Regulation of Th17/Treg Balance by 27-Hydroxycholesterol and 24S-Hydroxycholesterol Correlates with Learning and Memory Ability in Mice
Abstract
1. Introduction
2. Results
2.1. Effects of Oxysterols on Body Weight and Organ Coefficient
2.2. Oxysterols Treatment Significantly Affected Mice Learning and Memory Ability
2.3. Oxysterols Treatment Significantly Affected the Brain Pathology
2.4. Changes of Serum/Brain Oxysterols and the Expression of Metabolic Enzymes in Brain
2.5. Oxysterols Treatment Significantly Affected the Expression Level of T-Cell-Specific Transcription Factors and the Immunomodulatory Factors in the Brain
3. Discussion
4. Materials and Methods
4.1. Animals and Treatments
4.2. Neurobehavioral Tests
4.2.1. Novel Object Recognition Test
4.2.2. Morris Water Maze Test
4.3. Hematoxylin-Eosin (HE) Staining
4.4. High-Performance Liquid Chromatography-Mass Spectrometry (HPLC-MS)
4.5. Quantitative Real-Time PCR (qRT-PCR)
4.6. Western Blot
4.7. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mercerón-Martínez, D.; Ibaceta-González, C.; Salazar, C.; Almaguer-Melian, W.; Bergado-Rosado, J.A.; Palacios, A.G. Alzheimer’s Disease, Neural Plasticity, and Functional Recovery. J. Alzheimer’s Dis. 2021, 82, S37–S50. [Google Scholar] [CrossRef] [PubMed]
- Busche, M.A.; Hyman, B.T. Synergy between amyloid-β and tau in Alzheimer’s disease. Nat. Neurosci. 2020, 23, 1183–1193. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Liu, Q. Cholesterol metabolism and homeostasis in the brain. Protein Cell 2015, 6, 254–264. [Google Scholar] [CrossRef] [PubMed]
- Giudetti, A.M.; Romano, A.; Lavecchia, A.M.; Gaetani, S. The Role of Brain Cholesterol and its Oxidized Products in Alzheimer’s Disease. Curr. Alzheimer Res. 2016, 13, 198–205. [Google Scholar] [CrossRef]
- Schipper, H.M.; Song, W.; Tavitian, A.; Cressatti, M. The sinister face of heme oxygenase-1 in brain aging and disease. Prog. Neurobiol. 2019, 172, 40–70. [Google Scholar] [CrossRef]
- Ishikawa, M.; Yoshitomi, T.; Covey, D.F.; Zorumski, C.F.; Izumi, Y. Neurosteroids and oxysterols as potential therapeutic agents for glaucoma and Alzheimer’s disease. Neuropsychiatry 2018, 8, 344–359. [Google Scholar] [CrossRef]
- El-Darzi, N.; Mast, N.; Petrov, A.M.; Pikuleva, I.A. 2-Hydroxypropyl-β-cyclodextrin reduces retinal cholesterol in wild-type and Cyp27a1(-/-) Cyp46a1(-/-) mice with deficiency in the oxysterol production. Br. J. Pharmacol. 2021, 178, 3220–3234. [Google Scholar] [CrossRef]
- Dai, L.; Zou, L.; Meng, L.; Qiang, G.; Yan, M.; Zhang, Z. Cholesterol Metabolism in Neurodegenerative Diseases: Molecular Mechanisms and Therapeutic Targets. Mol. Neurobiol. 2021, 58, 2183–2201. [Google Scholar] [CrossRef]
- Feringa, F.M.; van der Kant, R. Cholesterol and Alzheimer’s Disease; From Risk Genes to Pathological Effects. Front. Aging Neurosci. 2021, 13, 690372. [Google Scholar] [CrossRef]
- Gamba, P.; Giannelli, S.; Staurenghi, E.; Testa, G.; Sottero, B.; Biasi, F.; Poli, G.; Leonarduzzi, G. The Controversial Role of 24-S-Hydroxycholesterol in Alzheimer’s Disease. Antioxidants 2021, 10, 740. [Google Scholar] [CrossRef]
