.; Gerasimou, P.; Paz, M.A.; Ramalho, J.; Porto, I.O.P.; Lima, T.H.A.; Souza, A.S.; Veiga-castelli, L.C.; Collares, C.V.A.; Donadi, E.A.; et al. HLA-G Variability and Haplotypes Detected by Massively Parallel Sequencing Procedures in the Geographicaly Distinct Population Samples of Brazil and Cyprus. Mol. Immunol. 2017, 83, 115–126. [Google Scholar] [CrossRef]
  40. Dias, F.C.; Bertol, B.C.; Poras, I.; Souto, B.M.; Mendes-Junior, C.T.; Castelli, E.C.; Gineau, L.; Sabbagh, A.; Rouas-Freiss, N.; Carosella, E.D.; et al. The Genetic Diversity within the 1.4 Kb HLA-G 5′ Upstream Regulatory Region Moderately Impacts on Cellular Microenvironment Responses. Sci. Rep. 2018, 8, 5652. [Google Scholar] [CrossRef]
  41. Rousseau, P.; Le Discorde, M.; Mouillot, G.; Marcou, C.; Carosella, E.D.; Moreau, P. The 14 Bp Deletion-Insertion Polymorphism in the 3′ UT Region of the HLA-G Gene Influences HLA-G MRNA Stability. Hum. Immunol. 2003, 64, 1005–1010. [Google Scholar] [CrossRef]
  42. Castelli, E.C.; Mendes-Junior, C.T.; Deghaide, N.H.S.; de Albuquerque, R.S.; Muniz, Y.C.N.; Simões, R.T.; Carosella, E.D.; Moreau, P.; Donadi, E.A. The Genetic Structure of 3’untranslated Region of the HLA-G Gene: Polymorphisms and Haplotypes. Genes Immun. 2010, 11, 134–141. [Google Scholar] [CrossRef]
  43. Akin, M.; Aral, L.A.; Yavuz, A.; Karaback, H.; Dikmen, K.; Bostanci, H. Plasma Human Leukocyte Antigen-G (HLA-G) in Patients with Thyroid Cancer. Turkish J. Med. Sci. 2017, 47, 1263–1266. [Google Scholar] [CrossRef]
  44. de Almeida, B.S.; Muniz, Y.C.N.; Prompt, A.H.; Castelli, E.C.; Mendes-Junior, C.T.; Donadi, E.A. Genetic Association between HLA-G 14-Bp Polymorphism and Diseases: A Systematic Review and Meta-Analysis. Hum. Immunol. 2018, 79, 724–735. [Google Scholar] [CrossRef]
  45. Martelli-Palomino, G.; Pancotto, J.A.; Muniz, Y.C.; Mendes-Junior, C.T.; Castelli, E.C.; Massaro, J.D.; Krawice-Radanne, I.; Poras, I.; Rebmann, V.; Carosella, E.D.; et al. Polymorphic Sites at the 3’ Untranslated Region of the HLA-G Gene Are Associated with Differential HLA-G Soluble Levels in the Brazilian and French Population. PLoS ONE 2013, 8, e71742. [Google Scholar] [CrossRef]
  46. Di Cristofaro, J.; El Moujally, D.; Agnel, A.; Mazières, S.; Cortey, M.; Basire, A.; Chiaroni, J.; Picard, C. HLA-G Haplotype Structure Shows Good Conservation between Different Populations and Good Correlation with High, Normal and Low Soluble HLA-G Expression. Hum. Immunol. 2013, 74, 203–206. [Google Scholar] [CrossRef]
  47. Lin, J. Der Papillary Thyroid Carcinoma with Lymph Node Metastases. Growth Factors 2007, 25, 41–49. [Google Scholar] [CrossRef]
  48. Maksimovic, S.; Jakovljevic, B.; Gojkovic, Z. Lymph Node Metastases Papillary Thyroid Carcinoma and Their Importance in Recurrence of Disease. Med. Arch. 2018, 72, 108–111. [Google Scholar] [CrossRef]
  49. Kwong, N.; Marqusee, E.; Gordon, M.S.; Larsen, P.R.; Garber, J.R.; Kim, M.I.; Alexander, E.K. Long-Term, Treatment-Free Survival in Select Patients with Distant Metastatic Papillary Thyroid Cancer. Endocr. Connect. 2014, 3, 207–214. [Google Scholar] [CrossRef]
  50. Barbosa, M.P.; Momesso, D.; Bulzico, D.A.; Farias, T.; Dias, F.; Lima, R.A.; Corbo, R.; Vaisman, M.; Vaisman, F. Metastatic Lymph Node Characteristics as Predictors of Recurrence/Persistence in the Neck and Distant Metastases in Differentiated Thyroid Cancer. Arch. Endocrinol. Metab. 2017, 61, 584–589. [Google Scholar] [CrossRef]
  51. Joseph, K.R.; Edirimanne, S.; Eslick, G.D. Multifocality as a Prognostic Factor in Thyrod Cancer: A Meta-Analysis. Int. J. Surg. 2018, 50, 121–125. [Google Scholar] [CrossRef] [PubMed]
