Compressed Prostate Cancer Cells Decrease Osteoclast Activity While Enhancing Osteoblast Activity In Vitro
Abstract
1. Introduction
2. Results
2.1. Compression Decreases Total DNA in DU145 Cell Cultures
2.2. Compression Affects EMT-Related Gene Expression in DU145 Cells
2.3. Conditioned Medium from Compressed DU145 Cells Decreases the Resorptive Activity of Osteoclasts
2.4. Conditioned Medium from Compressed DU145 Cells Stimulates Bone Nodule Production by Osteogenic-Differentiated hASCs from the Majority of Donors
2.5. Conditioned Medium from DU145 Cells Contains More IL6 Compared to the Control Medium
3. Discussion
Limitations
4. Materials and Methods
4.1. Cell Cultures
4.2. Compression on Prostate Cancer Cells
4.3. RNA Isolation
4.4. cDNA Synthesis
4.5. qPCR
4.6. LEGENDplex Protein Quantification
4.7. Total DNA and Protein/DNA Quantification
4.8. CD14+ Monocyte Isolation and Osteoclastogenesis
4.9. TRACP and DAPI Staining
4.10. Resorption Assay
4.11. Osteoblastogenesis
4.12. Mineralization Assay
4.13. Statistical Analysis
5. Conclusions
6. Supplementary Paragraph 1: Rationale for Genes to Assess EMT
6.1. Intrinsic EMT-Related Proteins
6.2. EMT-Related Signaling Molecules
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA. Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- The American Cancer Society. 1.800.227.2345. 2020. Available online: https://www.cancer.org (accessed on 11 February 2021).
- Wu, C.H.; Lan, Y.J.; Wang, C.H.; Wu, M.S. Hypercalcemia in prostate cancer with positive neuron-specific enolase stain. Ren. Fail. 2004, 26, 325–327. [Google Scholar] [CrossRef] [PubMed]
- Dafermou, A.; Colamussi, P.; Giganti, M.; Cittanti, C.; Bestagno, M.; Piffanelli, A. A multicentre observational study of radionuclide therapy in patients with painful bone metastases of prostate cancer. Eur. J. Nucl. Med. 2001, 28, 788–798. [Google Scholar] [CrossRef] [PubMed]
- Luz, M.A.; Aprikian, A.G. Preventing bone complications in advanced prostate cancer. Curr. Oncol. 2010, 17, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Logothetis, C.J.; Lin, S.H. Osteoblasts in prostate cancer metastasis to bone. Nat. Rev. Cancer 2005, 5, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Fudge, K.; Wang, C.Y.; Stearns, M.E. Immunohistochemistry analysis of platelet-derived growth factor A and B chains and platelet-derived growth factor alpha and beta receptor expression in benign prostatic hyperplasias and Gleason-graded human prostate adenocarcinomas. Mod. Pathol. 1994, 7, 549–554. [Google Scholar] [PubMed]
- Isaacs, J.T.; Matsui, S.I.; Wada, F. Heparin Binding Affinity of Rat Prostatic Growth Factor in Normal and Cancerous Prostates: Partial Purification and Characterization of Rat Prostatic Growth Factor in the Dunning Tumor. Cancer Res. 1987, 47, 188–192. [Google Scholar]
- Ferrer, F.A.; Miller, L.J.; Andrawis, R.I.; Kurtzman, S.H.; Albertsen, P.C.; Laudone, V.P.; Kreutzer, D.L. Vascular endothelial growth factor (VEGF) expression in human prostate cancer: In situ and in vitro expression of VEGF by human prostate cancer cells. J. Urol. 1997, 157, 2329–2333. [Google Scholar] [CrossRef]
- Koutsilieris, M. Osteoblastic metastasis in advanced prostate cancer. Anticancer Res. 1993, 13, 443–449. [Google Scholar]
- Cramer, S.D.; Chen, Z.; Peehl, D.M. Prostate specific antigen cleaves parathyroid hormone-related protein in the PTH-like domain: Inactivation of PTHrP-stimulated cAMP accumulation in mouse osteoblasts. J. Urol. 1996, 156, 526–531. [Google Scholar] [CrossRef]
- Azevedo, A. IL-6/IL-6R as a potential key signaling pathway in prostate cancer development. World J. Clin. Oncol. 2011, 2, 384. [Google Scholar] [CrossRef] [PubMed]
- Kaneshiro, S.; Ebina, K.; Shi, K.; Higuchi, C.; Hirao, M.; Okamoto, M.; Koizumi, K.; Morimoto, T.; Yoshikawa, H.; Hashimoto, J. IL-6 negatively regulates osteoblast differentiation through the SHP2/MEK2 and SHP2/Akt2 pathways in vitro. J. Bone Miner. Metab. 2014, 32, 378–392. [Google Scholar] [CrossRef] [PubMed]
- Das, J.; Chakraborty, S.; Maiti, T.K. Mechanical stress-induced autophagic response: A cancer-enabling characteristic? Semin. Cancer Biol. 2020, 66, 101–109. [Google Scholar] [CrossRef] [PubMed]
- de Gusmão, C.V.B.; Belangero, W.D. How Do Bone Cells Sense Mechanical Loading? Rev. Bras. Ortop. Engl. Ed. 2009, 44, 299–305. [Google Scholar] [CrossRef] [PubMed]
- Schaffler, M.B.; Cheung, W.Y.; Majeska, R.; Kennedy, O. Osteocytes: Master orchestrators of bone. Calcif. Tissue Int. 2014, 94, 5–24. [Google Scholar] [CrossRef]
- Kumar, R.; Godavarthy, P.S.; Krause, D.S. The bone marrow microenvironment in health and disease at a glance. J. Cell Sci. 2018, 131, jcs201707. [Google Scholar] [CrossRef]
- Currey, J. The structure and mechanical properties of bone. In Bioceramics and Their Clinical Applications; Kokubo, T., Ed.; Elsevier: Amsterdam, The Netherlands, 2008; ISBN 1845694228. [Google Scholar]
- Levayer, R. Solid stress, competition for space and cancer: The opposing roles of mechanical cell competition in tumour initiation and growth. Semin. Cancer Biol. 2020, 63, 69–80. [Google Scholar] [CrossRef]
- Sottnik, J.L.; Dai, J.; Zhang, H.; Campbell, B.; Keller, E.T. Tumor-induced pressure in the bone microenvironment causes osteocytes to promote the growth of prostate cancer bone metastases. Cancer Res. 2015, 75, 2151–2158. [Google Scholar] [CrossRef]
- Tse, J.M.; Cheng, G.; Tyrrell, J.A.; Wilcox-Adelman, S.A.; Boucher, Y.; Jain, R.K.; Munn, L.L. Mechanical compression drives cancer cells toward invasive phenotype. Proc. Natl. Acad. Sci. USA 2012, 109, 911–916. [Google Scholar] [CrossRef]
- Kim, B.G.; Sung, J.S.; Jang, Y.; Cha, Y.J.; Kang, S.; Han, H.H.; Lee, J.H.; Cho, N.H. Compression-induced expression of glycolysis genes in CAFs correlates with EMT and angiogenesis gene expression in breast cancer. Commun. Biol. 2019, 2, 1–15. [Google Scholar] [CrossRef]
- Kim, B.G.; Gao, M.Q.; Kang, S.; Choi, Y.P.; Lee, J.H.; Kim, J.E.; Han, H.H.; Mun, S.G.; Cho, N.H. Mechanical compression induces VEGFA overexpression in breast cancer via DNMT3A-dependent miR-9 downregulation. Cell Death Dis. 2017, 8, e2646. [Google Scholar] [CrossRef] [PubMed]
- Kalli, M.; Voutouri, C.; Minia, A.; Pliaka, V.; Fotis, C.; Alexopoulos, L.G.; Stylianopoulos, T. Mechanical compression regulates brain cancer cell migration through MEK1/Erk1 pathway activation and GDF15 expression. Front. Oncol. 2019, 9, 992. [Google Scholar] [CrossRef] [PubMed]
- Ago, T.; Sadoshima, J. GDF15, a cardioprotective TGF-β superfamily protein. Circ. Res. 2006, 98, 294–297. [Google Scholar] [CrossRef] [PubMed]
- The American Cancer Society Survival Rates for Prostate Cancer. Available online: https://www.cancer.org/cancer/prostate-cancer/detection-diagnosis-staging/survival-rates.html (accessed on 19 February 2021).
- Sun, X.; Kaufman, P.D. Ki-67: More than a proliferation marker. Chromosoma 2018, 127, 175–186. [Google Scholar] [CrossRef]
- Culig, Z.; Puhr, M. Interleukin-6 and prostate cancer: Current developments and unsolved questions. Mol. Cell. Endocrinol. 2018, 462, 25–30. [Google Scholar] [CrossRef]
- Ali, M.S.; Al-Rubaei, S.H.; Ahmed, N.S. Tumor necrosis factor alpha as a potential marker for prostate cancer. J. Biotechnol. Res. Cent. 2020, 14, 5–9. [Google Scholar] [CrossRef]
- Yoshitake, F.; Itoh, S.; Narita, H.; Ishihara, K.; Ebisu, S. Interleukin-6 directly inhibits osteoclast differentiation by suppressing receptor activator of NF-κB signaling pathways. J. Biol. Chem. 2008, 283, 11535–11540. [Google Scholar] [CrossRef]
- Nakchbandi, I.A.; Weir, E.E.; Insogna, K.L.; Philbrick, W.M.; Broadus, A.E. Parathyroid hormone-related protein induces spontaneous osteoclast formation via a paracrine cascade. Proc. Natl. Acad. Sci. USA 2000, 97, 7296–7300. [Google Scholar] [CrossRef]
- Kasagi, S.; Chen, W. TGF-beta1 on osteoimmunology and the bone component cells. Cell Biosci. 2013, 3, 1–7. [Google Scholar] [CrossRef]
- Rifkin, D.B. Latent transforming growth factor-β (TGF-β) binding proteins: Orchestrators of TGF-β availability. J. Biol. Chem. 2005, 280, 7409–7412. [Google Scholar] [CrossRef]
- Hinoi, E.; Ochi, H.; Takarada, T.; Nakatani, E.; Iezaki, T.; Nakajima, H.; Fujita, H.; Takahata, Y.; Hidano, S.; Kobayashi, T.; et al. Positive regulation of osteoclastic differentiation by growth differentiation factor 15 upregulated in osteocytic cells under hypoxia. J. Bone Miner. Res. 2012, 27, 938–949. [Google Scholar] [CrossRef] [PubMed]
- Vaňhara, P.; Lincová, E.; Kozubík, A.; Jurdic, P.; Souček, K.; Šmarda, J. Growth/differentiation factor-15 inhibits differentiation into osteoclasts-A novel factor involved in control of osteoclast differentiation. Differentiation 2009, 78, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.; Li, X.; Koh, A.J.; Berry, J.E.; Thudi, N.; Rosol, T.J.; Pienta, K.J.; McCauley, L.K. Tumor expressed PTHrP facilitates prostate cancer-induced osteoblastic lesions. Int. J. Cancer 2008, 123, 2267–2278. [Google Scholar] [CrossRef] [PubMed]
- Westhrin, M.; Moen, S.H.; Holien, T.; Mylin, A.K.; Heickendorff, L.; Olsen, O.E.; Sundan, A.; Turesson, I.; Gimsing, P.; Waage, A.; et al. Growth differentiation factor 15 (GDF15) promotes osteoclast differentiation and inhibits osteoblast differentiation and high serum GDF15 levels are associated with multiple myeloma bone disease. Haematologica 2015, 100, e511–e514. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Deng, C.; Li, Y.P. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272–288. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, X.; Zhao, D.; Liu, B.; Wang, B.; Yu, W.; Li, J.; Yu, X.; Cao, F.; Zheng, G.; et al. TGF-β1 promotes the osteoinduction of human osteoblasts via the PI3K/AKT/mTOR/S6K1 signalling pathway. Mol. Med. Rep. 2019, 49, 3505–3518. [Google Scholar] [CrossRef]
- Hao, Y.; Baker, D.; Dijke, P. Ten TGF-β-mediated epithelial-mesenchymal transition and cancer metastasis. Int. J. Mol. Sci. 2019, 20, 2767. [Google Scholar] [CrossRef]
- Miao, D.; He, B.; Jiang, Y.; Kobayashi, T.; Sorocéanu, M.A.; Zhao, J.; Su, H.; Tong, X.; Amizuka, N.; Gupta, A.; et al. Osteoblast-derived PTHrP is a potent endogenous bone anabolic agent that modifies the therapeutic efficacy of administered PTH 1-34. J. Clin. Investig. 2005, 115, 2402–2411. [Google Scholar] [CrossRef]
- Ongkeko, W.M.; Burton, D.; Kiang, A.; Abhold, E.; Kuo, S.Z.; Rahimy, E.; Yang, M.; Hoffman, R.M.; Wang-Rodriguez, J.; Deftos, L.J. Parathyroid hormone related-protein promotes epithelial-to-mesenchymal transition in prostate cancer. PLoS ONE 2014, 9, e85803. [Google Scholar] [CrossRef]
- Ishimi, Y.; Miyaura, C.; Jin, C.H.; Akatsu, T.; Abe, E.; Nakamura, Y.; Yamaguchi, A.; Yoshiki, S.; Matsuda, T.; Hirano, T. IL-6 is produced by osteoblasts and induces bone resorption. J. Immunol. 1990, 145, 3297–3303. [Google Scholar]
- McHugh, J. B cell-derived IL-6 promotes disease. Nat. Rev. Rheumatol. 2017, 13, 633. [Google Scholar] [CrossRef] [PubMed]
- Miao, J.W.; Liu, L.J.; Huang, J. Interleukin-6-induced epithelial-mesenchymal transition through signal transducer and activator of transcription 3 in human cervical carcinoma. Int. J. Oncol. 2014, 45, 165–176. [Google Scholar] [CrossRef] [PubMed]
- Atzeni, F.; Sarzi-Puttini, P. Tumor Necrosis Factor. In Brenner’s Encyclopedia of Genetics, 2nd ed.; Academic Press: Cambridge, MA, USA, 2013; pp. 229–231. ISBN 9780080961569. [Google Scholar]
- Li, C.W.; Xia, W.; Huo, L.; Lim, S.O.; Wu, Y.; Hsu, J.L.; Chao, C.H.; Yamaguchi, H.; Yang, N.K.; Ding, Q.; et al. Epithelial-mesenchymal transition induced by TNF-α requires NF-κB-mediated transcriptional upregulation of Twist1. Cancer Res. 2012, 72, 1290–1300. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, J.; Kong, J.; Tang, J.; Wu, Y.; Xu, E.; Zhang, H.; Lai, M. GDF15 promotes EMT and metastasis in colorectal cancer. Oncotarget 2016, 7, 860–872. [Google Scholar] [CrossRef] [PubMed]
- Bae, J.S.; Ryu, G.; Kim, J.H.; Kim, E.H.; Rhee, Y.H.; Chung, Y.J.; Kim, D.W.; Lim, S.; Chung, P.S.; Shin, H.W.; et al. Effects of Wnt signaling on epithelial to mesenchymal transition in chronic rhinosinusitis with nasal polyp. Thorax 2020, 75, 982–993. [Google Scholar] [CrossRef] [PubMed]
- Nemeth, J.A.; Harb, J.F.; Barroso, U.; He, Z.; Grignon, D.J.; Cher, M.L. Severe combined immunodeficient-hu model of human prostate cancer metastasis to human bone. Cancer Res. 1999, 59, 1987–1993. [Google Scholar]
- Podgorski, I.; Linebaugh, B.E.; Sameni, M.; Jedeszko, C.; Bhagat, S.; Cher, M.L.; Sloane, B.F. Bone microenvironment modulates expression and activity of cathepsin B in prostate cancer. Neoplasia 2005, 7, 207–223. [Google Scholar] [CrossRef]
- Ha, B.; Ko, H.; Kim, B.; Sohn, E.J.; Jung, J.H.; Kim, J.S.; Yoon, J.J.; Won, G.; Kim, J.H.; Jung, D.B.; et al. Regulation of crosstalk between epithelial to mesenchymal transition molecules and MMP-9 mediates the antimetastatic activity of anethole in DU145 prostate cancer cells. J. Nat. Prod. 2014, 77, 63–69. [Google Scholar] [CrossRef]
- Paiva, K.B.S.; Granjeiro, J.M. Matrix Metalloproteinases in Bone Resorption, Remodeling, and Repair. Prog. Mol. Biol. Transl. Sci. 2017, 148, 203–303. [Google Scholar] [CrossRef]
- Edmondson, R.; Adcock, A.F.; Yang, L. Influence of matrices on 3D-cultured prostate cancer cells’ drug response and expression of drug-action associated proteins. PLoS ONE 2016, 11, e0158116. [Google Scholar] [CrossRef]
- Bairoch, A. The cellosaurus, a cell-line knowledge resource. J. Biomol. Tech. 2018, 29, 25–38. [Google Scholar] [CrossRef]
- Crnalic, S.; Hörnberg, E.; Wikström, P.; Lerner, U.H.; Tieva, Å.; Svensson, O.; Widmark, A.; Bergh, A. Nuclear androgen receptor staining in bone metastases is related to a poor outcome in prostate cancer patients. Endocr. Relat. Cancer 2010, 17, 885–895. [Google Scholar] [CrossRef] [PubMed]
- Fujita, K.; Nonomura, N. Role of androgen receptor in prostate cancer: A review. World J. Men’s Health 2019, 37, 288–295. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.K.; Lavrovsky, Y.; Song, C.S.; Chen, S.; Jung, M.H.; Velu, N.K.; Bi, B.Y.; Chatterjee, B. Regulation of Androgen Action. Vitam. Horm. 1998, 55, 309–352. [Google Scholar] [CrossRef]
- Culig, Z.; Bartsch, G.; Hobisch, A. Interleukin-6 regulates androgen receptor activity and prostate cancer cell growth. Mol. Cell. Endocrinol. 2002, 197, 231–238. [Google Scholar] [CrossRef] [PubMed]
- Alimirah, F.; Chen, J.; Basrawala, Z.; Xin, H.; Choubey, D. DU-145 and PC-3 human prostate cancer cell lines express androgen receptor: Implications for the androgen receptor functions and regulation. FEBS Lett. 2006, 580, 2294–2300. [Google Scholar] [CrossRef] [PubMed]
- Varma, M.J.O.; Breuls, R.G.M.; Schouten, T.E.; Jurgens, W.J.F.M.; Bontkes, H.J.; Schuurhuis, G.J.; Van Ham, S.M.; Van Milligen, F.J. Phenotypical and functional characterization of freshly isolated adipose tissue-derived stem cells. Stem Cells Dev. 2007, 16, 91–104. [Google Scholar] [CrossRef]
- Kalli, M.; Papageorgis, P.; Gkretsi, V.; Stylianopoulos, T. Solid Stress Facilitates Fibroblasts Activation to Promote Pancreatic Cancer Cell Migration. Ann. Biomed. Eng. 2018, 46, 657–669. [Google Scholar] [CrossRef]
- Thermo Fisher Scientific. TRIzol Reagent User Guide—Pub. No. MAN0001271—Rev. A.0. User Guide; Thermo Fisher Scientific: Waltham, MA, USA, 2016; Volume 15596018, pp. 1–6. [Google Scholar]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Pfaffl, M. Quantification strategies in real-time PCR. In A-Z of Quantitative PCR; International University Line: La Jolla, CA, USA, 2004; pp. 87–112. ISBN 0963681788. [Google Scholar]
- Davison, N.L.; ten Harkel, B.; Schoenmaker, T.; Luo, X.; Yuan, H.; Everts, V.; Barrère-de Groot, F.; de Bruijn, J.D. Osteoclast resorption of beta-tricalcium phosphate controlled by surface architecture. Biomaterials 2014, 35, 7441–7451. [Google Scholar] [CrossRef]
- Millipore Corporation. MuseTM Cell Analyzer User’s Guide; Millipore Corporation: Burlington, MA, USA, 2012. [Google Scholar]
- de Vries, T.J.; Schoenmaker, T.; Micha, D.; Hogervorst, J.; Bouskla, S.; Forouzanfar, T.; Pals, G.; Netelenbos, C.; Eekhoff, E.M.W.; Bravenboer, N. Periodontal ligament fibroblasts as a cell model to study osteogenesis and osteoclastogenesis in fibrodysplasia ossificans progressiva. Bone 2018, 109, 168–177. [Google Scholar] [CrossRef] [PubMed]
- Fukuyo, S.; Yamaoka, K.; Sonomoto, K.; Oshita, K.; Okada, Y.; Saito, K.; Yoshida, Y.; Kanazawa, T.; Minami, Y.; Tanaka, Y. IL-6-accelerated calcification by induction of ROR2 in human adipose tissue-derived mesenchymal stem cells is STAT3 dependent. Rheumatology 2014, 53, 1282–1290. [Google Scholar] [CrossRef] [PubMed]
- Dudas, J.; Ladanyi, A.; Ingruber, J.; Steinbichler, T.B.; Riechelmann, H. Epithelial to Mesenchymal Transition: A Mechanism that Fuels Cancer Radio/Chemoresistance. Cells 2020, 9, 428. [Google Scholar] [CrossRef] [PubMed]
- Ricciardi, M.; Zanotto, M.; Malpeli, G.; Bassi, G.; Perbellini, O.; Chilosi, M.; Bifari, F.; Krampera, M. Epithelial-to-mesenchymal transition (EMT) induced by inflammatory priming elicits mesenchymal stromal cell-like immune-modulatory properties in cancer cells. Br. J. Cancer 2015, 112, 1067–1075. [Google Scholar] [CrossRef]
- Gheldof, A.; Berx, G. Cadherins and epithelial-to-mesenchymal transition. Prog. Mol. Biol. Transl. Sci. 2013, 116, 317–336. [Google Scholar] [CrossRef]
- Vuoriluoto, K.; Jokinen, J.; Kallio, K.; Salmivirta, M.; Heino, J.; Ivaska, J. Syndecan-1 supports integrin α2β1-mediated adhesion to collagen. Exp. Cell Res. 2008, 314, 3369–3381. [Google Scholar] [CrossRef]
- Wang, X.; He, J.; Zhao, X.; Qi, T.; Zhang, T.; Kong, C. Syndecan-1 suppresses epithelial-mesenchymal transition and migration in human oral cancer cells. Oncol. Rep. 2018, 39, 1835–1842. [Google Scholar] [CrossRef]
- Techasen, A.; Loilome, W.; Namwat, N.; Khuntikeo, N.; Puapairoj, A.; Jearanaikoon, P.; Saya, H.; Yongvanit, P. Loss of E-cadherin promotes migration and invasion of cholangiocarcinoma cells and serves as a potential marker of metastasis. Tumor Biol. 2014, 35, 8645–8652. [Google Scholar] [CrossRef]
- Papiewska-Pajak, I.; Kowalska, M.A.; Boncela, J. Expression and activity of SNAIL transcription factor during Epithelial to Mesenchymal Transition (EMT) in cancer progression. Postepy Hig. Med. Dosw. 2016, 70, 968–980. [Google Scholar] [CrossRef]
- Vesuna, F.; van Diest, P.; Chen, J.H.; Raman, V. Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem. Biophys. Res. Commun. 2008, 367, 235–241. [Google Scholar] [CrossRef]
- Bolós, V.; Peinado, H.; Pérez-Moreno, M.A.; Fraga, M.F.; Esteller, M.; Cano, A. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: A comparison with Snail and E47 repressors. J. Cell Sci. 2003, 116, 499–511. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Du, Y.; Beckford, J.; Alachkar, H. Upregulation of the EMT marker vimentin is associated with poor clinical outcome in acute myeloid leukemia. J. Transl. Med. 2018, 16, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.Y.; Lin, H.H.; Tang, M.J.; Wang, Y.K. Vimentin contributes to epithelial-mesenchymal transition ancer cell mechanics by mediating cytoskeletal organization and focal adhesion maturation. Oncotarget 2015, 6, 15966–15983. [Google Scholar] [CrossRef] [PubMed]
- Meng, J.; Chen, S.; Han, J.X.; Qian, B.; Wang, X.R.; Zhong, W.L.; Qin, Y.; Zhang, H.; Gao, W.F.; Lei, Y.Y.; et al. Twist1 regulates vimentin through Cul2 circular RNA to promote EMT in hepatocellular carcinoma. Cancer Res. 2018, 78, 4150–4162. [Google Scholar] [CrossRef]
- Galbraith, L.C.A.; Mui, E.; Nixon, C.; Hedley, A.; Strachan, D.; MacKay, G.; Sumpton, D.; Sansom, O.J.; Leung, H.Y.; Ahmad, I. PPAR-gamma induced AKT3 expression increases levels of mitochondrial biogenesis driving prostate cancer. Oncogene 2021, 40, 2355–2366. [Google Scholar] [CrossRef]
- Babic, A.M.; Kireeva, M.L.; Kolesnikova, T.V.; Lau, L.F. CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc. Natl. Acad. Sci. USA 1998, 95, 6355–6360. [Google Scholar] [CrossRef]
- Hou, C.H.; Lin, F.L.; Hou, S.M.; Liu, J.F. Cyr61 promotes epithelial-mesenchymal transition and tumor metastasis of osteosarcoma by Raf-1/MEK/ERK/Elk-1/TWIST-1 signaling pathway. Mol. Cancer 2014, 13, 1–13. [Google Scholar] [CrossRef]
- Inoue, K.; Fry, E.A. Novel Molecular Markers for Breast Cancer. Biomark. Cancer 2016, 8, BIC.S38394. [Google Scholar] [CrossRef]
- Yu, L.; Mu, Y.; Sa, N.; Wang, H.; Xu, W. Tumor necrosis factor α induces epithelial-mesenchymal transition and promotes metastasis via NF-κB signaling pathway-mediated TWIST expression in hypopharyngeal cancer. Oncol. Rep. 2014, 31, 321–327. [Google Scholar] [CrossRef]
- Abaurrea, A.; Araujo, A.M.; Caffarel, M.M. The role of the il-6 cytokine family in epithelial–mesenchymal plasticity in cancer progression. Int. J. Mol. Sci. 2021, 22, 8334. [Google Scholar] [CrossRef]
- Zou, H.; Shan, C.; Ma, L.; Liu, J.; Yang, N.; Zhao, J. Polarity and epithelial-mesenchymal transition of retinal pigment epithelial cells in proliferative vitreoretinopathy. PeerJ 2020, 8, e10136. [Google Scholar] [CrossRef] [PubMed]
- Assadi, A.; Zahabi, A.; Hart, R.A. GDF15, an update of the physiological and pathological roles it plays: A review. Pflugers Arch. Eur. J. Physiol. 2020, 472, 1535–1546. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Zeng, X.; He, Y.; Wang, X.; Liang, Z.; Liu, J.; Zhang, P.; Zhu, H.; Xu, N.; Liang, S. STC2 promotes the epithelial-mesenchymal transition of colorectal cancer cells through AKT-ERK signaling pathways. Oncotarget 2016, 7, 71400–71416. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Bergami, P.; Barbero, G. The emerging role of Wnt5a in the promotion of a pro-inflammatory and immunosuppressive tumor microenvironment. Cancer Metastasis Rev. 2020, 39, 933–952. [Google Scholar] [CrossRef]
- Asem, M.S.; Buechler, S.; Wates, R.B.; Miller, D.L.; Stack, M.S. Wnt5a signaling in cancer. Cancers 2016, 8, 79. [Google Scholar] [CrossRef]





| Gene (Human) | Forward | Reverse |
|---|---|---|
| PTHrP | GCCGTAAATCTTGGATGGACTT | AGCGTCGCGGTGTTCCT |
| SYND1 | GCCACCATGAGACCTCAACC | CGGCCACTACAGCCGTATTC |
| Slug | ACTACAGCGAACTGGACAC | GATGAGGAGTATCCGGAAAG |
| Twist | GGCCAGGTACATCGACTTCC | TATCCAGCTCCAGAGTCTCTA |
| IL6 | ACAGCCACTCACCTCTTCA | ACCAGGCAAGTCTCCTCAT |
| TNF-α | AGAGGGCCTGTACCTCATCT | AGGGCAATGATCCCAAAGTAG |
| WNT5a | GTGTCGCTAGGTATGAATAA | CGCGTATGTGAAGGCCGTC |
| PPARγ | CGACCAGCTGAATCCAGAGT | GATGCGGATGGCCACCTCTT |
| TGF-β1 | CTACTACGCCAAGGAGGTCA | CACGTGCTGCTCCACTTT |
| TGF-β2 | GGCACCTCCACATATACCAGT | ATTTCCACCCTAGATCCCTCTT |
| GDF15 | CCTGCAGTCCGGATACTCAC | CGAAGATTCTGCCAGCAGTT |
| CYR61 | TCCGAGGTGGAGTTGACGAGAA | TTCACAAGGCGGCACTCAGG |
| Snail | GGCTGCTACAAGGCCATGTC | CGCCTGGCACTGGTACTTCT |
| KI67 | CCCTCAGCAAGCCTGAGAA | AGAGGCGTATTAGGAGGCAAG |
| VMN | TGCGTCTCTGGCACGTCTTGA | CAGGTTCTTGGCAGCCACACT |
| CDH1 | CTCCTGGCCTCAGAAGACA | GTGGCAATGCGTTCTCTATC |
| 18S | GTAACCCGTTGAACCCATT | GTAACCCGTTGAACCCATT |
| PBGD | TGCAGTTTGAAATCATTGCTATGTC | AACAGGCTTTTCTCTCCAATCTTAG |
| B2M | AGCTGTGCTCGCGCTACTCTC | CACACGGCAGGCATACTCATC |
| Medium | Conditioned by PC (+/− Compression) | Basis | Supplement |
|---|---|---|---|
| Osteoclast medium | No | αMEM | FC1 (10%) |
| PC medium unconditioned (control) | No | EMEM | FBS (10%) |
| CM non-compressed PC cells | Yes | EMEM | FBS (10%) |
| CM compressed PC cells | Yes | EMEM | FBS (10%) |
| Medium | Conditioned by PC (+/− Compression) | Basis | Supplement |
|---|---|---|---|
| Osteoblast medium | No | DMEM | PL (2%) |
| PC medium unconditioned (control) | No | EMEM | FBS (10%) |
| CM non-compressed PC cells | Yes | EMEM | FBS (10%) |
| CM compressed PC cells | Yes | EMEM | FBS (10%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
van Santen, V.J.B.; Zandieh Doulabi, B.; Semeins, C.M.; Hogervorst, J.M.A.; Bratengeier, C.; Bakker, A.D. Compressed Prostate Cancer Cells Decrease Osteoclast Activity While Enhancing Osteoblast Activity In Vitro. Int. J. Mol. Sci. 2023, 24, 759. https://doi.org/10.3390/ijms24010759
van Santen VJB, Zandieh Doulabi B, Semeins CM, Hogervorst JMA, Bratengeier C, Bakker AD. Compressed Prostate Cancer Cells Decrease Osteoclast Activity While Enhancing Osteoblast Activity In Vitro. International Journal of Molecular Sciences. 2023; 24(1):759. https://doi.org/10.3390/ijms24010759
Chicago/Turabian Stylevan Santen, Victor J. B., Behrouz Zandieh Doulabi, Cornelis M. Semeins, Jolanda M. A. Hogervorst, Cornelia Bratengeier, and Astrid D. Bakker. 2023. "Compressed Prostate Cancer Cells Decrease Osteoclast Activity While Enhancing Osteoblast Activity In Vitro" International Journal of Molecular Sciences 24, no. 1: 759. https://doi.org/10.3390/ijms24010759
APA Stylevan Santen, V. J. B., Zandieh Doulabi, B., Semeins, C. M., Hogervorst, J. M. A., Bratengeier, C., & Bakker, A. D. (2023). Compressed Prostate Cancer Cells Decrease Osteoclast Activity While Enhancing Osteoblast Activity In Vitro. International Journal of Molecular Sciences, 24(1), 759. https://doi.org/10.3390/ijms24010759