- Ma, L.; Nelson, E.R. Oxysterols and nuclear receptors. Mol. Cell Endocrinol. 2019, 484, 42–51. [Google Scholar] [CrossRef] [PubMed]
- Kallen, J.; Izaac, A.; Be, C.; Arista, L.; Orain, D.; Kaupmann, K.; Guntermann, C.; Hoegenauer, K.; Hintermann, S. Structural States of RORγt: X-ray Elucidation of Molecular Mechanisms and Binding Interactions for Natural and Synthetic Compounds. ChemMedChem 2017, 12, 1014–1021. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.R. The Balance of Th17 versus Treg Cells in Autoimmunity. Int. J. Mol. Sci. 2018, 19, 730. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, M.; Sun, H.; Yin, K. Matrine improves cognitive impairment and modulates the balance of Th17/Treg cytokines in a rat model of Aβ1-42-induced Alzheimer’s disease. Cent. Eur. J. Immunol. 2015, 40, 411–419. [Google Scholar] [CrossRef]
- Saksida, T.; Koprivica, I.; Vujičić, M.; Stošić-Grujičić, S.; Perović, M.; Kanazir, S.; Stojanović, I. Impaired IL-17 Production in Gut-Residing Immune Cells of 5xFAD Mice with Alzheimer’s Disease Pathology. J. Alzheimer’s Dis. 2018, 61, 619–630. [Google Scholar] [CrossRef]
- Duffy, S.S.; Keating, B.A.; Perera, C.J.; Moalem-Taylor, G. The role of regulatory T cells in nervous system pathologies. J Neurosci. Res. 2018, 96, 951–968. [Google Scholar] [CrossRef]
- Jetten, A.M.; Takeda, Y.; Slominski, A.; Kang, H.S. Retinoic acid-related Orphan Receptor γ (RORγ): Connecting sterol metabolism to regulation of the immune system and autoimmune disease. Curr. Opin. Toxicol. 2018, 8, 66–80. [Google Scholar] [CrossRef]
- Soroosh, P.; Wu, J.; Xue, X.; Song, J.; Sutton, S.W.; Sablad, M.; Yu, J.; Nelen, M.I.; Liu, X.; Castro, G.; et al. Oxysterols are agonist ligands of RORγt and drive Th17 cell differentiation. Proc. Natl. Acad. Sci. USA 2014, 111, 12163–12168. [Google Scholar] [CrossRef]
- Mohammadi Shahrokhi, V.; Ravari, A.; Mirzaei, T.; Zare-Bidaki, M.; Asadikaram, G.; Arababadi, M.K. IL-17A and IL-23: Plausible risk factors to induce age-associated inflammation in Alzheimer’s disease. Immunol. Investig. 2018, 47, 812–822. [Google Scholar] [CrossRef]
- Lee, J.Y.; Hall, J.A.; Kroehling, L.; Wu, L.; Najar, T.; Nguyen, H.H.; Lin, W.Y.; Yeung, S.T.; Silva, H.M.; Li, D.; et al. Serum Amyloid A Proteins Induce Pathogenic Th17 Cells and Promote Inflammatory Disease. Cell 2020, 180, 79–91.e16. [Google Scholar] [CrossRef]
- Jayaraman, S.; Gantz, D.L.; Haupt, C.; Gursky, O. Serum amyloid A forms stable oligomers that disrupt vesicles at lysosomal pH and contribute to the pathogenesis of reactive amyloidosis. Proc. Natl. Acad. Sci. USA 2017, 114, E6507–E6515. [Google Scholar] [CrossRef] [PubMed]
- Zetterberg, H.; Bendlin, B.B. Biomarkers for Alzheimer’s disease-preparing for a new era of disease-modifying therapies. Mol. Psychiatry 2021, 26, 296–308. [Google Scholar] [CrossRef] [PubMed]