  52. Castelli, E.C.; Moreau, P.; Oya e Chiromatzo, A.; Mendes-Junior, C.T.; Veiga-Castelli, L.C.; Yaghi, L.; Giuliatti, S.; Carosella, E.D.; Donadi, E.A. In Silico Analysis of MicroRNAS Targeting the HLA-G 3’ Untranslated Region Alleles and Haplotypes. Hum. Immunol. 2009, 70, 1020–1025. [Google Scholar] [CrossRef] [PubMed]
  53. Castelli, E.C.; de Almeida, B.S.; Muniz, Y.C.N.; Silva, N.S.B.; Passos, M.R.S.; Souza, A.S.; Page, A.E.; Dyble, M.; Smith, D.; Aguileta, G.; et al. HLA-G Genetic Diversity and Evolutive Aspects in Worldwide Populations. Sci. Rep. 2021, 11, 23070. [Google Scholar] [CrossRef] [PubMed]
  54. Arns, T.; Antunes, D.A.; Abella, J.R.; Rigo, M.M.; Kavraki, L.E.; Giuliatti, S.; Donadi, E.A. Structural Modeling and Molecular Dynamics of the Immune Checkpoint Molecule HLA-G. Front. Immunol. 2020, 11, 575076. [Google Scholar] [CrossRef]
  55. Maleki, F.; Ovens, K.; McQuillan, I.; Kusalik, A.J. Size Matters: How Sample Size Affects the Reproducibility and Specificity of Gene Set Analysis. Hum. Genom. 2019, 13, 42. [Google Scholar] [CrossRef] [PubMed]
  56. Pena, S.D.J.; Santos, F.R.; Tarazona-Santos, E. Genetic Admixture in Brazil. Am. J. Med. Genet. Part C Semin. Med. Genet. 2020, 184, 928–938. [Google Scholar] [CrossRef]
  57. Chan, I.S.; Ginsburg, G.S. Personalized Medicine: Progress and Promise. Annu. Rev. Genomics Hum. Genet. 2011, 12, 217–244. [Google Scholar] [CrossRef]
  58. Cooke Bailey, J.N.; Bush, W.S.; Crawford, D.C. Editorial: The Importance of Diversity in Precision Medicine Research. Front. Genet. 2020, 11, 875. [Google Scholar] [CrossRef]
  59. Callegari-Jacques, S.M.; Grattapaglia, D.; Salzano, F.M.; Salamoni, S.P.; Crossetti, S.G.; Ferreira, M.E.; Hutz, M.H. Historical Genetics: Spatiotemporal Analysis of the Formation of the Brazilian Population. Am. J. Hum. Biol. 2003, 15, 824–834. [Google Scholar] [CrossRef]
  60. Cibas, E.S.; Ali, S.Z. The 2017 Bethesda System for Reporting Thyroid Cytopathology. Thyroid 2017, 27, 1341–1346. [Google Scholar] [CrossRef]
  61. Tuttle, R.M.; Haugen, B.; Perrier, N.D. Updated American Joint Committee on Cancer/Tumor-Node-Metastasis Staging System for Differentiated and Anaplastic Thyroid Cancer (Eighth Edition): What Changed and Why? Thyroid 2017, 27, 751–756. [Google Scholar] [CrossRef] [PubMed]
  62. Momesso, D.P.; Tuttle, R.M. Update on Differentiated Thyroid Cancer Staging. Endocrinol. Metab. Clin. N. Am. 2014, 43, 401–421. [Google Scholar] [CrossRef]
  63. Miller, S.A.; Dykes, D.D.; Polesky, H.F. A Simple Salting out Procedure for Extracting DNA from Human Nucleated Cells. Nucleic Acids Res. 1988, 16, 1215. [Google Scholar] [CrossRef]
  64. Bertol, B.C.; Dias, F.C.; Debortoli, G.; Souto, B.M.; Mendonça, P.B.; Araújo, R.C.; Santana, R.C.; Ramalho, L.N.Z.; Castelly, E.C.; Martinelli, A.d.L.C.; et al. HLA-G Liver Expression and HLA-G Extended Haplotypes Are Associated with Chronic Hepatitis C in HIV-Negative and HIV-Coinfected Patients. Clin. Immunol. 2020, 217, 108482. [Google Scholar] [CrossRef] [PubMed]
  65. Barrett, J.C.; Fry, B.; Maller, J.; Daly, M.J. Haploview: Analysis and Visualization of LD and Haplotype Maps. Bioinformatics 2005, 21, 263–265. [Google Scholar] [CrossRef]
  66. Stephens, M.; Donnelly, P. A Comparison of Bayesian Methods for Haplotype Reconstruction from Population Genotype Data. Am. J. Hum. Genet. 2003, 73, 1162–1169. [Google Scholar] [CrossRef]
  67. Guo, S.W.; Thompson, E.A. Performing the Exact Test of Hardy-Weinberg Proportion for Multiple Alleles. Biometrics 1992, 48, 361–372. [Google Scholar] [CrossRef]
  68. Excoffier, L.; Lischer, H.E.L. Arlequin Suite Ver 3.5: A New Series of Programs to Perform Population Genetics Analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
Table 1. HLA-G extended haplotypes in papillary thyroid carcinoma (PTC) patients and control subjects.
