Acacetin Protects against Non-Alcoholic Fatty Liver Disease by Regulating Lipid Accumulation and Inflammation in Mice
Abstract
:1. Introduction
2. Results
2.1. Acacetin Mitigated Body Weight in Obese Mice
2.2. Acacetin Attenuated Liver Steatosis
2.3. Acacetin Modulated Lipogenesis and Lipolysis in Liver Tissue
2.4. Acacetin Modulated Serum Metabolic Parameters
2.5. Acacetin Attenuated Liver Inflammation in Mice
2.6. Acacetin Attenuated Lipid Accumulation in FL83B Cells
3. Discussion
4. Materials and Methods
4.1. Animal Protocols
4.2. Hepatic Histological Examination
4.3. Biochemical Analysis
4.4. Cell Culture and Treatments
4.5. Oil Red O Staining
4.6. Real-Time PCR
4.7. Western Blot
4.8. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Huang, D.Q.; El-Serag, H.B.; Loomba, R. Global epidemiology of NAFLD-related HCC: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 223–238. [Google Scholar] [CrossRef] [PubMed]
- Powell, E.E.; Wong, V.W.; Rinella, M. Non-alcoholic fatty liver disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef]
- Abdelmalek, M.F. Nonalcoholic fatty liver disease: Another leap forward. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 85–86. [Google Scholar] [CrossRef] [PubMed]
- Bence, K.K.; Birnbaum, M.J. Metabolic drivers of non-alcoholic fatty liver disease. Mol. Metab. 2021, 50, 101143. [Google Scholar] [CrossRef]
- Ferré, P.; Phan, F.; Foufelle, F. Srebp-1c and lipogenesis in the liver: An update1. Biochem. J. 2021, 478, 3723–3739. [Google Scholar] [CrossRef]
- Semova, I.; Biddinger, S.B. Triglycerides in nonalcoholic fatty liver disease: Guilty until proven innocent. Trends. Pharmacol. Sci. 2021, 42, 183–190. [Google Scholar] [CrossRef]
- Bowers, E.; Singer, K. Obesity-induced inflammation: The impact of the hematopoietic stem cell niche. JCI Insight 2021, 6, e145295. [Google Scholar] [CrossRef]
- Liou, C.J.; Wu, S.J.; Chen, L.C.; Yeh, K.W.; Chen, C.Y.; Huang, W.C. Acacetin from traditionally used Saussurea involucrata kar. Et kir. suppressed adipogenesis in 3T3-L1 adipocytes and attenuated lipid accumulation in obese mice. Front. Pharmacol. 2017, 8, 589. [Google Scholar] [CrossRef] [Green Version]
- Singh, S.; Gupta, P.; Meena, A.; Luqman, S. Acacetin, a flavone with diverse therapeutic potential in cancer, inflammation, infections and other metabolic disorders. Food Chem. Toxicol. 2020, 145, 111708. [Google Scholar] [CrossRef]
- Liu, C.; Zhang, M.; Ye, S.; Hong, C.; Chen, J.; Lu, R.; Hu, B.; Yang, W.; Shen, B.; Gu, Z. Acacetin protects myocardial cells against hypoxia-reoxygenation injury through activation of autophagy. J. Immunol. Res. 2021, 2021, 9979843. [Google Scholar] [CrossRef]
- Bu, J.; Shi, S.; Wang, H.Q.; Niu, X.S.; Zhao, Z.F.; Wu, W.D.; Zhang, X.L.; Ma, Z.; Zhang, Y.J.; Zhang, H.; et al. Acacetin protects against cerebral ischemia-reperfusion injury via the NLRP3 signaling pathway. Neural Regen. Res. 2019, 14, 605–612. [Google Scholar] [PubMed]
- Pan, M.H.; Lai, C.S.; Wang, Y.J.; Ho, C.T. Acacetin suppressed LPS-induced up-expression of iNOS and COX-2 in murine macrophages and TPA-induced tumor promotion in mice. Biochem. Pharmacol. 2006, 72, 1293–1303. [Google Scholar] [CrossRef]
- Huang, W.C.; Liou, C.J. Dietary acacetin reduces airway hyperresponsiveness and eosinophil infiltration by modulating eotaxin-1 and Th2 cytokines in a mouse model of asthma. Evid. Based Complement. Alternat. Med. 2012, 2012, 910520. [Google Scholar] [CrossRef] [PubMed]