- Yeung, C.H.C.; Lau, K.W.D.; Au Yeung, S.L.; Schooling, C.M. Amyloid, tau and risk of Alzheimer’s disease: A Mendelian randomization study. Eur. J. Epidemiol. 2021, 36, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Mutemberezi, V.; Guillemot-Legris, O.; Muccioli, G.G. Oxysterols: From cholesterol metabolites to key mediators. Prog. Lipid Res. 2016, 64, 152–169. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Liu, Z.; Qin, L.; Wang, T.; Bai, O. Insights into the mechanisms of Th17 differentiation and the Yin-Yang of Th17 cells in human diseases. Mol. Immunol. 2021, 134, 109–117. [Google Scholar] [CrossRef]
- Staurenghi, E.; Cerrato, V.; Gamba, P.; Testa, G.; Giannelli, S.; Leoni, V.; Caccia, C.; Buffo, A.; Noble, W.; Perez-Nievas, B.G.; et al. Oxysterols present in Alzheimer’s disease brain induce synaptotoxicity by activating astrocytes: A major role for lipocalin-2. Redox Biol. 2021, 39, 101837. [Google Scholar] [CrossRef]
- Popp, J.; Lewczuk, P.; Kölsch, H.; Meichsner, S.; Maier, W.; Kornhuber, J.; Jessen, F.; Lütjohann, D. Cholesterol metabolism is associated with soluble amyloid precursor protein production in Alzheimer’s disease. J. Neurochem. 2012, 123, 310–316. [Google Scholar] [CrossRef]
- Jahn, T.; Clark, C.; Kerksiek, A.; Lewczuk, P.; Lütjohann, D.; Popp, J. Cholesterol metabolites and plant sterols in cerebrospinal fluid are associated with Alzheimer’s cerebral pathology and clinical disease progression. J. Steroid Biochem. Mol. Biol. 2021, 205, 105785. [Google Scholar] [CrossRef]
- Wang, Y.; An, Y.; Zhang, D.; Yu, H.; Zhang, X.; Wang, Y.; Tao, L.; Xiao, R. 27-Hydroxycholesterol Alters Synaptic Structural and Functional Plasticity in Hippocampal Neuronal Cultures. J. Neuropathol. Exp. Neurol. 2019, 78, 238–247. [Google Scholar]
- Chen, S.; Zhou, C.; Yu, H.; Tao, L.; An, Y.; Zhang, X.; Wang, Y.; Wang, Y.; Xiao, R. 27-Hydroxycholesterol Contributes to Lysosomal Membrane Permeabilization-Mediated Pyroptosis in Co-cultured SH-SY5Y Cells and C6 Cells. Front. Mol. Neurosci. 2019, 12, 14. [Google Scholar] [CrossRef]
- Wang, Y.; An, Y.; Ma, W.; Yu, H.; Lu, Y.; Zhang, X.; Wang, Y.; Liu, W.; Wang, T.; Xiao, R. 27-Hydroxycholesterol contributes to cognitive deficits in APP/PS1 transgenic mice through microbiota dysbiosis and intestinal barrier dysfunction. J. Neuroinflammation 2020, 17, 199. [Google Scholar] [CrossRef] [PubMed]
- Lütjohann, D.; Lopez, A.M.; Chuang, J.C.; Kerksiek, A.; Turley, S.D. Identification of Correlative Shifts in Indices of Brain Cholesterol Metabolism in the C57BL6/Mecp2(tm1.1Bird) Mouse, a Model for Rett Syndrome. Lipids 2018, 53, 363–373. [Google Scholar] [CrossRef] [PubMed]
- Crick, P.J.; Yutuc, E.; Abdel-Khalik, J.; Saeed, A.; Betsholtz, C.; Genove, G.; Björkhem, I.; Wang, Y.; Griffiths, W.J. Formation and metabolism of oxysterols and cholestenoic acids found in the mouse circulation: Lessons learnt from deuterium-enrichment experiments and the CYP46A1 transgenic mouse. J. Steroid Biochem. Mol. Biol. 2019, 195, 105475. [Google Scholar] [CrossRef] [PubMed]