Table 1. HLA-G extended haplotypes in papillary thyroid carcinoma (PTC) patients and control subjects.
HLA-G Extended HaplotypesTotal
n = 305		Controls
n = 154		PTC Patients
n = 151		OR95% CIp
5′URRCoding3′UTRnFreq.nFreq.nFreq.
1G010101aG*01:01:01:01UTR-011190.1951530.1721660.21851.34550.8997–2.01240.1538
2G010102aG*01:01:02:01UTR-02990.1623430.1396560.18541.40290.9093–2.16450.1532
3G0104aG*01:04:01UTR-03390.0639240.0779150.04970.61850.3179–1.20340.1858
4G0104aG*01:04:04UTR-03380.0623260.0844120.03970.44880.2221–0.90680.0285
5G010101bG*01:01:01:05UTR-04360.0590180.0584180.05961.02110.5207–2.00251.0000
6G010101cG*01:01:01:05UTR-04330.0541180.0584150.04970.84200.4163–1.70310.7214
7G010102aG*01:06UTR-02310.0508190.0617120.03970.62940.3000–1.32030.2692
8G010102aG*01:05NUTR-02260.0426120.0390140.04641.19910.5453–2.63660.6924
9G0103aG*01:03:01:02UTR-05250.0410120.0390130.04301.10960.4980–2.47230.8405
10G010102aG*01:01:03:03UTR-07250.0410130.0422120.03970.93900.4214–2.09221.0000
11G010101fG*01:01:01:04UTR-18180.029590.029290.02981.02050.3995–2.60691.0000
12G010101fG*01:01:01:04UTR-06170.027960.0195110.03641.90260.6946–5.21170.2273
13G0103dG*01:03:01:02UTR-05160.026290.029270.02320.78830.2898–2.14450.8012
14G010101dG*01:01:01:08UTR-01120.019740.013080.02652.06800.6161–6.94130.2579
15G0103eG*01:03:01:02UTR-05110.018040.009770.02321.80340.5225–6.22480.3791
16G010102aG*01:01:22:01UTR-0290.014840.013050.01661.27950.3403–4.81100.7499
17G010101dG*01:01:01:15UTR-0140.006610.003230.00993.08030.3186–29.77840.3689
18G010102aG*01:01:17UTR-0230.004910.003220.00662.04670.1846–22.69030.6207
19G0104bG*01:04:01UTR-0330.004920.006510.00330.50830.0458–5.63531.0000
20G010102dG*01:01:02:01UTR-0230.004910.003220.00662.04670.1846–22.69030.6207
21G010101fG*01:01:01:04UTR-2030.004920.006510.00330.50830.0458–5.63531.0000
22G010101bG*01:01:15compatibleUTR-0620.003300.000020.00665.13310.2454–107.36430.2447
23G010101fG*01:01:01:13UTR-0620.003300.000020.00665.13310.2454–107.36430.2447
24G010101aG*01:01:01:01UTR-0620.003310.003210.00331.01990.0635–16.38061.0000
25G010101aG*01:01:01:06UTR-0420.003320.006500.00000.20260.0097–4.23850.4992
26G0103cG*01:03:01:02UTR-0520.003320.006500.00000.20260.0097–4.23850.4992
27G0103eG*01:03:01:02UTR-1720.003320.006500.00000.20260.0097–4.23850.4992
28G010102aG*01:01:14UTR-0220.003320.006500.00000.20260.0097–4.23850.4992
29G010101aG*01:01:01:04UTR-0620.003320.006500.00000.20260.0097–4.23850.4992
30G010102aG*01:01:02:01UTR-0820.003320.006500.00000.20260.0097–4.23850.4992
31G010101hG*01:01:09(no deletion at +615)UTR-0420.003320.006500.00000.20260.0097–4.23850.4992
32G0103eG*01:03:01:02UTR-0920.003320.006500.00000.20260.0097–4.23850.4992
33G0104aG*01:04:01UTR-1310.001600.000010.00333.06970.1246–75.64910.4951
34G010101gG*01:01:01:01UTR-0110.001600.000010.00333.06970.1246–75.64910.4951
35G010102aG*01:01:02:01(+2798G)UTR-0210.001600.000010.00333.06970.1246–75.64910.4951
36G010101aG*01:01:02:01UTR-0210.001600.000010.00333.06970.1246–75.64910.4951
37G010101aG*01:01:01:04UTR-1810.001600.000010.00333.06970.1246–75.64910.4951
38G010101jG*01:01:01:01UTR-0110.001600.000010.00333.06970.1246–75.64910.4951
39G010101aG*01:01:01:01UTR-0410.001600.000010.00333.06970.1246–75.64910.4951
40G010101bG*01:01:01:05UTR-0110.001600.000010.00333.06970.1246–75.64910.4951