- Scorletti, E.; Carr, R.M. A new perspective on NAFLD: Focusing on lipid droplets. J. Hepatol. 2021, 76, 934–945. [Google Scholar] [CrossRef] [PubMed]
- Felix, D.R.; Costenaro, F.; Gottschall, C.B.; Coral, G.P. Non-alcoholic fatty liver disease (NAFLD) in obese children-effect of refined carbohydrates in diet. BMC Pediatr. 2016, 16, 187. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, B.; Sultana, R.; Greene, M.W. Adipose tissue and insulin resistance in obese. Biomed. Pharmacother. 2021, 137, 111315. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.S.; Olefsky, J. Chronic tissue inflammation and metabolic disease. Genes Dev. 2021, 35, 307–328. [Google Scholar] [CrossRef] [PubMed]
- Esan, O.; Wierzbicki, A.S. Triglycerides and cardiovascular disease. Curr. Opin. Cardiol. 2021, 36, 469–477. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Li, Y.; Bai, M.; Huang, Y.; Yang, H.; Liu, L.; Wang, S.; Yu, C.; Song, Z.; Bao, Y.; et al. Hypericin attenuates nonalcoholic fatty liver disease and abnormal lipid metabolism via the PKA-mediated AMPK signaling pathway in vitro and in vivo. Pharmacol. Res. 2020, 153, 104657. [Google Scholar] [CrossRef]
- Wang, Y.; Viscarra, J.; Kim, S.J.; Sul, H.S. Transcriptional regulation of hepatic lipogenesis. Nat. Rev. Mol. Cell Biol. 2015, 16, 678–689. [Google Scholar] [CrossRef] [Green Version]
- Petersen, M.C.; Vatner, D.F.; Shulman, G.I. Regulation of hepatic glucose metabolism in health and disease. Nat. Rev. Endocrinol. 2017, 13, 572–587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- von Loeffelholz, C.; Coldewey, S.M.; Birkenfeld, A.L. A narrative review on the role of AMPK on de novo lipogenesis in non-alcoholic fatty liver disease: Evidence from human studies. Cells 2021, 10, 1822. [Google Scholar] [CrossRef] [PubMed]
- Liou, C.J.; Lee, Y.K.; Ting, N.C.; Chen, Y.L.; Shen, S.C.; Wu, S.J.; Huang, W.C. Protective effects of licochalcone A ameliorates obesity and non-alcoholic fatty liver disease via promotion of the sirt-1/AMPK pathway in mice fed a high-fat diet. Cells 2019, 8, 447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, G.; Ma, J.; Huang, Q.; Yin, H.; Han, J.; Li, M.; Deng, Y.; Wang, B.; Hassan, W.; Shang, J. Isoquercetin improves hepatic lipid accumulation by activating AMPK pathway and suppressing TGF-beta signaling on an HFD-induced nonalcoholic fatty liver disease rat model. Int. J. Mol. Sci. 2018, 19, 4126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alves-Bezerra, M.; Cohen, D.E. Triglyceride metabolism in the liver. Compr. Physiol. 2017, 8, 1–8. [Google Scholar] [PubMed]
- Tiao, M.M.; Lin, Y.J.; Yu, H.R.; Sheen, J.M.; Lin, I.C.; Lai, Y.J.; Tain, Y.L.; Huang, L.T.; Tsai, C.C. Resveratrol ameliorates maternal and post-weaning high-fat diet-induced nonalcoholic fatty liver disease via renin-angiotensin system. Lipids Health Dis. 2018, 17, 178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liou, C.J.; Dai, Y.W.; Wang, C.L.; Fang, L.W.; Huang, W.C. Maslinic acid protects against obesity-induced nonalcoholic fatty liver disease in mice through regulation of the sirt1/AMPK signaling pathway. FASEB J. 2019, 33, 11791–11803. [Google Scholar] [CrossRef] [Green Version]
- Remmerie, A.; Scott, C.L. Macrophages and lipid metabolism. Cell. Immunol. 2018, 330, 27–42. [Google Scholar] [CrossRef]
- Kazankov, K.; Jørgensen, S.M.D.; Thomsen, K.L.; Møller, H.J.; Vilstrup, H.; George, J.; Schuppan, D.; Grønbæk, H. The role of macrophages in nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 145–159. [Google Scholar] [CrossRef]
- Gluvic, Z.; Zaric, B.; Resanovic, I.; Obradovic, M.; Mitrovic, A.; Radak, D.; Isenovic, E.R. Link between metabolic syndrome and insulin resistance. Curr. Vasc. Pharmacol. 2017, 15, 30–39. [Google Scholar] [CrossRef]
- Zhang, Y.; Chua, S., Jr. Leptin function and regulation. Compr. Physiol. 2017, 8, 351–369. [Google Scholar] [PubMed]
- Liou, C.J.; Wei, C.H.; Chen, Y.L.; Cheng, C.Y.; Wang, C.L.; Huang, W.C. Fisetin protects against hepatic steatosis through regulation of the sirt1/AMPK and fatty acid beta-oxidation signaling pathway in high-fat diet-induced obese mice. Cell. Physiol. Biochem. 2018, 49, 1870–1884. [Google Scholar] [CrossRef] [PubMed]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [PubMed]
- Liou, C.J.; Wu, S.J.; Shen, S.C.; Chen, L.C.; Chen, Y.L.; Huang, W.C. Phloretin ameliorates hepatic steatosis through regulation of lipogenesis and sirt1/AMPK signaling in obese mice. Cell. Biosci. 2020, 10, 114. [Google Scholar] [CrossRef]










| Gene | Primer | 5′–3′ Sequence |
|---|---|---|
| ATGL | F | CTCAGGCGAGAGTGACATCT |
| R | GATTGCGAAGGTTGAACTGGAT | |
| C/EBPα | F | TGGAGACGCAACAGAAGG |
| R | TGTCCAGTTCACGGCTCA | |
| C/EBPβ | F | GTCCAAACCAACCGCACAT |
| R | CAGAGGGAGAAGCAGAGAGTT | |
| CPT1 | F | GAGCCAGACCTTGAAGTAACG |
| CPT2 | R | GAGACAGACACCATCCAACAC |
| F | TTGACCAGTGAGAACCGAGAT | |
| R | AGAGGCAGAAGACAGCAGAG | |
| FAS | F | ATCCTGGCTGACGAAGACTC |
| R | TGCTGCTGAGGTTGGAGAG | |
| HSL | F | CGGCGGCTGTCTAATGTCT |
| R | CGTTGGCTGGTGTCTCTGT | |
| PPAR-α | F | GGAGCGTTGTCTGGAGGTT |
| R | GAAGTGGTGGCTAAGTTGTTGA | |
| Sirt1 | F | CGTCTTGTCCTCTAGTTCCTGT |
| R | GCCTCTCCGTATCATCTTCCA | |
| SREBP-1c | F | CTGTTGGTGCTCGTCTCCT |
| R | TTGCGATGCCTCCAGAAGTA | |
| β-actin | F | AAGACCTCTATGCCAACACAGT |
| R | AGCCAGAGCAGTAATCTCCTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liou, C.-J.; Wu, S.-J.; Shen, S.-C.; Chen, L.-C.; Chen, Y.-L.; Huang, W.-C. Acacetin Protects against Non-Alcoholic Fatty Liver Disease by Regulating Lipid Accumulation and Inflammation in Mice. Int. J. Mol. Sci. 2022, 23, 4687. https://doi.org/10.3390/ijms23094687
Liou C-J, Wu S-J, Shen S-C, Chen L-C, Chen Y-L, Huang W-C. Acacetin Protects against Non-Alcoholic Fatty Liver Disease by Regulating Lipid Accumulation and Inflammation in Mice. International Journal of Molecular Sciences. 2022; 23(9):4687. https://doi.org/10.3390/ijms23094687
Chicago/Turabian StyleLiou, Chian-Jiun, Shu-Ju Wu, Szu-Chuan Shen, Li-Chen Chen, Ya-Ling Chen, and Wen-Chung Huang. 2022. "Acacetin Protects against Non-Alcoholic Fatty Liver Disease by Regulating Lipid Accumulation and Inflammation in Mice" International Journal of Molecular Sciences 23, no. 9: 4687. https://doi.org/10.3390/ijms23094687
APA StyleLiou, C.-J., Wu, S.-J., Shen, S.-C., Chen, L.-C., Chen, Y.-L., & Huang, W.-C. (2022). Acacetin Protects against Non-Alcoholic Fatty Liver Disease by Regulating Lipid Accumulation and Inflammation in Mice. International Journal of Molecular Sciences, 23(9), 4687. https://doi.org/10.3390/ijms23094687