- Bang, H.J.; Arakawa, C.; Takada, M.; Sato, M.; Imaizumi, K. A comparison of the potential unfavorable effects of oxycholesterol and oxyphytosterol in mice: Different effects, on cerebral 24S-hydroxychoelsterol and serum triacylglycerols levels. Biosci. Biotechnol. Biochem. 2008, 72, 3128–3133. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Testa, G.; Staurenghi, E.; Giannelli, S.; Gargiulo, S.; Guglielmotto, M.; Tabaton, M.; Tamagno, E.; Gamba, P.; Leonarduzzi, G. A silver lining for 24-hydroxycholesterol in Alzheimer’s disease: The involvement of the neuroprotective enzyme sirtuin 1. Redox Biol. 2018, 17, 423–431. [Google Scholar] [CrossRef]
- Bretillon, L.; Lütjohann, D.; Ståhle, L.; Widhe, T.; Bindl, L.; Eggertsen, G.; Diczfalusy, U.; Björkhem, I. Plasma levels of 24S-hydroxycholesterol reflect the balance between cerebral production and hepatic metabolism and are inversely related to body surface. J. Lipid Res. 2000, 41, 840–845. [Google Scholar] [CrossRef]
- Roy, D.; Chakrabarti, S.S.; Banerjee, A.; Sharma, P.; Biswas, A.; Chakrabarti, S. Serum 24-hydroxycholesterol in probable Alzheimer’s dementia: Reexploring the significance of a tentative Alzheimer’s disease biomarker. Aging Med. 2019, 2, 74–81. [Google Scholar] [CrossRef]
- Benussi, L.; Ghidoni, R.; Dal Piaz, F.; Binetti, G.; Di Iorio, G.; Abrescia, P. The level of 24-Hydroxycholesteryl Esters is an Early Marker of Alzheimer’s Disease. J. Alzheimer’s Dis. 2017, 56, 825–833. [Google Scholar] [CrossRef]
- Zhang, X.; Xi, Y.; Yu, H.; An, Y.; Wang, Y.; Tao, L.; Wang, Y.; Liu, W.; Wang, T.; Xiao, R. 27-hydroxycholesterol promotes Aβ accumulation via altering Aβ metabolism in mild cognitive impairment patients and APP/PS1 mice. Brain Pathol. 2019, 29, 558–573. [Google Scholar] [CrossRef]
- Testa, G.; Staurenghi, E.; Zerbinati, C.; Gargiulo, S.; Iuliano, L.; Giaccone, G.; Fanto, F.; Poli, G.; Leonarduzzi, G.; Gamba, P. Changes in brain oxysterols at different stages of Alzheimer’s disease: Their involvement in neuroinflammation. Redox Biol. 2016, 10, 24–33. [Google Scholar] [CrossRef]
- Meir, K.; Kitsberg, D.; Alkalay, I.; Szafer, F.; Rosen, H.; Shpitzen, S.; Avi, L.B.; Staels, B.; Fievet, C.; Meiner, V.; et al. Human sterol 27-hydroxylase (CYP27) overexpressor transgenic mouse model. Evidence against 27-hydroxycholesterol as a critical regulator of cholesterol homeostasis. J. Biol. Chem. 2002, 277, 34036–34041. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Lv, C.; An, Y.; Liu, Q.; Rong, H.; Tao, L.; Wang, Y.; Wang, Y.; Xiao, R. Increased Levels of 27-Hydroxycholesterol Induced by Dietary Cholesterol in Brain Contribute to Learning and Memory Impairment in Rats. Mol. Nutr. Food Res. 2018, 62, 1700531. [Google Scholar] [CrossRef] [PubMed]
- Loera-Valencia, R.; Goikolea, J.; Parrado-Fernandez, C.; Merino-Serrais, P.; Maioli, S. Alterations in cholesterol metabolism as a risk factor for developing Alzheimer’s disease: Potential novel targets for treatment. J. Steroid Biochem. Mol. Biol. 2019, 190, 104–114. [Google Scholar] [CrossRef]
- Saeed, A.; Floris, F.; Andersson, U.; Pikuleva, I.; Lövgren-Sandblom, A.; Bjerke, M.; Paucar, M.; Wallin, A.; Svenningsson, P.; Björkhem, I. 7α-hydroxy-3-oxo-4-cholestenoic acid in cerebrospinal fluid reflects the integrity of the blood-brain barrier. J. Lipid Res. 2014, 55, 313–318. [Google Scholar] [CrossRef] [PubMed]
- Meljon, A.; Crick, P.J.; Yutuc, E.; Yau, J.L.; Seckl, J.R.; Theofilopoulos, S.; Arenas, E.; Wang, Y.; Griffiths, W.J. Mining for Oxysterols in Cyp7b1(-/-) Mouse Brain and Plasma: Relevance to Spastic Paraplegia Type 5. Biomolecules 2019, 9, 149. [Google Scholar] [CrossRef] [PubMed]
- Jevtic, S.; Sengar, A.S.; Salter, M.W.; McLaurin, J. The role of the immune system in Alzheimer disease: Etiology and treatment. Ageing Res. Rev. 2017, 40, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Ju, T.; Wang, T.; Zhang, L.; Ding, F.; Zhang, Y.; An, R.; Sun, Y.; Li, Y.; Lu, Y.; et al. Decreased Netrin-1 and Correlated Th17/Tregs Balance Disorder in Aβ(1-42) Induced Alzheimer’s Disease Model Rats. Front. Aging Neurosci. 2019, 11, 124. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Kumar, N.; Crumbley, C.; Griffin, P.R.; Burris, T.P. A second class of nuclear receptors for oxysterols: Regulation of RORalpha and RORgamma activity by 24S-hydroxycholesterol (cerebrosterol). Biochim. Biophys. Acta 2010, 1801, 917–923. [Google Scholar] [CrossRef]
- Baek, H.; Ye, M.; Kang, G.-H.; Lee, C.; Lee, G.; Choi, D.B.; Jung, J.; Kim, H.; Lee, S.; Kim, J.S.; et al. Neuroprotective effects of CD4+CD25+Foxp3+ regulatory T cells in a 3xTg-AD Alzheimer’s disease model. Oncotarget 2016, 7, 69347–69357. [Google Scholar] [CrossRef]
- Zhang, Y.Y.; Fan, Y.C.; Wang, M.; Wang, D.; Li, X.H. Atorvastatin attenuates the production of IL-1β, IL-6, and TNF-α in the hippocampus of an amyloid β1-42-induced rat model of Alzheimer’s disease. Clin. Interv. Aging 2013, 8, 103–110. [Google Scholar]
- Zhang, X.; Zhang, X.; Qiu, C.; Shen, H.; Zhang, H.; He, Z.; Song, Z.; Zhou, W. The imbalance of Th17/Treg via STAT3 activation modulates cognitive impairment in P. gingivalis LPS-induced periodontitis mice. J. Leukoc. Biol. 2021, 110, 511–524. [Google Scholar] [CrossRef] [PubMed]
- Yasuda, K.; Takeuchi, Y.; Hirota, K. The pathogenicity of Th17 cells in autoimmune diseases. Semin. Immunopathol. 2019, 41, 283–297. [Google Scholar] [CrossRef] [PubMed]
- Shang, S.; Yang, Y.M.; Zhang, H.; Tian, L.; Jiang, J.S.; Dong, Y.B.; Zhang, K.; Li, B.; Zhao, W.D.; Fang, W.G.; et al. Intracerebral GM-CSF contributes to transendothelial monocyte migration in APP/PS1 Alzheimer’s disease mice. J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow Metab. 2016, 36, 1978–1991. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Guo, Y.; Feng, X.; Jia, M.; Ai, N.; Dong, Y.; Zheng, Y.; Fu, L.; Yu, B.; Zhang, H.; et al. The behavioural and neuropathologic sexual dimorphism and absence of MIP-3α in tau P301S mouse model of Alzheimer’s disease. J. Neuroinflammation 2020, 17, 72. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhao, L.; Luo, Z.; Zhang, Y.; Lv, L.; Zhao, J.; Sui, B.; Huang, F.; Cui, M.; Fu, Z.F.; et al. Interferon-λ Attenuates Rabies Virus Infection by Inducing Interferon-Stimulated Genes and Alleviating Neurological Inflammation. Viruses 2020, 12, 405. [Google Scholar] [CrossRef]