41G010101bG*01:01:01:01UTR-0110.001610.003200.00000.33880.0137–8.35051.0000
42G010101bG*01:01:01:05UTR-0610.001610.003200.00000.33880.0137–8.35051.0000
43G010101iG*01:01:01:01UTR-0110.001610.003200.00000.33880.0137–8.35051.0000
44G010102aG*01:01:02:02UTR-0210.001610.003200.00000.33880.0137–8.35051.0000
45G010102eG*01:01:30:02UTR-4410.001610.003200.00000.33880.0137–8.35051.0000
46G0103aG*01:03:01:02UTR-0910.001610.003200.00000.33880.0137–8.35051.0000
47G010102aG*01:06UTR-0810.001610.003200.00000.33880.0137–8.35051.0000
48G010101aG*01:01:01:05UTR-0410.001610.003200.00000.33880.0137–8.35051.0000
49G010102aG*01:05NUTR-0810.001610.003200.00000.33880.0137–8.35051.0000
50G0104cG*01:04:05compatibleUTR-0310.001610.003200.00000.33880.0137–8.35051.0000
Total [2n]6101.00003081.00003021.0000---
5′URR: 5′ upstream region. 3′UTR: 3′ untranslated region. OR: odds ratio. CI: confidence interval. Freq: frequency. Haplotypes in order of total frequency. Comparisons between PTC patients and controls were made by using Fisher’s exact test, and p-values below 0.05 are highlighted in bold.
Table 2. Association between HLA-G extended haplotypes and histopathological features of PTC (n = 185).
Table 2. Association between HLA-G extended haplotypes and histopathological features of PTC (n = 185).
HLA-G Extended HaplotypesTumor SizeHistological
Subtype ϕ		Tumor InvasionExtrathyroidal
Extension		MulticentricityMetastasis
at Diagnosis		TNM Staging 8th θHashimoto’s
Thyroiditis		Response to
Therapy #
5′URRCoding3′UTR<2 cm
n = 106		≥2 cm
n = 79		Low Risk
n = 152		High Risk
n = 33		Absent
n = 133		Present
n = 52		Absent
n = 134		Present
n = 51		Absent
n = 119		Present
n = 66		Absent
n = 133		Present
n = 52		I
n = 153		II/III/IV
n = 30		Absent
n = 132		Present
n = 53		Complete
n = 111		Incomplete
n = 29
n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)		n
(freq.)
1G010101aG*01:01:01:01UTR-0146
(9.2170)		32
(0.2025)		62
(0.2039)		16
(0.2424)		55
(0.2068)		23
(0.2212)		57
(0.2127)		21
(0.2059)		52
(0.2185)		26
(0.1970)		58
(0.2180)		20
(0.1923)		67
(0.2189)		11
(0.1833)		51
(0.1931)		27
(0.2547)		49
(0.2207)		9
(0.1551)
2G010102aG*01:01:02:01UTR-0239
(0.1840)		28
(0.1772)		54
(0.1776)		13
(0.1969)		48
(0.1805)		19
(0.1827)		50
(0.1866)		17
(0.1667)		40
(0.1681)		27
(0.2045)		47
(0.1767)		20
(0.1923)		53
(0.1732)		13
(0.2166)		52
(0.1969)		15
(0.1415)		37
(0.1666)		16
(0.2758)
3G0104aG*01:04:01UTR-0310
(0.0472)		11
(0.0696)		17
(0.0559)		4
(0.0606)		16
(0.0602)		5
(0.0481)		15
(0.0560)		6
(0.0588)		18 A
(0.0756)		3 A
(0.0227)		19 B
(0.0714)		2 B
(0.0192)		17
(0.0555)		4
(0.0666)		16
(0.0606)		5
(0.0471)		9
(0.0405)		5
(0.0862)
4G0104aG*01:04:04UTR-038
(0.0377)		11
(0.0696)		17
(0.0559)		2
(0.0303)		15
(0.0564)		4
(0.0385)		12
(0.0448)		7
(0.0686)		15
(0.0630)		4
(0.0303)		13
(0.0489)		6
(0.0577)		13
(0.0424)		4
(0.0666)		16
(0.0606)		3
(0.0283)		10
(0.0450)		1
(0.0172)
5G010101bG*01:01:01:05UTR-0410
(0.0472)		9
(0.0570)		15
(0.0493)		4
(0.0606)		13
(0.0489)		6
(0.0577)		15
(0.0560)		4
(0.0392)		10
(0.0420)		9
(0.0682)		16
(0.0602)		3
(0.0288)		18
(0.0588)		1
(0.0166)		15
(0.0568)		4
(0.0377)		13
(0.0585)		3
(0.0517)
6G0103aG*01:03:01:02UTR-0514
(0.0660)		4
(0.0253)		15
(0.0493)		3
(0.0454)		13
