The Non-Specific Lethal (NSL) Histone Acetyltransferase Complex Transcriptionally Regulates Yin Yang 1-Mediated Cell Proliferation in Human Cells
Abstract
:1. Introduction
2. Results
2.1. The NSL HAT Complex Appears in Genes That Regulate Cell Proliferation and Development
2.2. The NSL HAT Complex Regulates Transcription Factor YY1-Mediated Cell Proliferation
2.3. YY1 May Be a Potential Target Gene of the NSL HAT Complex
2.4. CRISPR/Cas9-Mediated NSL3-Knockout (NSL3-KO) Led to Instability of the NSL HAT Complex, Which Further Reduced the Enzymatic Activity of the Complex
2.5. Redistribution of Histone H4 Acetylation and Histone H3 Methylation by NSL3-KO Was Observed in the Genome
2.6. The NSL3-KO Mediated H4K16ac Cooperates with H3K4me2/me3 to Govern Gene Transcription
2.7. NSL HAT May Regulate Multiple Transcription Factors, including YY1, through Binding to a Specific Motif
3. Discussion
4. Materials and Methods
4.1. Antibodies
4.2. Cell Culture
4.3. Plasmids
4.4. siRNA/shRNA Knockdown
4.5. CRISPR/Cas9-Mediated NSL3 Knockout (NSL3-KO) Cell Line
4.6. Reverse Transcription PCR
4.7. Immunofluorescence Staining
4.8. MTT and Colony Formation Experiments
4.9. Luciferase Reporter Assay
4.10. RNA-Sequencing (RNA-Seq)
4.11. Chromatin Immunoprecipitation–Sequencing (ChIP-Seq) and Data Analysis
4.12. Electrophoretic Mobility Shift Assay (EMSA)
4.13. Statistical Analysis
4.14. Data Accession
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
MOF | The human males absent on the first |
NSL | Non-specific lethal; HAT: Histone acetyltransferase |
HAT | histone acetyltransferase |
HMT | histone methyltransferase |
TFs | Transcription factors |
YY1 | Yin Yang 1 |
ChIP-Seq | Chromatin immunoprecipitation sequencing |
References
- Jin, J.; Cai, Y.; Li, B.; Conaway, R.C.; Workman, J.L.; Conaway, J.W.; Kusch, T. In and out: Histone variant exchange in chromatin. Trends Biochem. Sci. 2005, 30, 680–687. [Google Scholar] [CrossRef] [PubMed]
- Jenuwein, T.; Allis, C.D. Translating the histone code. Science 2001, 293, 1074–1080. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strahl, B.D.; Allis, C.D. The language of covalent histone modifications. Nature 2000, 403, 41–45. [Google Scholar] [CrossRef] [PubMed]
- Bannister, A.J.; Kouzarides, T. Regulation of chromatin by histone modifications. Cell Res. 2011, 21, 381–395. [Google Scholar] [CrossRef]
- Akhtar, A.; Becker, P.B. Activation of transcription through histone H4 acetylation by MOF, an acetyltransferase essential for dosage compensation in Drosophila. Mol. Cell 2000, 5, 367–375. [Google Scholar] [CrossRef]
- Lucchesi, J.C.; Kuroda, M.I. Dosage compensation in Drosophila. Cold Spring Harb. Perspect. Biol. 2015, 7, a019398. [Google Scholar] [CrossRef] [Green Version]
- Ravens, S.; Fournier, M.; Ye, T.; Stierle, M.; Dembele, D.; Chavant, V.; Tora, L. Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation. eLife 2014, 3, e02104. [Google Scholar] [CrossRef]
- Chelmicki, T.; Dundar, F.; Turley, M.J.; Khanam, T.; Aktas, T.; Ramirez, F.; Gendrel, A.V.; Wright, P.R.; Videm, P.; Backofen, R.; et al. MOF-associated complexes ensure stem cell identity and Xist repression. eLife 2014, 3, e02024. [Google Scholar] [CrossRef]
- Kapoor-Vazirani, P.; Kagey, J.D.; Powell, D.R.; Vertino, P.M. Role of hMOF-dependent histone H4 lysine 16 acetylation in the maintenance of TMS1/ASC gene activity. Cancer Res. 2008, 68, 6810–6821. [Google Scholar] [CrossRef] [Green Version]
- Fullgrabe, J.; Lynch-Day, M.A.; Heldring, N.; Li, W.; Struijk, R.B.; Ma, Q.; Hermanson, O.; Rosenfeld, M.G.; Klionsky, D.J.; Joseph, B. The histone H4 lysine 16 acetyltransferase hMOF regulates the outcome of autophagy. Nature 2013, 500, 468–471. [Google Scholar] [CrossRef]
- Gupta, A.; Guerin-Peyrou, T.G.; Sharma, G.G.; Park, C.; Agarwal, M.; Ganju, R.K.; Pandita, S.; Choi, K.; Sukumar, S.; Pandita, R.K.; et al. The mammalian ortholog of Drosophila MOF that acetylates histone H4 lysine 16 is essential for embryogenesis and oncogenesis. Mol. Cell. Biol. 2008, 28, 397–409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, G.G.; So, S.; Gupta, A.; Kumar, R.; Cayrou, C.; Avvakumov, N.; Bhadra, U.; Pandita, R.K.; Porteus, M.H.; Chen, D.J.; et al. MOF and histone H4 acetylation at lysine 16 are critical for DNA damage response and double-strand break repair. Mol. Cell. Biol. 2010, 30, 3582–3595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Corsa, C.A.; Pan, P.W.; Wu, L.; Ferguson, D.; Yu, X.; Min, J.; Dou, Y. MOF and H4 K16 acetylation play important roles in DNA damage repair by modulating recruitment of DNA damage repair protein Mdc1. Mol. Cell. Biol. 2010, 30, 5335–5347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Li, L.; Pandey, R.; Byun, J.S.; Gardner, K.; Qin, Z.; Dou, Y. The histone acetyltransferase MOF is a key regulator of the embryonic stem cell core transcriptional network. Cell Stem Cell 2012, 11, 163–178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, Y.; Jin, J.; Swanson, S.K.; Cole, M.D.; Choi, S.H.; Florens, L.; Washburn, M.P.; Conaway, J.W.; Conaway, R.C. Subunit composition and substrate specificity of a MOF-containing histone acetyltransferase distinct from the male-specific lethal (MSL) complex. J. Biol. Chem. 2010, 285, 4268–4272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, X.; Su, J.; Wang, F.; Liu, D.; Ding, J.; Yang, Y.; Conaway, J.W.; Conaway, R.C.; Cao, L.; Wu, D.; et al. Crosstalk between NSL histone acetyltransferase and MLL/SET complexes: NSL complex functions in promoting histone H3K4 di-methylation activity by MLL/SET complexes. PLoS Genet. 2013, 11, e1003940. [Google Scholar] [CrossRef]
- Klein, B.J.; Wang, X.; Cui, G.; Yuan, C.; Botuyan, M.V.; Lin, K.; Lu, Y.; Wang, X.; Zhao, Y.; Bruns, C.J.; et al. PHF20 Readers Link Methylation of Histone H3K4 and p53 with H4K16 Acetylation. Cell Rep. 2016, 17, 1158–1170. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Jang, Y.; Lee, J.E.; Ahn, J.; Xu, L.; Holden, M.R.; Cornett, E.M.; Krajewski, K.; Klein, B.J.; Wang, S.P.; et al. Selective binding of the PHD6 finger of MLL4 to histone H4K16ac links MLL4 and MOF. Nat. Commun. 2019, 10, 2314. [Google Scholar] [CrossRef]
- Zhao, L.; Li, M.; Wei, T.; Feng, C.; Wu, T.; Shah, J.A.; Liu, H.; Wang, F.; Cai, Y.; Jin, J. O-GlcNAc-Modification of NSL3 at Thr755 Site Maintains the Holoenzyme Activity of MOF/NSL Histone Acetyltransfease Complex. Int. J. Mol. Sci. 2019, 21, 173. [Google Scholar] [CrossRef] [Green Version]
- Sheikh, B.N.; Guhathakurta, S.; Akhtar, A. The non-specific lethal (NSL) complex at the crossroads of transcriptional control and cellular homeostasis. EMBO Rep. 2019, 20, e47630. [Google Scholar] [CrossRef]
- Robinson, P.J.; An, W.; Routh, A.; Martino, F.; Chapman, L.; Roeder, R.G.; Rhodes, D. 30 nm chromatin fibre decompaction requires both H4-K16 acetylation and linker histone eviction. J. Mol. Biol. 2008, 381, 816–825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allahverdi, A.; Yang, R.; Korolev, N.; Fan, Y.; Davey, C.A.; Liu, C.F.; Nordenskiold, L. The effects of histone H4 tail acetylations on cation-induced chromatin folding and self-association. Nucleic Acids Res. 2011, 39, 1680–1691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feller, C.; Prestel, M.; Hartmann, H.; Straub, T.; Soding, J.; Becker, P.B. The MOF-containing NSL complex associates globally with housekeeping genes, but activates only a defined subset. Nucleic Acids Res. 2012, 40, 1509–1522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lam, K.C.; Chung, H.R.; Semplicio, G.; Iyer, S.S.; Gaub, A.; Bhardwaj, V.; Holz, H.; Georgiev, P.; Akhtar, A. The NSL complex-mediated nucleosome landscape is required to maintain transcription fidelity and suppression of transcription noise. Genes Dev. 2019, 33, 452–465. Available online: http://www.genesdev.org/cgi/doi/10.1101/gad.321489.118 (accessed on 3 November 2021). [CrossRef] [PubMed]
- Dou, Y.; Milne, T.A.; Tackett, A.J.; Smith, E.R.; Fukuda, A.; Wysocka, J.; Allis, C.D.; Chait, B.T.; Hess, J.L.; Roeder, R.G. Physical Association and Coordinate Function of the H3 K4 Methyltransferase MLL1 and the H4 K16 Acetyltransferase MOF. Cell 2005, 121, 873–885. [Google Scholar] [CrossRef] [Green Version]
- Shogren-Knaak, M.; Ishii, H.; Sun, J.M.; Pazin, M.J.; Davie, J.R.; Peterson, C.L. Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science 2006, 311, 844–847. Available online: https://www.science.org/doi/10.1126/science.1124000 (accessed on 10 October 2021). [CrossRef] [Green Version]
- Pandita, T.K. Histone H4 lysine 16 acetylated isoform synthesis opens new route to biophysical studies. Proteomics 2013, 13, 1546–1547. [Google Scholar] [CrossRef]
- Corona, D.F.; Clapier, C.R.; Becker, P.B.; Tamkun, J.W. Modulation of ISWI function by site-specific histone acetylation. EMBO Rep. 2002, 3, 242–247. [Google Scholar] [CrossRef]
- Kwon, S.Y.; Xiao, H.; Wu, C.; Badenhorst, P. Alternative splicing of NURF301 generates distinct NURF chromatin remodeling complexes with altered modified histone binding specificities. PLoS Genet. 2009, 5, e1000574. [Google Scholar] [CrossRef] [Green Version]
- Suganuma, T.; Workman, J.L. Crosstalk among Histone Modifications. Cell 2008, 135, 604–607. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Nikolai, B.C.; Gates, L.A.; Jung, S.Y.; Siwak, E.B.; He, B.; Rice, A.P.; O’Malley, B.W.; Feng, Q. Crosstalk between histone modifications indicates that inhibition of arginine methyltransferase CARM1 activity reverses HIV latency. Nucleic Acids Res. 2017, 45, 9348–9360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berger, S.L. The complex language of chromatin regulation during transcription. Nature 2007, 447, 407–412. [Google Scholar] [CrossRef] [PubMed]
- Deng, W.; Lee, J.; Wang, H.; Miller, J.; Reik, A.; Gregory, P.D.; Dean, A.; Blobel, G.A. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell 2012, 149, 1233–1244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erokhin, M.; Vassetzky, Y.; Georgiev, P.; Chetverina, D. Eukaryotic enhancers: Common features, regulation, and participation in diseases. Cell. Mol. Life Sci. 2015, 72, 2361–2375. [Google Scholar] [CrossRef]
- Heintzman, N.D.; Stuart, R.K.; Hon, G.; Fu, Y.; Ching, C.W.; Hawkins, R.D.; Barrera, L.O.; Van Calcar, S.; Qu, C.; Ching, K.A.; et al. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat. Genet. 2007, 39, 311–318. [Google Scholar] [CrossRef]
- Rada-Iglesias, A.; Bajpai, R.; Swigut, T.; Brugmann, S.A.; Flynn, R.A.; Wysocka, J. A unique chromatin signature uncovers early developmental enhancers in humans. Nature 2011, 470, 279–283. [Google Scholar] [CrossRef] [Green Version]
- Karmodiya, K.; Krebs, A.R.; Oulad-Abdelghani, M.; Kimura, H.; Tora, L. H3K9 and H3K14 acetylation co-occur at many gene regulatory elements, while H3K14ac marks a subset of inactive inducible promoters in mouse embryonic stem cells. BMC Genom. 2012, 13, 424. [Google Scholar] [CrossRef] [Green Version]
- Voss, T.C.; Hager, G.L. Dynamic regulation of transcriptional states by chromatin and transcription factors. Nat. Rev. Genet. 2013, 15, 69–81. [Google Scholar] [CrossRef]
- Kim, J.-W.; Jang, S.-M.; Kim, C.-H.; An, J.-H.; Kang, E.-J.; Choi, K.-H. New Molecular Bridge between RelA/p65 and NF-κB Target Genes via Histone Acetyltransferase TIP60 Cofactor. J. Biol. Chem. 2012, 287, 7780–7791. [Google Scholar] [CrossRef] [Green Version]
- Yu, L.; Yang, G.; Zhang, X.; Wang, P.; Weng, X.; Yang, Y.; Li, Z.; Fang, M.; Xu, Y.; Sun, A.; et al. Megakaryocytic Leukemia 1 Bridges Epigenetic Activation of NADPH Oxidase in Macrophages to Cardiac Ischemia-Reperfusion Injury. Circulation 2018, 138, 2820–2836. [Google Scholar] [CrossRef]
- Katoh, H.; Qin, Z.S.; Liu, R.; Wang, L.; Li, W.; Li, X.; Wu, L.; Du, Z.; Lyons, R.; Liu, C.G.; et al. FOXP3 orchestrates H4K16 acetylation and H3K4 trimethylation for activation of multiple genes by recruiting MOF and causing displacement of PLU-1. Mol. Cell 2011, 44, 770–784. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lambert, S.A.; Jolma, A.; Campitelli, L.F.; Das, P.K.; Yin, Y.; Albu, M.; Chen, X.; Taipale, J.; Hughes, T.R.; Weirauch, M.T. The Human Transcription Factors. Cell 2018, 172, 650–665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Meliala, I.T.S.; Hosea, R.; Kasim, V.; Wu, S. The biological implications of Yin Yang 1 in the hallmarks of cancer. Theranostics 2020, 10, 4183–4200. Available online: https://www.thno.org/v10p4183.htm (accessed on 6 September 2021). [CrossRef] [PubMed]
- Li, D.; Yang, Y.; Chen, B.; Guo, X.; Gao, S.; Wang, M.; Duan, M.; Li, X. MOF Regulates TNK2 Transcription Expression to Promote Cell Proliferation in Thyroid Cancer. Front. Pharmacol. 2020, 11, 607605. [Google Scholar] [CrossRef] [PubMed]
- Gaub, A.; Sheikh, B.N.; Basilicata, M.F.; Vincent, M.; Nizon, M.; Colson, C.; Bird, M.J.; Bradner, J.E.; Thevenon, J.; Boutros, M.; et al. Evolutionary conserved NSL complex/BRD4 axis controls transcription activation via histone acetylation. Nat. Commun. 2020, 11, 2243. [Google Scholar] [CrossRef]
- Subhash, S.; Mishra, K.; Akhade, V.S.; Kanduri, M.; Mondal, T.; Kanduri, C. H3K4me2 and WDR5 enriched chromatin interacting long non-coding RNAs maintain transcriptionally competent chromatin at divergent transcriptional units. Nucleic Acids Res. 2018, 46, 9384–9400. [Google Scholar] [CrossRef] [Green Version]
- Kooistra, S.M.; Helin, K. Molecular mechanisms and potential functions of histone demethylases. Nat. Rev. Mol. Cell. Biol. 2012, 13, 297–311. [Google Scholar] [CrossRef]
- Taylor, G.C.; Eskeland, R.; Hekimoglu-Balkan, B.; Pradeepa, M.M.; Bickmore, W.A. H4K16 acetylation marks active genes and enhancers of embryonic stem cells, but does not alter chromatin compaction. Genome Res. 2013, 23, 2053–2065. Available online: http://www.genome.org/cgi/doi/10.1101/gr.155028.113 (accessed on 9 September 2021). [CrossRef] [Green Version]
- Yao, J.; Chen, J.; Li, L.-Y.; Wu, M. Epigenetic plasticity of enhancers in cancer. Transcription 2020, 11, 26–36. [Google Scholar] [CrossRef]
- Radzisheuskaya, A.; Shliaha, P.V.; Grinev, V.V.; Shlyueva, D.; Damhofer, H.; Koche, R.; Gorshkov, V.; Kovalchuk, S.; Zhan, Y.; Rodriguez, K.L.; et al. Complex-dependent histone acetyltransferase activity of KAT8 determines its role in transcription and cellular homeostasis. Mol. Cell 2021, 81, 1749–1765. [Google Scholar] [CrossRef] [PubMed]
- Sarvagalla, S.; Kolapalli, S.P.; Vallabhapurapu, S. The Two Sides of YY1 in Cancer: A Friend and a Foe. Front. Oncol. 2019, 9, 1230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, Y.; Jin, J.; Yao, T.; Gottschalk, A.J.; Swanson, S.K.; Wu, S.; Shi, Y.; Washburn, M.P.; Florens, L.; Conaway, R.C.; et al. YY1 functions with INO80 to activate transcription. Nat. Struct. Mol. Biol. 2007, 14, 872–874. [Google Scholar] [CrossRef] [PubMed]
- Janke, A.M.; Seo, D.H.; Rahmanian, V.; Conicella, A.E.; Mathews, K.L.; Burke, K.A.; Mittal, J.; Fawzi, N.L. Lysines in the RNA Polymerase II C-Terminal Domain Contribute to TAF15 Fibril Recruitment. Biochemistry 2017, 57, 2549–2563. [Google Scholar] [CrossRef] [PubMed]
- Firulli, A.B.; Tan, C.; Zhu, S.; Chen, Z.; Liu, C.; Li, Y.E.; Zhu, M.; Zhang, Z.; Zhang, Z.; Zhang, L.; et al. Mediator complex proximal Tail subunit MED30 is critical for Mediator core stability and cardiomyocyte transcriptional network. PLOS Genet. 2021, 17, e1009785. [Google Scholar] [CrossRef]
- Syafruddin, S.E.; Mohtar, M.A.; Wan Mohamad Nazarie, W.F.; Low, T.Y. Two Sides of the Same Coin: The Roles of KLF6 in Physiology and Pathophysiology. Biomolecules 2020, 10, 1378. [Google Scholar] [CrossRef]
- Jia, W.Z.; Yu, T.; An, Q.; Yang, H.; Zhang, Z.; Liu, X.; Xiao, G. MicroRNA-190 regulates FOXP2 genes in human gastric cancer. OncoTargets Ther. 2016, 9, 3643–3651. [Google Scholar] [CrossRef] [Green Version]
- Wu, D.; Zhao, L.; Feng, Z.; Yu, C.; Ding, J.; Wang, L.; Wang, F.; Liu, D.; Zhu, H.; Xing, F.; et al. O-LinkedN-acetylglucosamine transferase 1 regulates global histone H4 acetylation via stabilization of the nonspecific lethal protein NSL3. J. Biol. Chem. 2017, 292, 10014–10025. [Google Scholar] [CrossRef] [Green Version]
- Su, J.; Sui, Y.; Ding, J.; Li, F.; Shen, S.; Yang, Y.; Lu, Z.; Wang, F.; Cao, L.; Liu, X.; et al. Human INO80/YY1 chromatin remodeling complex transcriptionally regulates the BRCA2- and CDKN1A-interacting protein (BCCIP) in cells. Protein Cell 2016, 7, 749–760. [Google Scholar] [CrossRef] [Green Version]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of rna-seq experiments with hisat, stringtie and ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramírez, F.; Dündar, F.; Diehl, S.; Grüning, B.A.; Manke, T. Deeptools: A flexible platform for exploring deep-sequencing data. Nucleic Acids Res. 2014, 42, W187–W191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robinson, J.T. Integrative genomics viewer. Nat. Biotech. 2011, 29, 24–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, J.; Liu, T.; Qin, B.; Zhang, Y.; Liu, X.S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 2012, 7, 1728–1740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amemiya, H.M.; Kundaje, A.; Boyle, A.P. The ENCODE Blacklist: Identification of Problematic Regions of the Genome. Sci. Rep. 2019, 9, 9354. [Google Scholar] [CrossRef] [Green Version]
- Yu, G.; Wang, L.-G.; He, Q.-Y. ChIPseeker: An R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics 2015, 31, 2382–2383. [Google Scholar] [CrossRef] [Green Version]
- Heinz, S.; Benner, C.; Spann, N.; Bertolino, E.; Lin, Y.C.; Laslo, P.; Cheng, J.X.; Murre, C.; Singh, H.; Glass, C.K. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 2010, 38, 576–589. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
Genes | Forward Primer | Reverse Primer |
---|---|---|
YY1 | CCCTCATAAAGGCTGCACAA | TGAACCAGTTGGTGTCGTTT |
FOXP2 | AAGCATGCTGGCTCAGTCTT | CTTTGGTGTGCAACGTGAGG |
XBP1 | TCCGGAGCTGGGTATCTCAA | GAACCCCCGTATCCACAGTC |
MED30 | AGCTGCCAAATGGTGTCACT | AGTTGCTCGACTGGAATGGG |
KLF6 | CCACTTGAAAGCACACCAGC | CCTGTCACAGTGGGAGCATT |
TAF15 | TTGTGCAAGGACTTGGGGAG | GCCTTAGCTGAAGGAGGGTC |
SLC3A2 | GGGCGTCTCGATTACCTGAG | CAGCAAGTCAGTCTGAGCGA |
UBA2 | AGCTGCCCGAAACCATGTTA | TCTGGGTCGGCTTAGGATGA |
UCHL5 | CAACAGTTTCGCCAGACAGC | GGCCTTACTGCACTGATCCA |
NAMPT | GGAGCATCTGCTCACTTGGT | TCATGGTCTTTCCCCCAAGC |
DKC1 | AGCGGAAGTCATTGCCAGAA | TAGCAAAAGGGGCCACTGAG |
β-Actin | GGGTCAGGGCAGTATCTCTC | AGGACAGCACCAGAGTAACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Wei, T.; Sun, L.; Wu, T.; Li, F.; Zhao, J.; Chu, J.; Wang, F.; Cai, Y.; Jin, J. The Non-Specific Lethal (NSL) Histone Acetyltransferase Complex Transcriptionally Regulates Yin Yang 1-Mediated Cell Proliferation in Human Cells. Int. J. Mol. Sci. 2022, 23, 3801. https://doi.org/10.3390/ijms23073801
Liu H, Wei T, Sun L, Wu T, Li F, Zhao J, Chu J, Wang F, Cai Y, Jin J. The Non-Specific Lethal (NSL) Histone Acetyltransferase Complex Transcriptionally Regulates Yin Yang 1-Mediated Cell Proliferation in Human Cells. International Journal of Molecular Sciences. 2022; 23(7):3801. https://doi.org/10.3390/ijms23073801
Chicago/Turabian StyleLiu, Hongsen, Tao Wei, Lin Sun, Tingting Wu, Fuqiang Li, Jianlei Zhao, Jinmeng Chu, Fei Wang, Yong Cai, and Jingji Jin. 2022. "The Non-Specific Lethal (NSL) Histone Acetyltransferase Complex Transcriptionally Regulates Yin Yang 1-Mediated Cell Proliferation in Human Cells" International Journal of Molecular Sciences 23, no. 7: 3801. https://doi.org/10.3390/ijms23073801