- Mehla, J.; Lacoursiere, S.; Stuart, E.; McDonald, R.J.; Mohajerani, M.H. Gradual Cerebral Hypoperfusion Impairs Fear Conditioning and Object Recognition Learning and Memory in Mice: Potential Roles of Neurodegeneration and Cholinergic Dysfunction. J. Alzheimer’s Dis. 2018, 61, 283–293. [Google Scholar] [CrossRef]
Groups | FDI | TDI |
---|---|---|
Control group | 0.17 ± 0.23 | 0.29 ± 0.09 |
27-OHC group | −0.08 ± 0.26 | 0.031 ± 0.46 |
24S-OHC group | 0.19 ± 0.40 | −0.19 ± 0.39 |
27-OHC+24S-OHC group | −0.08 ± 0.52 | 0.09 ± 0.51 |
F value | 1.099 | 1.098 |
p-value | 0.367 | 0.371 |
Primer | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
APP | TGAATGTGCAGAATGGAAAGTG | AACTAGGCAACGGTAAGGAATC |
SAA | ACACTGACATGAAGGAAGCTAA | CCTTTGAGCAGCATCATAGTTC |
CYP27A1 | ATCGCACAAGGAGAGCAATGGTAC | GGCAAGGTGGTAGAGAAGATGAGC |
CYP7B1 | AACCCTTTCCAGTACCAGTATG | GTGAACGTCTTCATTAAGGTCG |
CYP46A1 | CTTGGACATCTCCCCTACTTTT | TCAGGAACTTCTTGACTGACTC |
RORγt | ACAAATTGAAGTGATCCCTTGC | GGAGTAGGCCACATTACACTG |
Foxp3 | TTTCACCTATGCCACCCTTATC | CATGCGAGTAAACCAATGGTAG |
IL-17A | GAGCTTCATCTGTGTCTCTGAT | GCCAAGGGAGTTAAAGACTTTG |
GM-CSF | TTCAAGAAGCTAACATGTGTGC | GGTAACTTGTGTTTCACAGTCC |
MIP-3α | TCTTCCTTCCAGAGCTATTGTG | GACTGCTTGTCCTTCAATGATC |
IL-10 | TTCTTTCAAACAAAGGACCAGC | GCAACCCAAGTAACCCTTAAAG |
IFN-λ2 | GGATTGCCACATTGCTCAGTTCAAG | GTCCTTCTCAAGCAGCCTCTTCTC |
GAPDH | GGTTGTCTCCTGCGACTTCA | TGGTCCAGGGTTTCTTACTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; Cui, S.; Hao, L.; Liu, W.; Wang, L.; Ju, M.; Feng, W.; Xiao, R. Regulation of Th17/Treg Balance by 27-Hydroxycholesterol and 24S-Hydroxycholesterol Correlates with Learning and Memory Ability in Mice. Int. J. Mol. Sci. 2022, 23, 4370. https://doi.org/10.3390/ijms23084370
Wang T, Cui S, Hao L, Liu W, Wang L, Ju M, Feng W, Xiao R. Regulation of Th17/Treg Balance by 27-Hydroxycholesterol and 24S-Hydroxycholesterol Correlates with Learning and Memory Ability in Mice. International Journal of Molecular Sciences. 2022; 23(8):4370. https://doi.org/10.3390/ijms23084370
Chicago/Turabian StyleWang, Tao, Shanshan Cui, Ling Hao, Wen Liu, Lijing Wang, Mengwei Ju, Wenjing Feng, and Rong Xiao. 2022. "Regulation of Th17/Treg Balance by 27-Hydroxycholesterol and 24S-Hydroxycholesterol Correlates with Learning and Memory Ability in Mice" International Journal of Molecular Sciences 23, no. 8: 4370. https://doi.org/10.3390/ijms23084370
APA StyleWang, T., Cui, S., Hao, L., Liu, W., Wang, L., Ju, M., Feng, W., & Xiao, R. (2022). Regulation of Th17/Treg Balance by 27-Hydroxycholesterol and 24S-Hydroxycholesterol Correlates with Learning and Memory Ability in Mice. International Journal of Molecular Sciences, 23(8), 4370. https://doi.org/10.3390/ijms23084370