(0.0489)		5
(0.0481)		13
(0.0485)		5
(0.0490)		13
(0.0546)		5
(0.0379)		14
(0.0526)		4
(0.0385)		13
(0.0424)		5
(0.0833)		9
(0.0340)		9
(0.0849)		10
(0.0450)		3
(0.0517)
7G010101cG*01:01:01:05UTR-048
(0.0377)		9
(0.0570)		13
(0.0427)		4
(0.0606)		15
(0.0564)		2
(0.0192)		15
(0.0560)		2
(0.0196)		13
(0.0546)		4
(0.0303)		11
(0.0414)		6
(0.0577)		15
(0.0490)		2
(0.0333)		10
(0.0378)		7
(0.0660)		13
(0.0585)		2
(0.0344)
8G010102aG*01:05NUTR-0210
(0.0472)		6
(0.0380)		14
(0.0460)		2
(0.0303)		12
(0.0451)		4
(0.0385)		12
(0.0448)		4
(0.0392)		10
(0.0420)		6
(0.0455)		12
(0.0451)		4
(0.0385)		15
(0.0490)		1
(0.0166)		11
(0.0416)		5
(0.0471)		11
(0.0495)		2
(0.0344)
9G010102aG*01:06UTR-0211
(0.0519)		4
(0.0253)		11
(0.0361)		4
(0.0606)		12
(0.0451)		3
(0.0288)		11
(0.0410)		4
(0.0392)		8
(0.0336)		7
(0.0530)		11
(0.0414)		4
(0.0385)		14
(0.0457)		1
(0.0166)		9
(0.0340)		6
(0.0566)		10
(0.0450)		1
(0.0172)
10G010102aG*01:01:03:03UTR-078
(0.0377)		6
(0.0380)		11
(0.0361)		3
(0.0454)		10
(0.0376)		4
(0.0385)		11
(0.0410)		3
(0.0294)		10
(0.0420)		4
(0.0303)		8
(0.0301)		6
(0.0577)		11
(0.0359)		3
(0.0500)		12
(0.0454)		2
(0.0188)		10
(0.0450)		2
(0.0344)
11G010101fG*01:01:01:04UTR-067
(0.0330)		5
(0.0316)		11
(0.0361)		1
(0.0151)		7
(0.0263)		5
(0.0481)		9
(0.0336)		3
(0.0294)		7
(0.0294)		5
(0.0379)		8
(0.0301)		4
(0.0385)		11
(0.0359)		1
(0.0166)		11
(0.0416)		1
(0.0094)		8
(0.0360)		2
(0.0344)
12G010101fG*01:01:01:04UTR-186
(0.0283)		5
(0.0316)		10
(0.0328)		1
(0.0151)		7
(0.0263)		4
(0.0385)		8
(0.0299)		3
(0.0294)		6
(0.0252)		5
(0.0379)		7
(0.0263)		4
(0.0385)		7
(0.0229)		4
(0.0667)		7
(0.0265)		4
(0.0377)		8
(0.0360)		1
(0.0172)
13G0103eG*01:03:01:02UTR-056
(0.0283)		4
(0.0253)		10
(0.0328)		0
(0.0000)		7
(0.0263)		3
(0.0288)		5
(0.0187)		5
(0.0490)		9
(0.0378)		1
(0.0076)		7
(0.0263)		3
(0.0288)		8
(0.0261)		2
(0.0333)		9
(0.0340)		1
(0.0094)		6
(0.0270)		0
(0.0000)
14G010101dG*01:01:01:08UTR-016
(0.0283)		3
(0.0190)		9
(0.0296)		0
(0.0000)		5
(0.0188)		4
(0.0385)		6
(0.0224)		3
(0.0294)		6
(0.0252)		3
(0.0227)		6
(0.0226)		3
(0.0288)		8
(0.0261)		1
(0.0166)		9
(0.0340)		0
(0.0000)		6
(0.0270)		1
(0.0172)
15G0103dG*01:03:01:02UTR-053
(0.0142)		4
(0.0253)		6
(0.0197)		1
(0.0151)		7
(0.0263)		0
(0.0000)		6
(0.0224)		1
(0.0098)		3
(0.0126)		4
(0.0303)		6
(0.0226)		1
(0.0096)		7
(0.0228)		0
(0.0000)		7
(0.0265)		0
(0.0000)		4
(0.0180)		3
(0.0517)
16G010102aG*01:01:22:01UTR-026
(0.0283)		1
(0.0063)		6
(0.0197)		1
(0.0151)		5
(0.0188)		2
(0.0192)		5
(0.0187)		2
(0.0196)		1
(0.0042)		6
(0.0455)		4
(0.0150)		3
(0.0288)		6
(0.0196)		0
(0.0000)		2
(0.0075)		5
(0.0471)		3
(0.0135)		2
(0.0344)
17G0104bG*01:04:01UTR-033
(0.0142)		2
(0.0127)		5
(0.0164)		0
(0.0000)		3
(0.0113)		2
(0.0192)		3
(0.0112)		2
(0.0196)		3
(0.0126)		2
(0.0152)		3
(0.0113)		2
(0.0192)		5
(0.0163)		0
(0.0000)		2
(0.0075)		3
(0.0283)		0
(0.0000)		1
(0.0172)
Others *11
(0.0519)		14
(0.0885)		18
(0.0581)		7
(0.1058)		16
(0.0602)		9
(0.0864)		15
(0.0560)		10
(0.0980)		14
(0.0588)		11
(0.0836)		16
(0.0602)		9
(0.0864)		18
(0.0588)		7
(0.1164)		16
(0.0597)		9
(0.0846)		15
(0.0675)		4
(0.0688)
5′URR: 5′ upstream region. 3′UTR: 3′ untranslated region. Freq: frequency. Haplotypes in order of total frequency. * Details about the other less frequent HLA-G extended haplotypes are available at Table S3. Association of haplotypes with histopathological features of PTC was made by using Fisher’s exact test, and p-values below 0.05 are highlighted in bold. ϕ Low-risk/more frequent subtypes (classic + follicular) or high-risk/less frequent subtypes (oncocytic, solid, trabecular, and others). θ Information not available for 2 PTC patients (total n = 183). Tumor node metastasis (TNM) system refers to the primary tumor, lymph node metastasis, and distant metastasis. # Information not available for 45 PTC patients (total n = 140). Complete (the sum of patients presenting excellent and indeterminate responses) or incomplete (the sum of patients presenting biochemical and structural incomplete responses). A OR: 0.2842; 95% CI: 0.0821–0.9836; p: 0.0362. B OR: 0.2520; 95% CI: 0.0577–1.1015; p: 0.0492. OR: odds ratio. CI: confidence interval.
Table 3. HLA-G extended haplotypes in papillary thyroid carcinoma (PTC) patients according to the expression of HLA-G in the tumor microenvironment [n = 170].
Table 3. HLA-G extended haplotypes in papillary thyroid carcinoma (PTC) patients according to the expression of HLA-G in the tumor microenvironment [n = 170].
HLA-G Extended Haplotypes HLA-G Tumor Expression #
Low
n = 51		High
n = 119		OR95% CIp
5′URRCoding3′UTRnnFreq.nFreq.
1G010101aG*01:01:01:01UTR-0171190.1863520.21851.22130.6799–2.19360.5620
2G010102aG*01:01:02:01UTR-0264270.2647370.15550.51130.2913–0.89740.0230
3G0104aG*01:04:04UTR-031960.0588130.05460.92440.3413–2.50381.0000
4G0104aG*01:04:01UTR-031780.078490.03780.46180.1729–1.23300.1712
5G010101bG*01:01:01:05UTR-041660.0588100.04200.70180.2480–1.98500.5774
6G0103aG*01:03:01:02UTR-051650.0490110.04620.94010.3181–2.77801.0000
7G010101cG*01:01:01:05UTR-041510.0098140.05886.31250.8189–48.65920.0457
8G010102aG*01:06UTR-021540.0392110.04621.18720.3689–3.82001.0000
9G010102aG*01:05NUTR-021320.0196110.04622.42290.5273–11.13230.3583
10G010102aG*01:01:03:03UTR-071320.0196110.04622.42290.5273–11.13230.3583
11G010101fG*01:01:01:04UTR-061230.029490.03781.29690.3437–4.89271.0000
12G010101fG*01:01:01:04UTR-181130.029480.03361.14780.2982–4.41721.0000
13G010101dG*01:01:01:08UTR-01830.029450.02100.70820.1660–3.02050.7007
14G0103eG*01:03:01:02UTR-05820.019660.02521.29310.2565–6.51711.0000
15G010102aG*01:01:22:01UTR-02700.000070.02946.64150.3757–117.38650.1076
16G0103dG*01:03:01:02UTR-05610.009850.02102.16740.2500–18.78780.6729
17G0104bG*01:04:01UTR-03520.019630.01260.63830.1050–3.87860.6383
24G010101dG*01:01:01:15UTR-01400.000040.01683.93390.2098–73.74220.3207
18G010101fG*01:01:01:04UTR-20200.000020.00842.16700.1031–45.53801.0000
19G010101aG*01:01:01:01UTR-06210.009810.00420.42620.0263–6.88010.5106
20G010102dG*01:01:02:01UTR-02210.009810.00420.42620.0263–6.88010.5106
21G010102aG*01:01:17UTR-02210.009810.00420.42620.0263–6.88010.5106
22G010101bG*01:01:15compatibleUTR-06200.000020.00842.16700.1031–45.53801.0000
23G010101fG*01:01:01:13UTR-06210.009810.00420.42620.0263–6.88010.5106
25G0104aG*01:04:01UTR-13110.009800.00000.14190.0057–3.51170.3000
26G010101gG*01:01:01:01UTR-01110.009800.00000.14190.0057–3.51170.3000
27G010102aG*01:01:02:01(+2798G)UTR-02110.009800.00000.14190.0057–3.51170.3000
28G010101aG*01:01:02:01UTR-02110.009800.00000.14190.0057–3.51170.3000
29G010101jG*01:01:01:01UTR-01100.000010.00421.29470.0523–32.04961.0000
30G010101aG*01:01:01:01UTR-04100.000010.00421.29470.0523–32.04961.0000
31G010101bG*01:01:01:05UTR-01100.000010.00421.29470.0523–32.04961.0000
32G010101hG*01:01:01:06UTR-04100.000010.00421.29470.0523–32.04961.0000
Total [2n]3401021.00002381.0000---
5′URR: 5′ upstream region. 3′UTR: 3′ untranslated region. OR: odds ratio. CI: confidence interval. Freq: frequency. Haplotypes in order of total frequency. Association of haplotypes with HLA-G tumor expression was made by using Fisher’s exact test, and p-values below 0.05 are highlighted in bold. # Low (≤50% of positive tumor cells) or high (>50% of positive tumor cells).
Table 4. HLA-G extended haplotypes in papillary thyroid carcinoma (PTC) patients according to sHLA-G detection in plasma before thyroidectomy [n = 84].
Table 4. HLA-G extended haplotypes in papillary thyroid carcinoma (PTC) patients according to sHLA-G detection in plasma before thyroidectomy [n = 84].
HLA-G Extended Haplotypes sHLA-G
Undetectable
n = 40		Detectable
n = 44		OR95% CIp
5′URRCoding3′UTRnnFreq.nFreq.
1G010102aG*01:01:02:01UTR-0228190.237590.10230.36580.1546–0.86480.0228
2G010101aG*01:01:01:01UTR-0127110.1375160.18181.39390.6043–3.21490.5296
3G0104aG*01:04:01UTR-031030.037570.07952.21810.5535–8.88760.3345
4G0104aG*01:04:04UTR-03850.062530.03410.52940.1223–2.29020.4802
5G010102aG*01:06UTR-02860.075020.02270.28680.0561–1.46410.1528
6G0103aG*01:03:01:02UTR-05820.025060.06822.85370.5590–14.56540.2817
7G010102aG*01:05NUTR-02840.050040.04550.90480.2186–3.74391.0000
8G010101fG*01:01:01:04UTR-06850.062530.03410.52940.1223–2.29020.4802
9G010101bG*01:01:01:05UTR-04740.050030.03410.67060.1454–3.09250.7098
10G010101cG*01:01:01:05UTR-04730.037540.04551.22220.2650–5.63621.0000
11G010102aG*01:01:03:03UTR-07720.025050.05682.34940.4428–12.46410.4470
12G0103eG*01:03:01:02UTR-05730.037540.04551.22220.2650–5.63621.0000
13G010101fG*01:01:01:04UTR-18500.000050.056810.60480.5770–194.90390.0602
14G010101dG*01:01:01:08UTR-01530.037520.02270.59690.0971–3.66710.6698
15G010102aG*01:01:22:01UTR-02520.025030.03411.37650.2240–8.45631.0000
16G0104bG*01:04:01UTR-03530.037520.02270.59690.0971–3.66710.6698
17G0103dG*01:03:01:02UTR-05430.037510.01140.29500.0300–2.89540.3480
18G010102aG*01:01:17UTR-02200.000020.02274.65320.2200–98.40060.4981
19G010101dG*01:01:01:15UTR-01200.000020.02274.65320.2200–98.40060.4981
20G010101fG*01:01:01:04UTR-20110.012500.00000.29940.0120–7.45620.4762
21G010101aG*01:01:01:01UTR-06100.000010.01142.76000.1108–68.72541.0000
22G010102aG*01:01:02:01(+2798G)UTR-02100.000010.01142.76000.1108–68.72541.0000
23G010101aG*01:01:01:04UTR-18100.000010.01142.76000.1108–68.72541.0000
24G010101aG*01:01:01:01UTR-04110.012500.00000.29940.0120–7.45620.4762
25G010101bG*01:01:01:05UTR-01100.000010.01142.76000.1108–68.72541.0000
26G010101hG*01:01:01:06UTR-04100.000010.01142.76000.1108–68.72541.0000
Total [2n]168801.0000881.0000---
5′URR: 5′ upstream region. 3′UTR: 3′ untranslated region. OR: odds ratio. CI: confidence interval. Freq: frequency. Haplotypes in order of total frequency. Association of haplotypes with sHLA-G detection was made by using Fisher’s exact test, and p-values below 0.05 are highlighted in bold.
Table 5. Clinical and histopathological features of the papillary thyroid carcinoma (PTC) patients.
Table 5. Clinical and histopathological features of the papillary thyroid carcinoma (PTC) patients.
n%
Surgical strategy
  Total thyroidectomy18298.4
  Information not available31.6
Radioactive iodine (RAI) ablation
  Yes15282.2
  No3116.7
  Information not available21.1
Tumor size (cm) (mean: 2.14)
  <210657.3
  ≥27942.7
Histological subtype
  Classic9651.9
  Follicular4423.8
  Oncocytic179.2
  Classic and follicular126.5
  Follicular and oncocytic52.7
  Follicular and solid42.2
  Solid31.6
  Trabecular21.1
  Others21.1
Tumor invasion
  Absent13371.9
  Present:5228.1
  Angiolymphatic179.2
  Vascular115.9
  Capsular115.9
  Capsular and vascular31.6
  Angiolymphatic and capsular31.6
  Angiolymphatic and perineural31.6
  Others42.2
Extrathyroidal extension a
  Absent13472.4
  Present5127.6
Multicentricity
  Absent11964.3
  Present6635.7
Metastasis at diagnosis
  Absent13371.9
  Present:5228.1
  Lymph node(s)4725.4
  Lymph node(s) and lung31.6
  Lymph node(s), lung, and bone10.5
  Lung10.5
Hashimoto’s thyroiditis
  Absent13271.4
  Present5328.6
TNM Staging 8th b
  I15382.7
  II2413.0
  III31.6
  IV31.6
  Information not available21.1
Response to therapy c
  Excellent8043.2
  Indeterminate3116.8
  Biochemical incomplete137.0
  Structural incomplete168.6
  Information not available4524.3
a Including minimal (immediate perithyroidal soft tissues or sternothyroid muscle typically detected only microscopically) and extensive (subcutaneous soft tissues, i.e., larynx, trachea, esophagus, or recurrent laryngeal nerve) extrathyroidal extension. b At initial diagnosis. Tumor node metastasis (TNM) system refers to the primary tumor, lymph node metastasis, and distant metastasis. c Classification at the final follow-up.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bertol, B.C.; Debortoli, G.; Dias, F.C.; de Araújo, J.N.G.; Maia, L.S.M.; de Almeida, B.S.; de Figueiredo-Feitosa, N.L.; de Freitas, L.C.C.; Castelli, E.C.; Mendes-Junior, C.T.; et al. HLA-G Gene Variability Is Associated with Papillary Thyroid Carcinoma Morbidity and the HLA-G Protein Profile. Int. J. Mol. Sci. 2023, 24, 12858. https://doi.org/10.3390/ijms241612858

AMA Style

Bertol BC, Debortoli G, Dias FC, de Araújo JNG, Maia LSM, de Almeida BS, de Figueiredo-Feitosa NL, de Freitas LCC, Castelli EC, Mendes-Junior CT, et al. HLA-G Gene Variability Is Associated with Papillary Thyroid Carcinoma Morbidity and the HLA-G Protein Profile. International Journal of Molecular Sciences. 2023; 24(16):12858. https://doi.org/10.3390/ijms241612858

Chicago/Turabian Style

Bertol, Bruna C., Guilherme Debortoli, Fabrício C. Dias, Jéssica N. G. de Araújo, Luana S. M. Maia, Bibiana S. de Almeida, Nathalie L. de Figueiredo-Feitosa, Luiz Carlos C. de Freitas, Erick C. Castelli, Celso T. Mendes-Junior, and et al. 2023. "HLA-G Gene Variability Is Associated with Papillary Thyroid Carcinoma Morbidity and the HLA-G Protein Profile" International Journal of Molecular Sciences 24, no. 16: 12858. https://doi.org/10.3390/ijms241612858

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop