Next Article in Journal
Mouse Models to Examine Differentiated Thyroid Cancer Pathogenesis: Recent Updates
Previous Article in Journal
Molecular Diagnostics, Pathology and Biomarkers of Gastrointestinal Neoplasms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 13
10.3390/ijms241311137
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Multiple cry Genes in Bacillus thuringiensis Strain BTG Suggest a Broad-Spectrum Insecticidal Activity

by
Alexander Arsov
1,
Maria Gerginova
1,
Tsvetelina Paunova-Krasteva
1,
Kaloyan Petrov
2 and
Penka Petrova
1,*
1
Institute of Microbiology, Bulgarian Academy of Sciences, 1113 Sofia, Bulgaria
2
Institute of Chemical Engineering, Bulgarian Academy of Sciences, 1113 Sofia, Bulgaria
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(13), 11137; https://doi.org/10.3390/ijms241311137
Submission received: 5 June 2023 / Revised: 3 July 2023 / Accepted: 4 July 2023 / Published: 6 July 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
The properties of Bacillus thuringiensis strains as a biopesticide with potent action against moths, beetles, and mosquitoes have been known for decades, with individual subspecies showing specific activity against a particular pest. The aim of the present work is to characterize strains that can be used for broad-spectrum pest control in agriculture. Twenty strains of B. thuringiensis were isolated from Bulgarian soil habitats. The strains were screened for genes encoding 12 different crystal (Cry) endotoxins by PCR with specific primer pairs. Seven of the isolates contained cry genes in their genomes. B. thuringiensis strains PL1, PL3, and PL20 contained at least three different cry genes, while B. thuringiensis serovar galleriae BTG contained at least four. Moreover, scanning electron microscopy (SEM) investigation revealed the production of bipyramidal (PL1, PL3, PL20), polygonal (PL1), cubic (BTG), and spherical crystals (BTG and PL20). Potentially containing the most cry genes, the BTG genome was sequenced and annotated. It comprises 6,275,416 base pairs, does not contain plasmids, has a GC content of 35.05%, and contained 7 genes encoding crystal toxins: cry1Ab35, cry1Db, cry1Fb, cry1Ib, cry2Ab, cry8Ea1, and cry9Ba. This unique combination would possibly enable the simultaneous pesticidal action against pest species from orders Lepidoptera, Coleoptera, Diptera, and Hemiptera, as well as class Gastropoda. Whole-genome sequencing provided accurate information about the presence, localization, and classification of Cry toxins in B. thuringiensis BTG, revealing the great potential of the strain for the development of new broad-spectrum bio-insecticides.

1. Introduction

According to the Food and Agriculture Organization of the United Nations (FAO), the world’s agriculture loses between 20% and 40% of its total production due to pest attacks every year. Invasive insects alone cause over USD 70 billion in losses to the global economy [1]. More than 10,000 pest species attack cultivated plants, feed on their above-ground and underground parts, and fatally destroy the crops. Most plant damage is caused by insects and their larvae (moths, whiteflies, beetles, and thrips), nematodes, and slugs. Bacillus thuringiensis, a common soil-dwelling bacterium, has been known for decades as a good option for an environmentally friendly, safe for humans, species-specific, and highly effective pest biocontrol agent [2,3,4,5].
B. thuringiensis was isolated in the early 20th century, first in Japan as a silkworm pathogen, and later by Berliner from the Mediterranean flour moth Anagasta kuehniella in the Thuringia province of Germany [6]. Scientists and farmers quickly saw the potential of the new bacterial species for pest control, and the earliest commercial product to contain it was launched in France in 1938 under the name Sporeine. Increased interest in B. thuringiensis is attributed to Steinhaus, who obtained pure cultures in 1942 and drew attention to their insecticidal potential, followed by the discovery of Angus, who demonstrated that protein crystals formed during sporulation were responsible for the insecticidal action [7].
Toxigenic strains of the species B. thuringiensis contain genes that encode δ-endotoxins, also known as Cry, or crystalline, due to their ability to auto-crystallize in vivo. When ingested by the insect or its larvae, the crystal protoxins are activated by proteases in the digestive system. The active toxins bind to specific receptors on the cells of the midgut, disrupt the membrane transport, and cause the death of the insect or its larvae after 2 to 48 h [8,9,10,11,12]. Currently, two molecular models describe Cry toxins’ insecticidal mechanisms of action: the sequential binding model, which suggests the formation of cell membrane pores, and the signaling pathway model describing a signaling cascade of cell apoptosis induction [13].
B. thuringiensis is a Gram-positive, catalase-positive, oxidase-negative, strictly aerobic bacterium with peritrichous flagella that allow motility. It develops in two life cycles: vegetative growth and sporulation. Cry protein crystals are formed during the sporulation phase [14,15,16,17], which involves seven distinct stages: (1) axial filament formation; (2) formation of the pre-spore septum; (3) parasporin crystals and pre-spore formation; (4–6) formation of exospores, development of the primary cell wall and transformation of spore nucleoids; (7) spore maturation and cell lysis [8]. Crystals are synthesized after the second stage of sporulation and accumulate in the cell, where they can represent up to 30% of the dry weight of sporulated cells [18]. The shapes of the parasporal crystals can be bipyramidal, pyramidal, cubic, flat rhombic, spherical, or rectangular [19,20,21,22] and may include one or more endotoxins, with a molecular weight between 60 kDa and 140 kDa [13].
More than 700 different cry genes have been sequenced and described so far [23]. According to their amino acid sequence, Cry toxins have been classified into 16 groups with 272 holotypes [2]. They usually consist of three reserved domains, each exhibiting a specific function [13]. Domain I (pfam03945) is located at the N-terminus of the protein; it consists of seven alpha helices and is involved in pore formation. The middle domain, Domain II (pfam00555), has a beta-prism structure and is responsible for the interaction with mid-intestinal epithelial cell membrane receptors of target insects determining the pesticidal specificity [24]. Domain III (cd04085), the C-terminus domain, forms a regular β-sandwich structure composed of two antiparallel β-sheets and is critical for receptor interaction and structural stability. Domain III is usually involved in the specific binding to receptors such as N-acetylgalactosamine [25].
The different classes of B. thuringiensis Cry toxins bind to various receptors (cadherins, aminopeptidases, alkaline peptidases, ATP-binding transporter proteins) and therefore bioinsecticide preparations containing B. thuringiensis strains have specific toxicity against certain pest groups [23,26]. Thus, the bioinsecticide formula based on B. thuringiensis ssp. kurstaki (Sumitomo Chemical Co., Ltd., Tokyo, Japan—Valent Biosciences’s DiPel®) is directed towards lepidopteran larvae only, the insecticide containing B. thuringiensis ssp. galleriae (Green Earth Ag & Turf LLC, Branford, CT, USA) is used solely against scarab beetles, while B. thuringiensis ssp. israelensis (Arbico Organics LLC, Oro Valley, AZ, USA) controls only Diptera representatives (mosquitoes and black flies). In addition to these limitations, due to the long-term use of particular insecticidal strains, an inherited resistance to certain formulae, such as DiPel®, has been developed by a number of pest species [27,28]. Today, genetic engineering of B. thuringiensis is increasingly used to obtain strains with a broader spectrum and stronger pesticidal activity [29,30,31].
The aim of the present work is to propose an alternative solution to the problems described herein by searching for B. thuringiensis strains containing new cry genes or unique combinations of them, which would enable a more efficient fight against pests from different taxonomic groups. Based on the available knowledge about the toxicity and specificity of Cry proteins, studying the genetic profile of newly isolated strains can be used to predict their potential for pest control.

2. Results

2.1. Isolation and Identification of New B. thuringiensis Strains

To select new crystal toxin producers, we collected B. thuringiensis isolates from remote agricultural and mountainous regions of Bulgaria. Twenty strains of B. thuringiensis were isolated from biopesticide-untreated soil samples taken from rice, sunflower or maize fields, wastelands, and forests of the Rhodope Mountains.
The initial identification of the strains was based on cells and colony morphology (rod-shaped cells, creamy white to light beige colonies with ragged edges).
Determination of isolates to species level was done by 16S rRNA gene sequencing and BLAST comparison of the obtained sequences with the NCBI GenBank database. In parallel, the total DNA of the strains was tested for the presence of cry genes. Figure 1 presents the phylogenetic positions of the isolates, which is affiliated with B. thuringiensis species and were positive for cry genes (PL1, PL3, PL20, BTG, 30, 38, and 40).
Nucleotide sequence similarity of the 16S rRNA genes showed that the isolates PL1, 30, and 40 were clustered with the branch B. thuringiensis subsp. kurstaki/israelensis/aizawai. This identifies the strains as belonging to the B. thuringensis species but does not provide information on the subspecies as due to the high similarity in 16S rDNA these three subspecies cannot be distinguished by this method. The strain PL3 was close to B. thuringiensis subsp. Berliner, while the strain BTG was clustered with B. thuringiensis subsp. galleriae, and B. thuringiensis X023 (BtX023), a strain with high insecticidal activity isolated in Hunan Province, China [19]. Strains 38 and PL20 fell into separate clusters. Accurate subspecies assignment based on whole genome sequencing was done only for strain BTG.

2.2. PCR Screening for Genes Encoding Cry δ-Toxins in Newly Isolated B. thuringiensis Strains

The methodology used to study B. thuringiensis strains and their potential for toxin synthesis included primer design, isolation, and purification of genomic DNA from the tested strains, PCR, sequencing, and bioinformatic analysis of the obtained fragments. Aiming to detect a broad Cry toxins spectrum, the presence of 12 toxins was tested: cry1Aa, cry1Ab, cry2Aa, cry3Aa, cry5A, cry7Aa, cry8Ba2, cry9Ca, cry9Da, cry11A, cry15A, and cry22A (Table 1).
B. thuringiensis serovar kurstaki ABTS-351 (the strain in the composition of the commercial preparation DiPel®) was used as a positive control for genes 1Aa, 1Ab, and 2Aa. Seven of the newly isolated B. thuringiensis strains possessed genes encoding different toxins. PCR products analysis showed that PL1, PL3, and PL20 contained at least three cry genes each, while B. thuringiensis strain BTG contained at least four. The other collected strains did not yield PCR products for cry genes and were not analyzed further. The majority of the fragments obtained were unique and amenable to sequencing. The study of homology of cry1Ab partial sequences of B. thuringiensis strains PL1, PL3, and PL20 showed that they are 100% homologous to cry1Ab of B. thuringiensis strain ABTS-351 (MK184462, 3468 bp). However, the primers targeting cry7Aa and cry8Ba2 did not generate a single PCR product, hence, the existence of these toxin genes had to be confirmed by another method.

2.3. Observation of B. thuringiensis Spores and Crystal Toxins by Scanning Electron Microscopy (SEM)

The four strains, namely PL1, PL3, PL20, and BTG, were designated as promising due to their possession of multiple genes encoding Cry proteins. The strains were characterized by their ability to form spores and crystal toxins. The crystal morphology observed by scanning electron microscopy (SEM) is shown in Figure 2 and Figure 3.
All images showed the presence of spores and parasporal crystal forms, attached or not attached to the spores. Three of the strains were capable of releasing two different morphological types of crystals. B. thuringiensis strain PL1 produced bipyramidal and polygonal crystals (Figure 2a,c), whereas PL20 formed bipyramidal and spherical crystals (Figure 2c,d).
The most impressive was the crystal composition of B. thuringiensis strain BTG, which released spherical (Figure 3a,c) and cubic crystalline forms (Figure 3a,b). Unlike the others, B. thuringiensis PL3 formed only one type of crystal inclusion, which was bipyramidal in shape. However, despite the similar shape, the bipyramidal crystals formed by B. thuringiensis PL3 were significantly larger in size compared to those of PL1 and PL20 (Figure 3d).

2.4. Whole Genome Sequencing (WGS) of B. thuringiensis BTG

B. thuringiensis BTG carried at least four different cry genes in its genome and released two different types of crystal toxins. Being the most promising, it was selected for whole genome sequencing (WGS), since the discovery of more genes encoding crystal proteins in its genome was expected.
The circular chromosome of B. thuringiensis BTG consists of 6,275,416 base pairs, with a G + C content of 35.05%. The BTG genome was de novo assembled in 153 contigs, bearing 6026 genes (5909 complete CDS), 102 genes for tRNAs, 14 for rRNAs, and 1 encoding transfer-messenger RNA (tmRNA). The largest part of them is engaged in amino acid and carbohydrate transport and metabolism (581 genes) and in energy production and conversion (195 genes). A comparison of the BTG genome with the NCBI database shows 94.77% homology with the genomes of bacteria of the genus Bacillus and 5.23% homology with the genus Pseudomonas. The closest genome is that of B. thuringiensis X023 (GenBank GCA_021651035.1) [19,35], with a homology of 99.6% (92.9% alignment coverage). In silico DNA-DNA hybridization (DDH) with B. thuringiensis subsp. galleriae strain HD-29 showed a 92.13% probability that BTG belongs to the same subspecies [32,36]. The genomes with the highest homology to BTGs are presented in Table 2.
The functional annotation showed that the strain most likely does not contain plasmids, which was confirmed by PlasmidFinder analysis. This suggests that cry genes are most likely located in the chromosome, similarly to B. thuringiensis subsp. Berliner (ATCC 13367) and B. thuringiensis HER1410 [37,38]. Considering cry genes, B. thuringiensis BTG contained seven complete open reading frames (ORFs) encoding the following crystal toxins with insecticidal activity: Cry1Ab35, Cry1Db, Cry1Fb, Cry1Ib, Cry2Ab, Cry8Ea1, and Cry9Ba2, and two partial ORFs, homologous to cry9Aa and cry1Ac (Table 3 and Table S1).
It should be noted, however, that the sequence annotated as Cry1Ga proved to be identical to that of Cry8Ea1 on protein level (1166 AA). The sequence annotated as Cry9Ea proved to be identical to that of Cry9Ba2 on both DNA (3354 bp) and protein (1117 AA) levels. Cry1Ac was detected as a fragment of only 135 bp, which is not enough to distinguish it from closely related toxins of the same type and first two ranks (Cry1A). The genes encoding pesticidal crystal protein Cry1Fb, cry1Db, cry1Ib, and the partial genes for Cry9Aa and cry1Ca form a cluster in Contig68. Adjacently to cry genes one can find genes encoding integrase (possessing 97% similarity with B. thuringiensis GR007 plasmid pGR157), and tyrosine recombinase XerS (99% similar to that in the plasmid of Ps. synxantha strain 27). However, the genes responsible for plasmid replication were not found in proximity, thus suggesting that the group of cry genes in BTG is located in the chromosome (as a possible result of a former recombination event) rather than in autonomous plasmid. In addition, nucleotide sequences with different levels of homology with the unnamed plasmid of Ps. synxantha strain 27 were found in nine different BTG contigs (13, 41, 68, 84, 86, 102, 120, 137, and 148).
As far as our current knowledge goes, this toxicological profile appears to be unique to BTG and is not known to exist in any other strain. The BTG genome also bears 107 genes dedicated to defence mechanisms, 116 genes for posttranslational modification, protein turnover, and chaperones, and 66 genes for the biosynthesis of secondary metabolites. Considering the last, in silico analysis by AntiSMASH web service https://antismash.secondarymetabolites.org/ (accessed on 1 May 2023) showed that the BTG genome contains a cluster encoding the synthesis of non-ribosomal antifungal lipopeptide fengycin, metallophore bacillibactin, and siderophore petrobactin, as well as the ribosomally synthesized and post-translationally modified linear azoline-containing peptides (LAPs) with antimicrobial activity [48].

3. Discussion

There are numerous patents describing B. thuringiensis strains with insecticidal activity and their characteristics. Several US patents protect particular strains (WO2016115476A1, WO1996028031A1), while others protect the discovery of new Cry proteins (US2008020967, US2008040827, US2007245430, US2008016596, US2008020968), or the cloning of the responsible genes in transgenic plants. There are also patents that describe new hybrid insecticidal toxins and their production (US5593881, US5932209, US6780408). Due to the huge interest in the species, 745 genomes of B. thuringiensis have been sequenced and assembled to date, as the NCBI database tree contains 603 annotated genomes. However, regardless of the accumulated huge database, the de novo assembled genome of B. thuringiensis BTG contains nearly a quarter of genes that are of unknown function. Certain regions of the BTG genome are homologous to the genomes of the strains with widely applied insecticidal activity as B. thuringiensis ABTS-1857 (CP083156.1) and B. thuringiensis YBT-1520 (CP004858.1) of serovar kurstaki. There are also certain differences. For example, ABTS-351 (the active ingredient of DiPel®) and YBT-1520 (patent-protected in China) contain genes for Cry1Aa and Cry2Aa toxins, while the BTG strain does not contain such genes. Since B. thuringiensis BTG belongs to the subspecies galleriae according to ANI estimation, we compared its genome to that of B. thuringiensis serovar galleriae HD-29 [36]. The similarity between genomes is 90%, with the most significant differences in the encoded crystal toxins. Strain HD-29 contains plasmid-encoded cry1Aa, cry1Ac, cry1Ca, cry1Ia, cry9Ea, and vip3Aa, which are absent in strain BTG. A toxin gene present in the genomes of both strains is cry2Ab with 99.6% homology. The nucleotide sequence of cry1Ab35 of BTG is 100% identical to that of B. thuringiensis strain GS36 [35,49]. The toxin is very close (99.97% identity) to a plasmid-encoded toxin of Pseudomonas synxantha strain 27 (GenBank CP074079, PRJNA725964). Notably, the same plasmid shows 100% identity with cry8Ea1 of BTG.
It was recently discovered that a strain of B. thuringiensis subsp. galleriae (SDS-502), registered in the USA and Canada, produces Cry8Da toxin, which has demonstrated effectiveness against scarab beetles such as Popillia japonica [50]. Furthermore, Shrestha et al. [51] reported that strain SDS-502 can be used for biological control of the alfalfa bollworm.
Considering toxins Cry1Ab35, Cry1Db, Cry1Fb, Cry1Ib, Cry2Ab, Cry8Ea1, and Cry9Ba2/Cry9Ea, they have been shown to be effective against at least 10 harmful species from the orders Lepidoptera and Coleoptera. Cry1Ab35 is active against many representatives of Lepidoptera, and one of its most important applications is to control the maize pest Ostrinia nubilalis (Hübner), family Pyralidae. Against this insect, only the endophytic fungi of the species Beauveria bassiana has been used as a successful biopesticide so far [52]. Cry1Ab35 is a toxin that affects representatives of class Gastropoda, which are various types of snails and slugs [53]. Cry1Ab35 and Cry1Fb are effective against Spodoptera frugiperda (armyworm), which causes severe damage to crops worldwide [54,55] and very often develops resistance to pesticides [56]. Cry1Fb is toxic to members of the family Noctuidae, which include Spodoptera ornithogalli (yellow-striped nightshade) and Heliothis virescens (tobacco budworm), which attack tobacco, cotton, alfalfa, tobacco, beans, soybeans, corn, cotton, cabbage, lettuce, and ornamental species such as geranium, hibiscus, pelargonium, and chrysanthemum [57]. Cry1lb toxin is also known to be active against larvae of the cabbage moth Plutella xylostella [58], a cruciferous pest that causes USD 2.7 billion worth of damage annually worldwide [59]. Cry2Ab is effective against two cosmopolitan pests, the cotton bollworm Helicoverpa armigera [60], and the cabbage bollworm Trichoplusia ni [61], affecting over 180 different plant species and capable of developing remarkable resistance to chemical pesticides [57]. Cry8-type toxins are insecticidal to a number of arthropod pests, especially certain scarab beetles (Scarabaeidae) [62]. The Cry8Ea1 protein of Chinese isolate B. thuringiensis BT185 is specifically toxic against the larvae of Holotrichia parallela (black Asian chafer), a pest that destroys the underground parts of more than 300 species in Europe and Asia, causing massive and irreversible economic losses [63]. Cry9 family toxins have been shown to exhibit toxicity against the large wax moth Galleria melonella [64], which is an enemy of honeybees [65]. Additionally, these toxins have also demonstrated efficacy against the beet cutworm, which currently lacks effective biopesticides for control [66]. Cry9Ba2/9Ea (first described in B. thuringiensis subsp. galleriae HD29) is toxic to the beet armyworm Spodoptera exigua and the cabbage bollworm Trichoplusia ni, both polyphagous and cosmopolitan pests [67]. There is currently a lack of available data regarding the potency and specificity of Cry9Ba2, making it a very rare toxin with limited information. Cry9Ea is toxic to the larvae of Cydia pomonella, the coddling moth, which is a major threat to apples and pears on six continents [68]. So far, in the patent literature, no strains that exhibit combined insecticidal activity against different classes of insects and snails have been described. The specific activities of the known B. thuringiensis strains used as biopesticides are compared in Table 4.
The relationship between the production of certain δ-endotoxins and the crystals formed is not fully understood. Some crystal shapes have been related to the synthesis of specific Cry proteins. According to Djenane et al. [74], the expression of cry4, cry10, or cry11 genes gives rise to spherical shape crystals, and their respective proteins are known to be active against Diptera [75]. Crystals with a bipyramidal shape result from the accumulation of Cry1 or Cry9 proteins, which are active mainly against Lepidoptera. Cry2 proteins are active against both Lepidoptera and Diptera and form cuboidal crystals [74]. There are also other rare studies on the relationship between crystal morphology and cry gene content, for example, Azizoglu et al. [76] cloned the cry1Ab gene and showed that it is involved in the formation of bipyramidal crystals. Based on a study of 700 newly isolated strains of B. thuringiensis from Qatar, divided into 16 different groups depending on the crystals formed, Nair et al. [22] concluded that the isolates producing bipyramidal and cuboidal crystals carry all the Lepidopteran and Coleopteran specific insecticidal protein-coding genes, and these crystals are formed from the most common Cry1A, Cry1Ia, Cry1B, Cry1D, and Cry2 proteins. This statement partially contradicts the observations of Wanapaisan et al. [77], who demonstrated that Cry1Da forms spherical crystals. Rosas-García linked the presence of proteins of Cry1 and Cry2 classes with bipyramidal and square crystals [78]. In the work of Nair et al. [22], the most common bipyramidal form (characteristic of Bt serovar kurstaki) was associated with the obligatory presence of a protein of about 130 kDa (corresponding both to Cry1Aa and Cry1Ab). The spherical crystals, on the other hand, with a typical representative Bt serovar israelensis, also contain a 130 kDa protein core but are formed by a total of 15 proteins of different sizes. The cubic forms of the crystals were composed of a mixture of proteins with molecular weights of 130, 73, 34, 25, and 13 kDa, with the 50−66 kDa proteins being particularly abundantly [79]. Summarizing these data, we can assume that the bipyramidal crystal forms in the newly isolated B. thuringiensis PL1, PL3, and PL20, which is due to the presence and expression of the cry1Ab gene encoding a 133.5 kDa protein (Table 3). The cubic crystals of B. thuringiensis strain BTG are most likely formed by Cry1Ab35 and Cry2Ab proteins, similar to the quasi-cuboidal shape of Cry1Ab21 crystal protein that was previously found in other Bt isolates [80]. The spherical crystals of BTG, however, are not due to the auto-crystallization of proteins of the Cry4 class (since the genome lacks the related genes), but to Cry1Da, as suggested by Wanapaisan et al. [77].
In conclusion, according to the toxin type and specificity reported, B. thuringiensis BTG is most likely active mostly against members of orders Lepidoptera and Coleoptera, to a lesser extent orders Diptera and Hemiptera as well as class Gastropoda. The combination of several crystal shapes within an individual B. thuringiensis isolate is an indication of the presence of Cry proteins from different families and holds the potential for a spectrum of activity against a broad range of insect pests.

4. Materials and Methods

4.1. Collection of Soil Samples, Isolation, and Storage of Bacterial Strains

Soil samples were collected from several different geographical regions of Bulgaria (Plovdiv, Sofia, Veliko Tarnovo, Targovishte, Shabla, and the Rhodope Mountains). Notably, the majority of the strains containing cry genes (PL1, PL3, PL20, and BTG) were isolated from the Plovdiv region from the Oryza sativa rhizosphere (Table 5).
The soil samples were taken with a sterile spatula at a depth of 5 cm from the soil surface. All samples were placed in sterile Falcon tubes and stored at 4 °C until processed.
Soil samples were subjected to treatment in order to isolate strains of microorganisms belonging to the genus B. thuringiensis. The thermal shock was used to eliminate all bacteria unable to transform into endospores. One gram of the soil samples was mixed with 10 mL of physiological solution in sterile flasks, followed by incubation on a shaker at 200 rpm for 2 h at 30 °C. Aliquots of 1 mL of the solutions were heat shocked at 80 °C for 10 min and then placed on ice for 5 min. The heat-treated samples were serially diluted in saline and aliquots of each dilution were spread on Petri dishes with NB medium, and incubated at 37 °C for 24–72 h. Colonies that showed typical characteristics of Bacillus spp. were sub-cultured and stored at 4 °C for further identification. Long-term storage of the isolates was in liquid media with 20% v/v glycerol at −70 °C.

4.2. DNA Isolation, 16S rRNA Gene PCR, and Sequencing

For DNA isolation from 24-h cultures of the different strains, GeneMATRIX Bacterial & Yeast Genomic DNA Purification Kit (EURx, Gdansk, Poland) was used. The amplification of the gene encoding the 16S ribosomal RNA was carried out within QB-96 Satellite Gradient Thermal Cycler (LKB Vertriebs GmbH, Vienna, Austria) with universal primers 27F and 1492R, at the following temperature regime: initial denaturation 94 °C for 3.30 min, 35 cycles: 94 °C for 1 min, 58 °C for 45 s, 72 °C for 2 min, and final elongation 72 °C for 7 min. After the visualization of fragments of about 1600 bp in a 1% agarose gel, the PCR products were sent for sequencing. Analysis of the obtained sequences was performed with Chromas LITE version 2.6.6, BLAST, Cap3 (https://doua.prabi.fr/software/cap3, accessed on 25 April 2023), and ClustalW programs.

4.3. B. thuringiensis BTG Genome: Sequencing, Assembly, and Bioinformatics Analysis

De novo sequenced genome was registered in NCBI GenBank under the following WGS accession: BioProject PRJNA977062, BioSample SAMN35448569, acc. number JASNQP000000000.
All procedures on genome library preparation, WGS, and genome annotation were accomplished by the company Macrogen Inc. (Seoul, Republic of Korea). The genome library was constructed using TruSeq DNA PCR-Free Kit; the sequencing was done by the Illumina HiSeq 2000 Sequencing System, read length 151. Total read bases were 2,251,811,962. The genome coverage was 91.85x.
Platanus-allee v2.2.2, de novo haplotype assembly method using De Bruijn Graph (DBG) algorithm [80] generated 153 contigs with N50 = 58,552 (estimated genome size 6,275,416), with a sequencing depth of 163. The assembled genome was validated using Benchmarking Universal Single-Copy Orthologs (BUSCO) analysis [81] based on evolutionarily informed expectations of gene content from near-universal single-copy orthologs, as the used lineage was “bacteria_odb10” (number of genomes: 4085, number of BUSCOs: 124). Complete and single-copy BUSCOs were 119 (95.97%), while complete and duplicated BUSCOs were 5 (4.03%). Fragmented and missing BUSCOs were 0.0%.
The functional annotation was conducted by InterProScan and Eggnog DB, and the Type (Strain) Genome Server (TYGS) https://tygs.dsmz.de/ (accessed on 13 January 2023) was used for B. thuringiensis serovar elucidation [82]. The possible presence of plasmids was searched with the program PlasmidFinder set for Gram-positive bacteria [83] and did not detect plasmids. AntiSMASH 7.0 platform predicted secondary metabolites synthesis [84].

4.4. PCR Screening for Cry Toxins Encoding Genes

The genes encoding 12 different Cry toxins were selected for potential detection. These toxins are potential pests against six orders (Lepidoptera, Coleoptera, Diptera, Hemiptera, and Hymenoptera) and one class (Gastropoda) from three different phyla (Arthropoda, Nematoda, and Mollusca) according to the literature [8,85,86] and the NCBI GenBank database. Primers were designed to amplify fragments from 559 to 2181 bp (Table 6). Sequencing of the PCR fragments was performed by Macrogen Inc. (Amsterdam, The Netherlands).
PCR reactions consisted of 50 ng DNA template, 0.4 μM primers, Premix Ex Taq HotStart Version (Clontech Laboratories, Inc., A Takara Bio Company, Mountain View, CA, USA), and sterile water with a final volume of 25 μL. Between initial denaturation for 3 min and 30 s at 98 °C and final elongation for 5 min at 72 °C, the following temperature profile was used for 35 cycles: 10 s denaturation at 98 °C, 30 s annealing at the most appropriate temperature in a range from 43.3 to 55.9 °C (as determined by gradient PCR), and 2 min elongation at 72 °C.
The PCR fragments were visualized on 1% agarose gel and used for sequencing.

4.5. Scanning Electron Microscopy (SEM)

Spores and crystals of B. thuringiensis PL1, PL3, PL20, and BTG were observed by scanning electron microscopy after 72 h of incubation in a spore-forming medium containing (NH4)2SO4, 1 g/L; K2HPO4, 4.15 g/L; KH2PO4, 3.4 g/L; Salt solution, 3 ml/L with content as previously described [87]; sucrose, 10 g/L, and soybean meal, 60 g/L. Bacterial biomass was harvested by centrifugation and washed with cacodylate buffer pH (7.2). Pelleted cells were fixed with 4% glutaraldehyde for 2 h, followed by post-fixation with 1% OsO4 for 1 h at 4 °C. After washing three times, dehydration follows in graded ethanol series through 15 min time intervals. The final stage was mounting on scanning electron microscopy holders and sputtering with gold in a vacuum evaporator (Edwards, CA, USA). The observations were made on Lyra/Tescan scanning electron microscope (Riga, Latvia).

5. Conclusions

The isolation and genetic characterization of new B. thuringiensis strains containing cry toxin genes were reported. Seven strains contained various genes encoding δ-endotoxins. Four strains had the genetic ability to produce more than three different Cry toxins, as demonstrated by PCR analysis and whole genome sequencing. SEM observation of the formed crystalline structures showed their correlation with the detected genes. B. thuringiensis BTG genome mining showed a particularly rich and unique combination of cry genes, allowing for the future development of industrial preparations against multiple pests.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241311137/s1.

Author Contributions

Conceptualization, P.P.; methodology, M.G., A.A. and T.P.-K.; software, P.P.; validation, M.G.; investigation, M.G., A.A. and T.P.-K.; resources, K.P.; data curation, K.P.; writing—original draft preparation, A.A.; writing—review and editing, P.P.; funding acquisition, P.P. and K.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by AGRIA AG, grant number No. 1/2021. The APC fee is provided by the French Embassy and the French Institute in Bulgaria.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The B. thuringiensis serovar galleriae whole genome shotgun (WGS) project has the project accession JASNQP000000000. This version of the project (01) has the accession number JASNQP010000000 and consists of sequences JASNQP010000001-JASNQP010000153. All genome data are available in the NCBI GenBank following a patent deposit of B. thuringiensis strain BTG (NBIMCC №9095).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gula, L.T. Researchers Helping Protect Crops from Pests. Available online: https://www.nifa.usda.gov/about-nifa/blogs/researchers-helping-protect-crops-pests (accessed on 17 May 2023).
  2. Crickmore, N.; Berry, C.; Panneerselvam, S.; Mishra, R.; Connor, T.R.; Bonning, B.C. A structure-based nomenclature for Bacillus thuringiensis and other bacteria-derived pesticidal proteins. J. Invertebr. Pathol. 2021, 186, 107438. [Google Scholar] [CrossRef] [PubMed]
  3. Naqvi, R.Z.; Asif, M.; Saeed, M.; Asad, S.; Khatoon, A.; Amin, I.; Mukhtar, Z.; Bashir, A.; Mansoor, S. Development of a triple gene cry1ac-cry2ab-epsps construct and its expression in Nicotiana benthamiana for insect resistance and herbicide tolerance in plants. Front. Plant Sci. 2017, 8, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Loutfi, H.; Fayad, N.; Pellen, F.; Le Jeune, B.; Chakroun, M.; Benfarhat, D.; Lteif, R.; Kallassy, M.; Le Brun, G.; Abboud, M. Morphological study of Bacillus thuringiensis crystals and spores. Appl. Sci. 2021, 11, 155. [Google Scholar] [CrossRef]
  5. Gassmann, A.J.; Reisig, D.D. Management of insect pests with Bt crops in the United States. Annu. Rev. Entomol. 2023, 68, 31–49. [Google Scholar] [CrossRef] [PubMed]
  6. Ibrahim, M.A.; Griko, N.; Junker, M.; Bulla, L.A. Bacillus thuringiensis: A genomics and proteomics perspective. Bioeng. Bugs 2010, 1, 31–50. [Google Scholar] [CrossRef] [Green Version]
  7. Roh, J.Y.; Choi, J.Y.; Li, M.S.; Jin, B.R.; Je, Y.H. Bacillus thuringiensis as a specific, safe, and effective tool for insect pest control. J. Microbiol. Biotechnol. 2007, 17, 547–559. [Google Scholar]
  8. Palma, L.; Muñoz, D.; Berry, C.; Murillo, J.; Caballero, P. Bacillus thuringiensis toxins: An overview of their biocidal activity. Toxins 2014, 6, 3296–3325. [Google Scholar] [CrossRef] [Green Version]
  9. Bravo, A.; Gill, S.S.; Soberón, M. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 2007, 49, 423–435. [Google Scholar] [CrossRef] [Green Version]
  10. Tetreau, G.; Andreeva, E.A.; Banneville, A.-S.; De Zitter, E.; Colletier, J.-P. How Does Bacillus thuringiensis crystallize such a large diversity of toxins? Toxins 2021, 13, 443. [Google Scholar] [CrossRef]
  11. Guerrero, M.G.G. Sporulation, structure assembly, and germination in the soil bacterium Bacillus thuringiensis: Survival and success in the environment and the insect host. Microbiol. Res. 2023, 14, 466–491. [Google Scholar] [CrossRef]
  12. Valtierra-de-Luis, D.; Villanueva, M.; Lai, L.; Williams, T.; Caballero, P. Potential of Cry10Aa and Cyt2Ba, two minority δ-endotoxins produced by Bacillus thuringiensis ser. israelensis, for the control of Aedes aegypti larvae. Toxins 2020, 12, 355. [Google Scholar] [CrossRef]
  13. Liu, L.; Li, Z.; Luo, X.; Zhang, X.; Chou, S.-H.; Wang, J.; He, J. Which is stronger? A continuing battle between cry toxins and insects. Front. Microbiol. 2021, 12, 665101. [Google Scholar] [CrossRef]
  14. Li, Y.; Wang, C.; Ge, L.; Hu, C.; Wu, G.; Sun, Y.; Song, L.; Wu, X.; Pan, A.; Xu, Q.; et al. Environmental behaviors of Bacillus thuringiensis (Bt) insecticidal proteins and their effects on microbial ecology. Plants 2022, 11, 1212. [Google Scholar] [CrossRef] [PubMed]
  15. Xu, C.; Wang, B.C.; Yu, Z.N.; Sun, M. Structural insights into Bacillus thuringiensis Cry, Cyt and parasporin toxins. Toxins 2014, 6, 2732–7270. [Google Scholar] [CrossRef] [Green Version]
  16. Alves, G.B.; Dias, M.L.; Oliveira, E.E.; Santos, G.R.d.; Ribeiro, B.M.; Aguiar, R.W.d.S. Isolation, genomic, and proteomic characterization of a novel neotropical strain of Bacillus thuringiensis with mosquitocidal activities. Processes 2023, 11, 1455. [Google Scholar] [CrossRef]
  17. Lai, L.; Villanueva, M.; Muruzabal-Galarza, A.; Fernández, A.B.; Unzue, A.; Toledo-Arana, A.; Caballero, P.; Caballero, C.J. Bacillus thuringiensis Cyt proteins as enablers of activity of Cry and Tpp toxins against Aedes albopictus. Toxins 2023, 15, 211. [Google Scholar] [CrossRef] [PubMed]
  18. Wang, J.; Mei, H.; Zheng, C.; Qian, H.; Cui, C.; Fu, Y.; Su, J.; Liu, Z.; Yu, Z.; He, J. The metabolic regulation of sporulation and parasporal crystal formation in Bacillus thuringiensis revealed by transcriptomics and proteomics. Mol. Cell. Proteom. 2013, 12, 1363–1376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Liu, Z.; Xie, J.; Deng, Z.; Wang, M.; Dang, D.; Luo, S.; Wang, Y.; Sun, Y.; Xia, L.; Ding, X. Enhancing the insecticidal activity of new Bacillus thuringiensis X023 by copper ions. Microb. Cell Fact. 2020, 19, 195. [Google Scholar] [CrossRef]
  20. Iatsenko, I.; Nikolov, A.; Sommer, R.J. Identification of distinct Bacillus thuringiensis 4A4 nematicidal factors using the model nematodes Pristionchus pacificus and Caenorhabditis elegans. Toxins 2014, 6, 2050–2063. [Google Scholar] [CrossRef] [Green Version]
  21. Sezen, K.; Muratoglu, H.; Nalcacioglu, R.; Mert, D.; Demirbag, Z.; Kati, H. Highly pathogenic Bacillus thuringiensis subsp. tenebrionis from European shot-hole borer, Xyleborus dispar (Coleoptera: Scolytidae). N. Z. J. Crop Hortic. Sci. 2008, 36, 77–84. [Google Scholar] [CrossRef] [Green Version]
  22. Nair, K.; Al-Thani, R.; Al-Thani, D.; Al-Yafei, F.; Ahmed, T.; Jaoua, S. Diversity of Bacillus thuringiensis strains from Qatar as shown by crystal morphology, δ-endotoxins and Cry gene content. Front. Microbiol. 2018, 9, 708. [Google Scholar] [CrossRef] [PubMed]
  23. Bravo, A.; Gómez, I.; Porta, H.; García-Gómez, B.I.; Rodriguez-Almazan, C.; Pardo, L.; Soberón, M. Evolution of Bacillus thuringiensis Cry toxins insecticidal activity. Microb. Biotechnol. 2013, 6, 17–26. [Google Scholar] [CrossRef] [PubMed]
  24. Endo, H. Molecular and Kinetic models for pore formation of Bacillus thuringiensis Cry toxin. Toxins 2022, 14, 433. [Google Scholar] [CrossRef] [PubMed]
  25. Bel, Y.; Ferré, J.; Hernández-Martínez, P. Bacillus thuringiensis toxins: Functional characterization and mechanism of action. Toxins 2020, 12, 785. [Google Scholar] [CrossRef] [PubMed]
  26. Gonzalez-Vazquez, M.C.; Vela-Sanchez, R.A.; Rojas-Ruiz, N.E.; Carabarin-Lima, A. Importance of Cry proteins in biotechnology: Initially a bioinsecticide, now a vaccine adjuvant. Life 2021, 11, 999. [Google Scholar] [CrossRef]
  27. Huang, F.; Buschman, L.L.; Higgins, R.A.; McGaughey, W.H. Inheritance of resistance to Bacillus thuringiensis toxin (Dipel ES) in the European corn borer. Science 1999, 284, 965–967. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Xiao, Z.; Yao, X.; Bai, S.; Wei, J.; An, S. Involvement of an enhanced immunity mechanism in the resistance to Bacillus thuringiensis in Lepidopteran Pests. Insects 2023, 14, 151. [Google Scholar] [CrossRef]
  29. Wang, G.; Zhang, J.; Song, F.; Wu, J.; Feng, S.; Huang, D. Engineered Bacillus thuringiensis GO33A with broad insecticidal activity against lepidopteran and coleopteran pests. Appl. Microbiol. Biotechnol. 2006, 72, 924–930. [Google Scholar] [CrossRef]
  30. Yue, C.; Sun, M.; Yu, Z. Broadening the insecticidal spectrum of Lepidoptera-specific Bacillus thuringiensis strains by chromosomal integration of cry3A. Biotechnol. Bioeng. 2005, 91, 296–303. [Google Scholar] [CrossRef]
  31. Lereclus, D.; Vallade, M.; Chaufaux, J.; Arantes, O.; Rambaud, S. Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Nat. Biotechnol. 1992, 10, 418–421. [Google Scholar] [CrossRef]
  32. Sneath, P.H.; Sokal, R.R. Numerical Taxonomy: The Principles and Practice of Numerical Classification, 1st ed.; WF Freeman & Co.: San Francisco, CA, USA, 1973; p. 573. Available online: https://www.cabdirect.org/cabdirect/abstract/19730310919 (accessed on 3 April 2023).
  33. Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [PubMed]
  34. Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular evolutionary genetics analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  35. Ding, X.; Liu, Z.; Xie, J.; Xia, L.; Sun, Y.; Hu, S.; Yu, Z.; Huang, W.; Hu, Y. One Thuringiensis Strain Bacillus and Its Application. China Patent CN109810920A, 30 January 2019. Available online: https://patents.google.com/patent/CN109,810,920A/en (accessed on 3 June 2023).
  36. Zhu, L.; Tian, L.J.; Zheng, J.; Gao, Q.L.; Wang, Y.Y.; Peng, D.H.; Ruan, L.F.; Sun, M. Complete genome sequence of Bacillus thuringiensis serovar galleriae strain HD-29, a typical strain of commercial biopesticide. J. Biotechnol. 2015, 195, 108–109. [Google Scholar] [CrossRef]
  37. Shwed, P.S.; Crosthwait, J.; Weedmark, K.; Leveque, G. The complete genome sequence of Bacillus thuringiensis Strain ATCC 13367 features a cry-containing chromosome. Microbiol. Resour. Announc. 2022, 11, e0122721. [Google Scholar] [CrossRef]
  38. Lechuga, A.; Lood, C.; Salas, M.; van Noort, V.; Lavigne, R.; Redrejo-Rodríguez, M. Completed genomic sequence of Bacillus thuringiensis HER1410 reveals a Cry-containing chromosome, two megaplasmids, and an integrative plasmidial prophage. G3 (Bethesda) 2020, 10, 2927–2939. [Google Scholar] [CrossRef]
  39. Young, S.; Sessler, R.; Graser, G.; Guilbaud, R.; Schirm, M.; Isabelle, M. Compositions and Methods for Protein Detection. US Patent US20210190794A1, 14 August 2019. Available online: https://patents.google.com/patent/US20210190794A1/en (accessed on 14 May 2023).
  40. Cerf, D.C.; English, J.J.; Hendrick, C.A.; Liu, L.; Oral, J.K.; Patten, P.A.; Rosen, B.A.; Schellenberger, U.; Udranszky, I.A.; Wei, J.-Z.; et al. Novel Insecticidal Proteins and Methods for Their Use. US Patent US20,140,007,292A1, 11 March 2013. Available online: https://patents.google.com/patent/US20,140,007,292A1/en (accessed on 14 May 2023).
  41. Huang, T.; Xiao, Y.; Pan, J.; Zhang, L.; Gelbič, I.; Guan, X. Characterization of cry1Cb3 and cry1Fb7 from Bacillus thuringiensis subsp. galleriae. Open Life Sci. 2015, 10, 521–528. [Google Scholar] [CrossRef]
  42. Li, J.D.; Carroll, J.; Ellar, D.J. Crystal structure of insecticidal delta-endotoxin from Bacillus thuringiensis at 2.5 A resolution. Nature 1991, 353, 815–821. [Google Scholar] [CrossRef]
  43. Song, F.; Zhang, J.; Gu, A.; Wu, Y.; Han, L.; He, K.; Chen, Z.; Yao, J.; Hu, Y.; Li, G.; et al. Identification of cry1I-type genes from Bacillus thuringiensis strains and characterization of a novel cry1I-type gene. Appl. Environ. Microbiol. 2003, 9, 5207–5211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Villanueva, D.; Velásquez, N.; Rodríguez, E.; Orduz, S.; Arango, R. Molecular characterization of a Colombian Bacillus thuringiensis strain with activity against Tecia solanivora (Lepidoptera: Gelechiidae). Rev. Colomb. Entomol. 2009, 35, 130–137. [Google Scholar] [CrossRef]
  45. Diehn, S.; English, J.; Liu, L.; Ong, A.; Oral, J.; Rosen, B.; Schellenberger, U.; Udranszky, I.; Wei, J.-Z.; Xie, W.; et al. Insecticidal Proteins and Methods for Their Use. WIPO Patent WO2015038734A2, 11 September 2014. Available online: https://patents.google.com/patent/WO2015038734A2/en (accessed on 14 May 2023).
  46. Liu, L.; O’Rear, J.; Park, Y.J.; Rosen, B.; Schellenberger, U.; Schepers, E.; Wei, J.-Z.; Xie, W.; Yalpani, N.; Zhong, X.; et al. Insecticidal Proteins and Methods for Their Use. US Patent US10,006,045B2, 14 August 2024. Available online: https://patents.google.com/patent/US10006045B2/en (accessed on 14 May 2023).
  47. Pacheco, S.; Gómez, I.; Chiñas, M.; Sánchez, J.; Soberón, M.; Bravo, A. Whole Genome Sequencing Analysis of Bacillus thuringiensis GR007 reveals multiple pesticidal protein genes. Front. Microbiol. 2021, 12, 758314. [Google Scholar] [CrossRef]
  48. Mordhorst, S.; Ruijne, F.; Vagstad, A.L.; Kuipers, O.P.; Piel, J. Emulating nonribosomal peptides with ribosomal biosynthetic strategies. RSC Chem. Biol. 2022, 4, 7–36. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, Y.; Zhao, D.; Yan, X.; Guo, W.; Bao, Y.; Wang, W.; Wang, X. Identification and characterization of Hyphantria cunea aminopeptidase N as a binding protein of Bacillus thuringiensis Cry1Ab35. Int. J. Mol. Sci. 2017, 18, 2575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Redmond, C.T.; Wallis, L.; Geis, M.; Williamson, R.C.; Potter, D.A. Strengths and limitations of Bacillus thuringiensis galleriae for managing Japanese beetle (Popillia japonica) adults and grubs with caveats for cross-order activity to monarch butterfly (Danaus plexippus) larvae. Pest Manag. Sci. 2020, 76, 472–479. [Google Scholar] [CrossRef] [PubMed]
  51. Shrestha, G.; Reddy, G.V.P.; Jaronski, S.T. Field efficacy of Bacillus thuringiensis galleriae strain SDS-502 for the management of alfalfa weevil and its impact on Bathyplectes spp. parasitization rate. J. Invertebr. Pathol. 2018, 153, 6–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Wang, Y.; Zhao, W.; Han, S.; Wang, L.; Chang, X.; Liu, K.; Quan, Y.; Wang, Z.; He, K. Seven years of monitoring susceptibility to Cry1Ab and Cry1F in Asian corn borer. Toxins 2023, 15, 137. [Google Scholar] [CrossRef]
  53. Schneider, K.; Breck Davis, B.; Tourtois, J.; Hulbert, D. Insecticidal Combinations. WIPO Patent WO2021222814A1, 30 April 2021. Available online: https://patents.google.com/patent/WO2021222814A1/en (accessed on 14 May 2023).
  54. Gómez, I.; Ocelotl, J.; Sánchez, J.; Aguilar-Medel, S.; Peña-Chora, G.; Lina-Garcia, L.; Bravo, A.; Soberón, M. Bacillus thuringiensis Cry1Ab domain III β-22 mutants with enhanced toxicity to Spodoptera frugiperda (J. E. Smith). Appl. Environ. Microbiol. 2020, 86, e01580-20. [Google Scholar] [CrossRef]
  55. Ingber, D.A.; Mason, C.E.; Flexner, L. Cry1 Bt Susceptibilities of fall armyworm (Lepidoptera: Noctuidae) host strains. J. Econ. Entomol. 2018, 111, 361–368. [Google Scholar] [CrossRef]
  56. Paredes-Sánchez, F.A.; Rivera, G.; Bocanegra-García, V.; Martínez-Padrón, H.Y.; Berrones-Morales, M.; Niño-García, N.; Herrera-Mayorga, V. Advances in control strategies against Spodoptera frugiperda. A Review. Molecules 2021, 26, 5587. [Google Scholar] [CrossRef]
  57. Da Silva, F.R.; Trujillo, D.; Bernardi, O.; Verle Rodrigues, J.C.; Bailey, W.D.; Gilligan, T.M.; Carrillo, D. Comparative toxicity of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) to selected insecticides. Insects 2020, 11, 431. [Google Scholar] [CrossRef]
  58. Shin, B.S.; Park, S.H.; Choi, S.K.; Koo, B.T.; Lee, S.T.; Kim, J.I. Distribution of cryV-type insecticidal protein genes in Bacillus thuringiensis and cloning of cryV-type genes from Bacillus thuringiensis subsp. kurstaki and Bacillus thuringiensis subsp. Entomocidus. Appl. Environ. Microbiol. 1995, 61, 2402–2407. [Google Scholar] [CrossRef] [Green Version]
  59. Zalucki, M.P.; Shabbir, A.; Silva, R.; Adamson, D.; Shu-Sheng, L.; Furlong, M.J. Estimating the economic cost of one of the world’s major insect pests, Plutella xylostella (Lepidoptera: Plutellidae): Just how long is a piece of string? J. Econ. Entomol. 2012, 105, 1115–1129. [Google Scholar] [CrossRef] [PubMed]
  60. Liu, S.; Wang, S.; Wu, S.; Wu, Y.; Yang, Y. Proteolysis activation of Cry1Ac and Cry2Ab protoxins by larval midgut juice proteases from Helicoverpa armigera. PLoS ONE 2020, 15, e0228159. [Google Scholar] [CrossRef] [PubMed]
  61. Yang, X.; Chen, W.; Song, X.; Ma, X.; Cotto-Rivera, R.O.; Kain, W.; Chu, H.; Chen, Y.R.; Fei, Z.; Wang, P. Mutation of ABC transporter ABCA2 confers resistance to Bt toxin Cry2Ab in Trichoplusia ni. Insect Biochem. Mol. Biol. 2019, 112, 103209. [Google Scholar] [CrossRef]
  62. Yamaguchi, T.; Bando, H.; Asano, S. Identification of a Bacillus thuringiensis Cry8Da toxin-binding glucosidase from the adult Japanese beetle, Popillia japonica. J. Invertebr. Pathol. 2013, 113, 123–128. [Google Scholar] [CrossRef]
  63. Geng, L.; Chi, J.; Shu, C.; Gresshoff, P.M.; Song, F.; Huang, D.; Zhang, J. A chimeric cry8Ea1 gene flanked by MARs efficiently controls Holotrichia parallela. Plant Cell Rep. 2013, 32, 1211–1218. [Google Scholar] [CrossRef]
  64. Shah, J.V.; Yadav, R.; Ingle, S.S. Engineered Cry1Ac-Cry9Aa hybrid Bacillus thuringiensis delta-endotoxin with improved insecticidal activity against Helicoverpa armigera. Arch. Microbiol. 2017, 199, 1069–1075. [Google Scholar] [CrossRef] [PubMed]
  65. Kwadha, C.A.; Ong’amo, G.O.; Ndegwa, P.N.; Raina, S.K.; Fombong, A.T. The biology and control of the greater wax moth, Galleria mellonella. Insects 2017, 8, 61. [Google Scholar] [CrossRef] [Green Version]
  66. Hafeez, M.; Ullah, F.; Khan, M.M.; Li, X.; Zhang, Z.; Shah, S.; Imran, M.; Assiri, M.A.; Fernández-Grandon, G.M.; Desneux, N.; et al. Metabolic-based insecticide resistance mechanism and eco-friendly approaches for controlling of beet armyworm Spodoptera exigua: A review. Environ. Sci. Pollut. Res. Int. 2022, 29, 1746–1762. [Google Scholar] [CrossRef]
  67. Kalman, S.; Kiehne, K.L.; Libs, J.L.; Yamamoto, T. Cloning of a novel cryIC-type gene from a strain of Bacillus thuringiensis subsp. galleriae. Appl. Environ. Microbiol. 1993, 59, 1131–1137. [Google Scholar] [CrossRef] [Green Version]
  68. Mahi, T.; Harizia, A.; Benguerai, A.; Canelo, T.; Bonal, R. Assessment and forecast of damages caused by Cydia pomonella in apple orchards of Northern Africa (Algeria). Bull. Insectol. 2021, 74, 139–146. Available online: http://www.bulletinofinsectology.org/pdfarticles/vol74-2021-139-146mahi.pdf (accessed on 4 June 2023).
  69. Peer review of the pesticide risk assessment of the active substance Bacillus thuringiensis subsp. kurstaki strain ABTS-351. EFSA J. 2021, 19, 6879. [CrossRef]
  70. Lone, R.A.; Lone, T.A.; Sharma, G.R.; Govindaraju, S.; Arulselvi, P.I. Cry1 holotype toxins of Bacillus thuringiensis. J. Pharm. Res. 2013, 6, 481–487. [Google Scholar] [CrossRef]
  71. Soberón, M.; Gill, S.S.; Bravo, A. Signaling versus punching hole: How do Bacillus thuringiensis toxins kill insect midgut cells? Cell. Mol. Life Sci. 2009, 66, 1337–1349. [Google Scholar] [CrossRef] [PubMed]
  72. Ben-Dov, E. Bacillus thuringiensis subsp. israelensis and its dipteran-specific toxins. Toxins 2014, 6, 1222–1243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Güney, G.; Cedden, D.; Hänniger, S.; Heckel, D.G.; Coutu, C.; Hegedus, D.D.; Mutlu, D.A.; Suludere, Z.; Sezen, K.; Güney, E.; et al. Silencing of an ABC transporter, but not a cadherin, decreases the susceptibility of Colorado potato beetle larvae to Bacillus thuringiensis ssp. tenebrionis Cry3Aa toxin. Arch. Insect Biochem. Physiol. 2021, 108, e21834. [Google Scholar] [CrossRef]
  74. Djenane, Z.; Nateche, F.; Amziane, M.; Gomis-Cebolla, J.; El-Aichar, F.; Khorf, H.; Ferré, J. Assessment of the Antimicrobial Activity and the Entomocidal Potential of Bacillus thuringiensis Isolates from Algeria. Toxins 2017, 9, 139. [Google Scholar] [CrossRef] [Green Version]
  75. Shankar, K.; Prabakaran, G.; Manonmani, A.M. WDP formulations using a novel mosquitocidal bacteria, Bacillus thuringiensis subsp. israelensis/tochigiensis (VCRC B-474)—Development and storage stability. Acta Tropica 2019, 193, 158–162. [Google Scholar] [CrossRef]
  76. Azizoglu, U.; Ayvaz, A.; Yılmaz, S.; Karabörklü, S.; Temizgul, R. Expression of cry1Ab gene from a novel Bacillus thuringiensis strain SY49-1 active on pest insects. Braz. J. Microbiol. 2016, 47, 597–602. [Google Scholar] [CrossRef] [Green Version]
  77. Wanapaisan, P.; Chumsakul, O.; Panbangred, W. Enhanced Cry1Da production in Bacillus thuringiensis by driving expression from the σE-dependent BtI promoter. J. Appl. Microbiol. 2013, 115, 859–871. [Google Scholar] [CrossRef]
  78. Rosas-García, N.M.; Mireles-Martínez, M.; Hernández-Mendoza, J.L.; Ibarra, J.E. Screening of cry gene contents of Bacillus thuringiensis strains isolated from avocado orchards in Mexico, and their insecticidal activity towards Argyrotaenia sp. (Lepidoptera: Tortricidae) larvae. J. Appl. Microbiol. 2008, 104, 224–230. [Google Scholar] [CrossRef]
  79. Ramasamy, A.; Suresh, M.; Mallesh, M.S.H. Toxicity evaluation of Aphidicidal crystalliferous toxins from Bacillus thuringiensis strains: A molecular study. Ann. Microbiol. 2020, 70, 52. [Google Scholar] [CrossRef]
  80. Kajitani, R.; Yoshimura, D.; Okuno, M.; Minakuchi, Y.; Kagoshima, H.; Fujiyama, A.; Kubokawa, K.; Kohara, Y.; Toyoda, A.; Itoh, T. Platanus-allee is a de novo haplotype assembler enabling a comprehensive access to divergent heterozygous regions. Nat. Commun. 2019, 10, 1702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  81. Simao, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Meier-Kolthoff, J.P.; Sardà Carbasse, J.; Peinado-Olarte, R.L.; Göker, M. TYGS and LPSN: A database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acid Res. 2022, 50, D801–D807. [Google Scholar] [CrossRef]
  83. Carattoli, A.; Zankari, E.; Garcia-Fernandez, A.; Voldby Larsen, M.; Lund, O.; Villa, L.; Aarestrup, F.M.; Hasman, H. PlasmidFinder and pMLST: In silico detection and typing of plasmids. Antimicrob. Agents Chemother. 2014, 58, 3895–3903. [Google Scholar] [CrossRef] [Green Version]
  84. Blin, K.; Shaw, S.; Augustijn, H.E.; Reitz, Z.L.; Biermann, F.; Alanjary, M.; Fetter, A.; Terlouw, B.R.; Metcalf, W.W.; Helfrich, R.J.N.; et al. antiSMASH 7.0: New and improved predictions for detection, regulation, chemical structures, and visualization. Nucleic Acids Res. 2023, 51, W46–W50. [Google Scholar] [CrossRef]
  85. van Frankenhuyzen, K. Insecticidal activity of Bacillus thuringiensis crystal proteins. J. Invertebr. Pathol. 2009, 101, 1–16. [Google Scholar] [CrossRef]
  86. van Frankenhuyzen, K.; Tonon, A. Activity of Bacillus thuringiensis cyt1Ba crystal protein against hymenopteran forest pests. J. Invertebr. Pathol. 2013, 113, 160–162. [Google Scholar] [CrossRef]
  87. Tsigoriyna, L.; Ganchev, D.; Petrova, P.; Petrov, K. Highly Efficient 2,3-Butanediol Production by Bacillus licheniformis via Complex Optimization of Nutritional and Technological Parameters. Fermentation 2021, 7, 118. [Google Scholar] [CrossRef]
Ijms 24 11137 g001 550
Figure 1. Bootstrapped phylogenetic tree of the newly isolated strains PL1, PL3, PL20, BTG, 30, 38, and 40 based on 16S rRNA gene sequences inferred using the UPGMA method [32]. The evolutionary distances were computed using the Maximum Composite Likelihood method [33]; evolutionary analyses were conducted in the MEGA11 program [34]. In the comparison sequences, the following NCBI GenBank accession numbers were used: OR084785 (PL1), OR084784 (PL3), OR084783 (PL20), JASNQP000000000 (BTG), OR084786 (30), OR084787 (38), OR084788 (40), MN396730 (ATCC 10792), NZ_CP083101 (ABTS-351), OL721864 (Bti-Pk), CP010089 (HD29), GCA021651035 (X023), and AM980865.1 (ATCC 35218).
Figure 1. Bootstrapped phylogenetic tree of the newly isolated strains PL1, PL3, PL20, BTG, 30, 38, and 40 based on 16S rRNA gene sequences inferred using the UPGMA method [32]. The evolutionary distances were computed using the Maximum Composite Likelihood method [33]; evolutionary analyses were conducted in the MEGA11 program [34]. In the comparison sequences, the following NCBI GenBank accession numbers were used: OR084785 (PL1), OR084784 (PL3), OR084783 (PL20), JASNQP000000000 (BTG), OR084786 (30), OR084787 (38), OR084788 (40), MN396730 (ATCC 10792), NZ_CP083101 (ABTS-351), OL721864 (Bti-Pk), CP010089 (HD29), GCA021651035 (X023), and AM980865.1 (ATCC 35218).
Ijms 24 11137 g001
Ijms 24 11137 g002 550
Figure 2. Scanning electron microscope (SEM) images demonstrating the synthesis of crystalline toxins by B. thuringiensis strains PL1 and PL20. SEM micrographs show the surface architecture of three different types of synthesized crystals, marked with black arrows. (a) B. thuringiensis PL1, bipyramidal crystals; (b) B. thuringiensis PL1, polygonal crystals; (c) B. thuringiensis PL20, bipyramidal crystals; (d) B. thuringiensis PL20, spherical crystals. Designations: B, bipyramidal crystal; PO, polygonal crystal; Sph, spherical crystal; S, spore; black star—vegetative cells. The higher magnification shows the geometry of the crystal. Bar = 2 µm.
Figure 2. Scanning electron microscope (SEM) images demonstrating the synthesis of crystalline toxins by B. thuringiensis strains PL1 and PL20. SEM micrographs show the surface architecture of three different types of synthesized crystals, marked with black arrows. (a) B. thuringiensis PL1, bipyramidal crystals; (b) B. thuringiensis PL1, polygonal crystals; (c) B. thuringiensis PL20, bipyramidal crystals; (d) B. thuringiensis PL20, spherical crystals. Designations: B, bipyramidal crystal; PO, polygonal crystal; Sph, spherical crystal; S, spore; black star—vegetative cells. The higher magnification shows the geometry of the crystal. Bar = 2 µm.
Ijms 24 11137 g002
Ijms 24 11137 g003 550
Figure 3. Scanning electron microscope (SEM) images demonstrating the synthesis of crystalline toxins by B. thuringiensis strains BTG and PL3. SEM micrographs show the surface architecture of three different types of synthesized crystals, marked with black arrows. (a) B. thuringiensis BTG, spherical crystals; (b) B. thuringiensis BTG, cubic crystals; (c) B. thuringiensis BTG, cubic crystals; (d) B. thuringiensis PL3, bipyramidal crystals. Designations: B, bipyramidal crystal; CU, cubic crystal; Sph, spherical crystal; S, spore; black star—vegetative cells. The higher magnification shows the geometry of the crystal; Bar = 2–5 µm.
Figure 3. Scanning electron microscope (SEM) images demonstrating the synthesis of crystalline toxins by B. thuringiensis strains BTG and PL3. SEM micrographs show the surface architecture of three different types of synthesized crystals, marked with black arrows. (a) B. thuringiensis BTG, spherical crystals; (b) B. thuringiensis BTG, cubic crystals; (c) B. thuringiensis BTG, cubic crystals; (d) B. thuringiensis PL3, bipyramidal crystals. Designations: B, bipyramidal crystal; CU, cubic crystal; Sph, spherical crystal; S, spore; black star—vegetative cells. The higher magnification shows the geometry of the crystal; Bar = 2–5 µm.
Ijms 24 11137 g003
Table
Table 1. PCR screening for cry genes in B. thuringiensis strains.
Table 1. PCR screening for cry genes in B. thuringiensis strains.
Straincry Genes
SequencedPCR ProductNot Presented
BTGcry1Ab35, cry2Ab,
cry9Ba2		cry7Aacry1Aa, cry2Aa, cry3Aa, cry5A, cry8Ba2, cry9Ca, cry9Da, cry11A, cry15A, cry22A
PL1cry1Abcry7Aa, cry8Ba2cry1Aa, cry2Aa, cry3Aa, cry5A, cry9Ca, cry9Da, cry11A, cry15A, cry22A
PL3cry1Abcry7Aa, cry8Ba2
PL20cry1Abcry7Aa, cry8Ba2
30-cry1Abcry1Aa, cry2Aa, cry3Aa, cry5A, cry7Aa, cry8Ba2, cry9Ca, cry9Da, cry11A, cry22A
40-cry1Ab
38-cry11A
Table
Table 2. Summarized BLAST comparison of de novo sequenced genome of B. thuringiensis strain BTG with B. thuringiensis genomes (NCBI GenBank database).
Table 2. Summarized BLAST comparison of de novo sequenced genome of B. thuringiensis strain BTG with B. thuringiensis genomes (NCBI GenBank database).
Sequence (Accession Number)Species/StrainBTG Genome Contigs
(Number)		Total Length with >99% Homology
(bp)
CP045585.1B. thuringiensis strain X023661,958,310
CP010089.1B. thuringiensis serovar galleriae HD-2922750,128
CP004858.1B. thuringiensis serovar kurstaki YBT-15205442,012
CP083156.1B. thuringiensis ABTS-18572391,953
CP004069.1B. thuringiensis serovar kurstaki HD734328,551
CP013055.1B. thuringiensis YWC2-86289,587
Table
Table 3. Cry genes encoding crystal δ-toxins in B. thuringiensis BTG.
Table 3. Cry genes encoding crystal δ-toxins in B. thuringiensis BTG.
NameGene
(bp)		Cry Protein
(Amino Acids)		Cry Protein
(kDa) †		Gene Homology
(GenBank Accession No.)		Reference
cry1Ab3535461181133.5KT692985 (100%)[39]
cry1Db34831160131.0AF358862 (99%)[40]
cry1Fb35251174133.3AF336114 (100%)[41]
cry8Ea135011166132.1WP_033698569 (100%)[42]
cry1Ib216071981.5BTU07642, EU677422 (99.9%)[43]
cry2Ab190263370.7ON508057 (100%)[44]
cry9Ba233541117126.4GU299522 (100%)[45]
cry9Aa *27691-JX174110 (100%)[46]
cry1Ac *13544-CP076540 (100%)[47]
* Partial sequence; † computed molecular weight.
Table
Table 4. Predicted insecticidal activity of the Cry-proteins of B. thuringiensis isolated in Bulgaria in comparison with literature data.
Table 4. Predicted insecticidal activity of the Cry-proteins of B. thuringiensis isolated in Bulgaria in comparison with literature data.
Cry ToxinsB. thuringiensis SerovarStrainTargetReference
1Aa, 1Ab, 1Ac, 2Aa, 2AbkurstakiABTS-351Lepidoptera[69]
1Aa, 1Ab, 1Ac, 2AakurstakiHD1Lepidoptera[70]
1AckurstakiHD73Lepidoptera[70]
1Aa, 1Ba, 1Ca, 1DaaizawaiHD137Lepidoptera[71]
1Aa, 2Ba, 4Aa, 4Ba, 10Aaisraelensis-Diptera[72]
3Aatenebrionis-Coleoptera[73]
1Aa, 1Ac, 1Ca, 1Da, 1Ia, 2Ab, 9EagalleriaeHD-29Lepidoptera[36]
8DagalleriaeSDS-502Coleoptera[51]
1Ab, 1Db, 1Fb, 1Ib, 2Ab, 8Ea1, 9Ba2 galleriaeBTGLepidoptera
Coleoptera		This study
1Ab, 7Aa, 8Ba2-PL1, PL3, PL20Lepidoptera
Coleoptera		This study
1Ab-30, 40LepidopteraThis study
11A-38LepidopteraThis study
Table
Table 5. Isolation of B. thuringiensis strains: geographical location of sampling sites in Bulgaria.
Table 5. Isolation of B. thuringiensis strains: geographical location of sampling sites in Bulgaria.
Species/StrainSourceRegion/TownCoordinates
Bt serovar galleriae BTGLoam soil, rice rhizospherePlovdiv, TrudN 42°14′, E 24°44′
B. thuringiensis PL1Loam soil, rice rhizosphereTsaratsovoN 42°12′, E 24°41′
B. thuringiensis PL3Waterlogged clay soilGelemenovoN 42°16′, E 24°19′
B. thuringiensis PL20Loam soil, rice rhizosphereKurtovo KonareN 42°06′, E 24°30′
B. thuringiensis 30Loam soil, maize fieldTargovishteN 43°16′, E 26°23′
B. thuringiensis 38Loam soilVeliko TarnovoN 43°04′, E 25°37′
B. thuringiensis 40Silt/Sandy soilShablaN 43°37′, E 28°31′
Table
Table 6. Cry genes selected for PCR screening in B. thuringiensis strains.
Table 6. Cry genes selected for PCR screening in B. thuringiensis strains.
EndotoxinTargetGene
(bp)		PCR Fragment
(bp)		Primers
(5′-3′)		Accession Number (NCBI)
1AaLepidoptera
Diptera		3543704F: TCAAATTATGATAGTCGAAG
R: CCAAGATTAGTAGATTTTGTTA		KM924540
1Aa 1Lepidoptera
Diptera		4222951F: TGGCTCTGGAACTTCTGTCG
R: TTCGGCTCTCCACACTTTCC		M11250
1AbLepidoptera
Gastropoda		51391132F: CTCCTGTAGGGTTTTCGGGG
R: CTCCAGCCACGGTCTAGTTG		AF358861
2Aa/2AbLepidoptera
Diptera
Hemiptera		1902559F: TAGTGGACCACAGCAGACAC
R: TACCAAATAGGCCCGTGCTC		MK184464
JN226103
3AaColeoptera
Hemiptera
Hymenoptera		29831265F: ATAGCCAGGGGCGGATAAGA
R: TGCCCCGTCTAAACTGAGTG		AJ237900
5AHymenoptera
Rhabditida		4377743F: CACCACCAGGATTGTCTCCAT
R: CGTCCAATTGGCTGCATCTT		EF219060
7Aa 2Coleoptera34171764F: CCCGATCTTTTCTTGGACGC
R: ATTCCTATCTTGCGCGCTGT		MK840959
8Ba2 3Coleoptera35101093F: TTTAACGGACCGCATCGGAA
R: TGCGTCTCCTGACAAAGGTC		MZ355710
9Ca 4Lepidoptera57721954F: GGATGGGGATTCACACAGGG
R: GTGTTTGAGCCGCTTCACAG		Z37527
9Da/9Ba2Coleoptera
Lepidoptera		3456
3495		2181F: TGCACAAGCAGCAAACCTTC
R: TCACCCGATAATGGCCCAAC		GQ249295
GU299522
11AaDiptera
Hemiptera		19411476F: AACCTACTATTGCGCCAGCA
R: TACTGCCGTCTGTTGCTTGA		MK184471
15A 5Lepidoptera22591628F: GGGGGTGGTAAGCCTGAAAT
R: CTCTCGTCGTTGCTGTTCCT		M76442
22ALepidoptera
Coleoptera
Hymenoptera		21691631F: TAGGCGATTCGTTTGGGCAT
R: GAAAACTGGCGGCTCTTCTG		EU715020
1 High level of homology between cry1Aa/1Ab > 93%; 2 Toxin active against Colorado beetle larvae [86]; 3 Toxin active against Colorado beetle imago; 4 Broad-spectrum toxins against several Lepidopteran families such as Pyralidae, Plutellidae, Sphingidae, and Noctuidae. Toxic against the larvae of moths of the Noctuidae family [86]; 5 An unidentified novel toxin identical in sequence to cry15 (MN557412).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Arsov, A.; Gerginova, M.; Paunova-Krasteva, T.; Petrov, K.; Petrova, P. Multiple cry Genes in Bacillus thuringiensis Strain BTG Suggest a Broad-Spectrum Insecticidal Activity. Int. J. Mol. Sci. 2023, 24, 11137. https://doi.org/10.3390/ijms241311137

AMA Style

Arsov A, Gerginova M, Paunova-Krasteva T, Petrov K, Petrova P. Multiple cry Genes in Bacillus thuringiensis Strain BTG Suggest a Broad-Spectrum Insecticidal Activity. International Journal of Molecular Sciences. 2023; 24(13):11137. https://doi.org/10.3390/ijms241311137

Chicago/Turabian Style

Arsov, Alexander, Maria Gerginova, Tsvetelina Paunova-Krasteva, Kaloyan Petrov, and Penka Petrova. 2023. "Multiple cry Genes in Bacillus thuringiensis Strain BTG Suggest a Broad-Spectrum Insecticidal Activity" International Journal of Molecular Sciences 24, no. 13: 11137. https://doi.org/10.3390/ijms241311137

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop