Cold Atmospheric Plasma Does Not Affect Stellate Cells Phenotype in Pancreatic Cancer Tissue in Ovo
Abstract
:1. Introduction
2. Results
2.1. CAP Inhibits Growth of Mia PaCa-2 Tissue, but Effectiveness Is Reduced in the Presence of RLT-PSCs
2.2. CAP Decreases Ki67 Expression in RLT-PSC + Mia PaCa-2 Tissue
2.3. CAP Does Not Alter mRNA Expression of Activation, Cell-Matrix Interaction, and ECM Remodelling Factors in Tissue with RLT-PSC Cells
2.4. CAP Does Not Alter the Activation Profile of RLT-PSC Cells in Ovo
2.5. CAP Does Not Affect MMPs Expression in RLT-PSC but Increases MMP2 Expression in Mia PaCa-2 of Co-Cultured Tissue
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Reagents
4.2. Chicken Chorioallantoic Membrane Assay (CAM Assay)
4.3. kINPen IND Plasma Jet
4.4. Immunofluorescence Assays (IF)
4.5. Immunohistochemistry (IHC) Assays
4.6. IHC Image Processing
4.7. IF Image Processing
4.7.1. Nuclear DAPI Segmentation
4.7.2. Tissue Classification
4.7.3. Fluorescent Signal Measurement
4.7.4. Quantification of ACTA-2+ Cells
4.8. Tissue Homogenization and RNA Extraction
4.9. Reverse Transcription Quantitative PCR (RT-qPCR)
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| ACTA-2 | CTAAGACGGGAATCCTGTGAAG | ATGGATGGGAAAACAGCCCT |
| GFAP | TGCCTATAGACAGGAAGCAGATG | TCCTCCTCCAGCGACTCAAT |
| vimentin | GGCTCGTCACCTTCGTGAAT | GAGAAATCCTGCTCTCCTCGC |
| e-cadherin | GGGCTGGACCGAGAGAGTTT | GTTAGCCTCGTTCTCAGGCA |
| n-cadherin | CGAAGGATGTGCATGAAGGAC | TGCAGTTGCTAAACTTCACATTG |
| SNAI2 | TTGTGTTTGCAAGATCTGCGG | TTCTCCCCCGTGTGAGTTCTAA |
| MMP1 | CAGGGGAGATCATCGGGACAA | GGCCTGGTTGAAAAGCATGAG |
| TIMP2 | TATCTACACGGCCCCCTCCT | CGGCCTTTCCTGCAATGAGATA |
| fibronectin 1 | AACAAACACTAATGTTAATTGCCCA | TCGGGAATCTTCTCTGTCAGC |
| B2M | TGCTGTCTCCATGTTTGATGTATCT | TCTCTGCTCCCCACCTCTAAGT |
| PMM1 | GCTTCGACACCATCCACTTCTTTG | AGATCTCAAAGTCGTTCCCACCAG |
Appendix B

References
- Kleeff, J.; Korc, M.; Apte, M.; La Vecchia, C.; Johnson, C.D.; Biankin, A.V.; Neale, R.E.; Tempero, M.; Tuveson, D.A.; Hruban, R.H.; et al. Pancreatic cancer. Nat. Rev. Dis. Primers 2016, 2, 16022. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef]
- Zhan, H.-X.; Zhou, B.; Cheng, Y.-G.; Xu, J.-W.; Wang, L.; Zhang, G.-Y.; Hu, S.-Y. Crosstalk between stromal cells and cancer cells in pancreatic cancer: New insights into stromal biology. Cancer Lett. 2017, 392, 83–93. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, C.; Jiang, K.; Werner, J.; Bazhin, A.V.; D’Haese, J.G. The Role of Stellate Cells in Pancreatic Ductal Adenocarcinoma: Targeting Perspectives. Front. Oncol. 2020, 10, 621937. [Google Scholar] [CrossRef] [PubMed]
- Kanat, O.; Ertas, H. Shattering the castle walls: Anti-stromal therapy for pancreatic cancer. World J. Gastrointest. Oncol. 2018, 10, 202–210. [Google Scholar] [CrossRef] [PubMed]
- Phillips, P. Pancreatic stellate cells and fibrosis. In Pancreatic Cancer and Tumor Microenvironment; Grippo, P.J., Munshi, H.G., Eds.; Transworld Research Network: Trivandrum, India, 2012. [Google Scholar]
- Tang, D.; Zhang, J.; Yuan, Z.; Zhang, H.; Chong, Y.; Huang, Y.; Wang, J.; Xiong, Q.; Wang, S.; Wu, Q.; et al. PSC-derived Galectin-1 inducing epithelial-mesenchymal transition of pancreatic ductal adenocarcinoma cells by activating the NF-kappaB pathway. Oncotarget 2017, 8, 86488–86502. [Google Scholar] [CrossRef] [Green Version]
- Afanas’ev, I. Reactive oxygen species signaling in cancer: Comparison with aging. Aging Dis. 2011, 2, 219–230. [Google Scholar]
- Sperb, N.; Tsesmelis, M.; Wirth, T. Crosstalk between Tumor and Stromal Cells in Pancreatic Ductal Adenocarcinoma. Int. J. Mol. Sci. 2020, 21, 5486. [Google Scholar] [CrossRef]
- Chaiswing, L.; St Clair, W.H.; St Clair, D.K. Redox Paradox: A Novel Approach to Therapeutics-Resistant Cancer. Antioxid. Redox Signal. 2018, 29, 1237–1272. [Google Scholar] [CrossRef]
- Shin, J.; Song, M.H.; Oh, J.W.; Keum, Y.S.; Saini, R.K. Pro-Oxidant Actions of Carotenoids in Triggering Apoptosis of Cancer Cells: A Review of Emerging Evidence. Antioxidants 2020, 9, 532. [Google Scholar] [CrossRef]
- Sznarkowska, A.; Kostecka, A.; Meller, K.; Bielawski, K.P. Inhibition of cancer antioxidant defense by natural compounds. Oncotarget 2017, 8, 15996–16016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, J.; Cieslak, J.A., III; Welsh, J.L.; Sibenaller, Z.A.; Allen, B.G.; Wagner, B.A.; Kalen, A.L.; Doskey, C.M.; Strother, R.K.; Button, A.M.; et al. Pharmacological Ascorbate Radiosensitizes Pancreatic Cancer. Cancer Res. 2015, 75, 3314–3326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alexander, M.S.; O’Leary, B.R.; Wilkes, J.G.; Gibson, A.R.; Wagner, B.A.; Du, J.; Sarsour, E.; Hwang, R.F.; Buettner, G.R.; Cullen, J.J. Enhanced Pharmacological Ascorbate Oxidation Radiosensitizes Pancreatic Cancer. Radiat. Res. 2019, 191, 43–51. [Google Scholar] [CrossRef] [PubMed]
- Reuter, S.; von Woedtke, T.; Weltmann, K.-D. The kINPen—a review on physics and chemistry of the atmospheric pressure plasma jet and its applications. J. Phys. D Appl. Phys. 2018, 51, 233001. [Google Scholar] [CrossRef] [Green Version]
- Lin, A.; Gorbanev, Y.; De Backer, J.; Van Loenhout, J.; Van Boxem, W.; Lemière, F.; Cos, P.; Dewilde, S.; Smits, E.; Bogaerts, A. Non-Thermal Plasma as a Unique Delivery System of Short-Lived Reactive Oxygen and Nitrogen Species for Immunogenic Cell Death in Melanoma Cells. Adv. Sci. 2019, 6, 1802062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miebach, L.; Freund, E.; Clemen, R.; Weltmann, K.D.; Metelmann, H.R.; von Woedtke, T.; Gerling, T.; Wende, K.; Bekeschus, S. Conductivity augments ROS and RNS delivery and tumor toxicity of an argon plasma jet. Free Radic. Biol. Med. 2022, 180, 210–219. [Google Scholar] [CrossRef] [PubMed]
- Kumar, N.; Perez-Novo, C.; Shaw, P.; Logie, E.; Privat-Maldonado, A.; Dewilde, S.; Smits, E.; Berghe, W.V.; Bogaerts, A. Physical plasma-derived oxidants sensitize pancreatic cancer cells to ferroptotic cell death. Free Radic. Biol. Med. 2021, 166, 187–200. [Google Scholar] [CrossRef]
- Liedtke, K.R.; Diedrich, S.; Pati, O.; Freund, E.; Flieger, R.; Heidecke, C.D.; Partecke, L.I.; Bekeschus, S. Cold Physical Plasma Selectively Elicits Apoptosis in Murine Pancreatic Cancer Cells In Vitro and In Ovo. Anticancer Res. 2018, 38, 5655–5663. [Google Scholar] [CrossRef]
- Virard, F.; Cousty, S.; Cambus, J.P.; Valentin, A.; Kemoun, P.; Clement, F. Cold Atmospheric Plasma Induces a Predominantly Necrotic Cell Death via the Microenvironment. PLoS ONE 2015, 10, e0133120. [Google Scholar] [CrossRef]
- Biscop, E.; Lin, A.; Boxem, W.V.; Loenhout, J.V.; Backer, J.; Deben, C.; Dewilde, S.; Smits, E.; Bogaerts, A.A. Influence of Cell Type and Culture Medium on Determining Cancer Selectivity of Cold Atmospheric Plasma Treatment. Cancers 2019, 11, 1287. [Google Scholar] [CrossRef] [Green Version]
- Yusupov, M.; Privat-Maldonado, A.; Cordeiro, R.M.; Verswyvel, H.; Shaw, P.; Razzokov, J.; Smits, E.; Bogaerts, A. Oxidative damage to hyaluronan-CD44 interactions as an underlying mechanism of action of oxidative stress-inducing cancer therapy. Redox Biol. 2021, 43, 101968. [Google Scholar] [CrossRef] [PubMed]
- Shaw, P.; Kumar, N.; Hammerschmid, D.; Privat-Maldonado, A.; Dewilde, S.; Bogaerts, A. Synergistic Effects of Melittin and Plasma Treatment: A Promising Approach for Cancer Therapy. Cancers 2019, 11, 1109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shaw, P.; Kumar, N.; Privat-Maldonado, A.; Smits, E.; Bogaerts, A. Cold Atmospheric Plasma Increases Temozolomide Sensitivity of Three-Dimensional Glioblastoma Spheroids via Oxidative Stress-Mediated DNA Damage. Cancers 2021, 13, 1780. [Google Scholar] [CrossRef]
- Rasouli, M.; Fallah, N.; Bekeschus, S. Combining Nanotechnology and Gas Plasma as an Emerging Platform for Cancer Therapy: Mechanism and Therapeutic Implication. Oxidative Med. Cell. Longev. 2021, 2021, 2990326. [Google Scholar] [CrossRef] [PubMed]
- Bernhardt, T.; Semmler, M.L.; Schafer, M.; Bekeschus, S.; Emmert, S.; Boeckmann, L. Plasma Medicine: Applications of Cold Atmospheric Pressure Plasma in Dermatology. Oxidative Med. Cell. Longev. 2019, 2019, 3873928. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freund, E.; Spadola, C.; Schmidt, A.; Privat-Maldonado, A.; Bogaerts, A.; von Woedtke, T.; Weltmann, K.-D.; Heidecke, C.-D.; Partecke, L.-I.; Käding, A.; et al. Risk Evaluation of EMT and Inflammation in Metastatic Pancreatic Cancer Cells Following Plasma Treatment. Front. Phys. 2020, 8, 569618. [Google Scholar] [CrossRef]
- Bekeschus, S.; Freund, E.; Spadola, C.; Privat-Maldonado, A.; Hackbarth, C.; Bogaerts, A.; Schmidt, A.; Wende, K.; Weltmann, K.D.; von Woedtke, T.; et al. Risk Assessment of kINPen Plasma Treatment of Four Human Pancreatic Cancer Cell Lines with Respect to Metastasis. Cancers 2019, 11, 1237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, B.; Cheng, L.; Jiang, Z.; Chen, K.; Zhou, C.; Sun, L.; Cao, J.; Qian, W.; Li, J.; Shan, T.; et al. Resveratrol Inhibits ROS-Promoted Activation and Glycolysis of Pancreatic Stellate Cells via Suppression of miR-21. Oxidative Med. Cell. Longev. 2018, 2018, 1346958. [Google Scholar] [CrossRef]
- Van Loenhout, J.; Flieswasser, T.; Freire Boullosa, L.; De Waele, J.; Van Audenaerde, J.; Marcq, E.; Jacobs, J.; Lin, A.; Lion, E.; Dewitte, H.; et al. Cold Atmospheric Plasma-Treated PBS Eliminates Immunosuppressive Pancreatic Stellate Cells and Induces Immunogenic Cell Death of Pancreatic Cancer Cells. Cancers 2019, 11, 1597. [Google Scholar] [CrossRef] [Green Version]
- Kumar, N.; Attri, P.; Dewilde, S.; Bogaerts, A. Inactivation of human pancreatic ductal adenocarcinoma with atmospheric plasma treated media and water: A comparative study. J. Phys. D Appl. Phys. 2018, 51, 255401. [Google Scholar] [CrossRef]
- Verloy, R.; Privat-Maldonado, A.; Smits, E.; Bogaerts, A. Cold Atmospheric Plasma Treatment for Pancreatic Cancer-The Importance of Pancreatic Stellate Cells. Cancers 2020, 12, 2782. [Google Scholar] [CrossRef]
- Jesnowski, R.; Fürst, D.; Ringel, J.; Chen, Y.; Schrödel, A.; Kleeff, J.; Kolb, A.; Schareck, W.D.; Löhr, M. Immortalization of pancreatic stellate cells as an in vitro model of pancreatic fibrosis: Deactivation is induced by matrigel and N-acetylcysteine. Lab. Investig. 2005, 85, 1276–1291. [Google Scholar] [CrossRef] [PubMed]
- Sugahara, K.N.; Murai, T.; Nishinakamura, H.; Kawashima, H.; Saya, H.; Miyasaka, M. Hyaluronan oligosaccharides induce CD44 cleavage and promote cell migration in CD44-expressing tumor cells. J. Biol. Chem. 2003, 278, 32259–32265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lenggenhager, D.; Amrutkar, M.; Sántha, P.; Aasrum, M.; Löhr, J.M.; Gladhaug, I.P.; Verbeke, C.S. Commonly Used Pancreatic Stellate Cell Cultures Differ Phenotypically and in Their Interactions with Pancreatic Cancer Cells. Cells 2019, 8, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Winkler, J.; Abisoye-Ogunniyan, A.; Metcalf, K.J.; Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat. Commun. 2020, 11, 5120. [Google Scholar] [CrossRef]
- Gilles, C.; Newgreen, D.F.; Sato, H.; Thompson, E.W. Matrix Metalloproteases and Epithelial-to-Mesenchymal Transition: Implications for Carcinoma Metastasis. In Madame Curie Bioscience Database; Landes Bioscience: Austin, TX, USA, 2013. Available online: https://www.ncbi.nlm.nih.gov/books/NBK6387/ (accessed on 12 January 2022).
- Yamazaki, K.; Masugi, Y.; Effendi, K.; Tsujikawa, H.; Hiraoka, N.; Kitago, M.; Shinoda, M.; Itano, O.; Tanabe, M.; Kitagawa, Y.; et al. Upregulated SMAD3 promotes epithelial-mesenchymal transition and predicts poor prognosis in pancreatic ductal adenocarcinoma. Lab. Investig. 2014, 94, 683–691. [Google Scholar] [CrossRef]
- Catenacci, D.V.; Junttila, M.R.; Karrison, T.; Bahary, N.; Horiba, M.N.; Nattam, S.R.; Marsh, R.; Wallace, J.; Kozloff, M.; Rajdev, L.; et al. Randomized Phase Ib/II Study of Gemcitabine Plus Placebo or Vismodegib, a Hedgehog Pathway Inhibitor, in Patients With Metastatic Pancreatic Cancer. J. Clin. Oncol. 2015, 33, 4284–4292. [Google Scholar] [CrossRef]
- Rhim, A.D.; Oberstein, P.E.; Thomas, D.H.; Mirek, E.T.; Palermo, C.F.; Sastra, S.A.; Dekleva, E.N.; Saunders, T.; Becerra, C.P.; Tattersall, I.W.; et al. Stromal elements act to restrain, rather than support, pancreatic ductal adenocarcinoma. Cancer Cell 2014, 25, 735–747. [Google Scholar] [CrossRef] [Green Version]
- Ozdemir, B.C.; Pentcheva-Hoang, T.; Carstens, J.L.; Zheng, X.; Wu, C.C.; Simpson, T.R.; Laklai, H.; Sugimoto, H.; Kahlert, C.; Novitskiy, S.V.; et al. Depletion of Carcinoma-Associated Fibroblasts and Fibrosis Induces Immunosuppression and Accelerates Pancreas Cancer with Reduced Survival. Cancer Cell 2015, 28, 831–833. [Google Scholar] [CrossRef] [Green Version]
- Huet, E.; Jaroz, C.; Nguyen, H.Q.; Belkacemi, Y.; de la Taille, A.; Stavrinides, V.; Whitaker, H. Stroma in normal and cancer wound healing. FEBS J. 2019, 286, 2909–2920. [Google Scholar] [CrossRef] [Green Version]
- Xiao, Y.; Hsiao, T.H.; Suresh, U.; Chen, H.I.; Wu, X.; Wolf, S.E.; Chen, Y. A novel significance score for gene selection and ranking. Bioinformatics 2014, 30, 801–807. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, D.J.; Smyth, G.K. Testing significance relative to a fold-change threshold is a TREAT. Bioinformatics 2009, 25, 765–771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, Z.; Teo, G.; Krueger, S.; Rock, T.M.; Koh, H.W.; Choi, H.; Vogel, C. Differential dynamics of the mammalian mRNA and protein expression response to misfolding stress. Mol. Syst. Biol. 2016, 12, 855. [Google Scholar] [CrossRef] [PubMed]
- Maneshi, P.; Mason, J.; Dongre, M.; Ohlund, D. Targeting Tumor-Stromal Interactions in Pancreatic Cancer: Impact of Collagens and Mechanical Traits. Front. Cell Dev. Biol. 2021, 9, 787485. [Google Scholar] [CrossRef] [PubMed]
- Kessenbrock, K.; Plaks, V.; Werb, Z. Matrix metalloproteinases: Regulators of the tumor microenvironment. Cell 2010, 141, 52–67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Procacci, P.; Moscheni, C.; Sartori, P.; Sommariva, M.; Gagliano, N. Tumor-Stroma Cross-Talk in Human Pancreatic Ductal Adenocarcinoma: A Focus on the Effect of the Extracellular Matrix on Tumor Cell Phenotype and Invasive Potential. Cells 2018, 7, 158. [Google Scholar] [CrossRef] [Green Version]
- Cates, J.M.; Byrd, R.H.; Fohn, L.E.; Tatsas, A.D.; Washington, M.K.; Black, C.C. Epithelial-mesenchymal transition markers in pancreatic ductal adenocarcinoma. Pancreas 2009, 38, e1–e6. [Google Scholar] [CrossRef] [Green Version]
- Slapak, E.J.; Duitman, J.; Tekin, C.; Bijlsma, M.F.; Spek, C.A. Matrix Metalloproteases in Pancreatic Ductal Adenocarcinoma: Key Drivers of Disease Progression? Biology 2020, 9, 80. [Google Scholar] [CrossRef] [Green Version]
- Zhou, L.; Lu, J.; Liang, Z.Y.; Zhou, W.X.; Wang, Y.Z.; Jiang, B.L.; You, L.; Guo, J.C. Expression and Prognostic Value of Small Mothers Against Decapentaplegic 7, Matrix Metalloproteinase 2, and Matrix Metalloproteinase 9 in Resectable Pancreatic Ductal Adenocarcinoma. Pancreas 2021, 50, 1195–1201. [Google Scholar] [CrossRef]
- Grunwald, B.; Vandooren, J.; Gerg, M.; Ahomaa, K.; Hunger, A.; Berchtold, S.; Akbareian, S.; Schaten, S.; Knolle, P.; Edwards, D.R.; et al. Systemic Ablation of MMP-9 Triggers Invasive Growth and Metastasis of Pancreatic Cancer via Deregulation of IL6 Expression in the Bone Marrow. Mol. Cancer Res. 2016, 14, 1147–1158. [Google Scholar] [CrossRef] [Green Version]
- Shchors, K.; Nozawa, H.; Xu, J.; Rostker, F.; Swigart-Brown, L.; Evan, G.; Hanahan, D. Increased invasiveness of MMP-9-deficient tumors in two mouse models of neuroendocrine tumorigenesis. Oncogene 2013, 32, 502–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Yu, K.N.; Bao, L.; Shen, J.; Cheng, C.; Han, W. Non-thermal plasma inhibits human cervical cancer HeLa cells invasiveness by suppressing the MAPK pathway and decreasing matrix metalloproteinase-9 expression. Sci. Rep. 2016, 6, 19720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakamura, K.; Peng, Y.; Utsumi, F.; Tanaka, H.; Mizuno, M.; Toyokuni, S.; Hori, M.; Kikkawa, F.; Kajiyama, H. Novel Intraperitoneal Treatment with Non-Thermal Plasma-Activated Medium Inhibits Metastatic Potential of Ovarian Cancer Cells. Sci. Rep. 2017, 7, 6085. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.; Choung, J.; Ko, U.H.; Jung, A.; Choe, W.; Shin, J.H.; Gweon, B. Suppression of Breast Cancer Cell Migration and Epithelial-Mesenchymal Transition by Atmospheric Pressure Plasma. Front. Phys. 2021, 9, 370. [Google Scholar] [CrossRef]
- Wang, P.Y.; Zhou, R.W.; Thomas, P.; Zhao, L.Q.; Zhou, R.S.; Mandal, S.; Jolly, M.K.; Richard, D.J.; Rehm, B.H.A.; Ostrikov, K.; et al. Epithelial-to-Mesenchymal Transition Enhances Cancer Cell Sensitivity to Cytotoxic Effects of Cold Atmospheric Plasmas in Breast and Bladder Cancer Systems. Cancers 2021, 13, 2889. [Google Scholar] [CrossRef]
- Adhikari, M.; Kaushik, N.; Ghimire, B.; Adhikari, B.; Baboota, S.; Al-Khedhairy, A.A.; Wahab, R.; Lee, S.J.; Kaushik, N.K.; Choi, E.H. Cold atmospheric plasma and silymarin nanoemulsion synergistically inhibits human melanoma tumorigenesis via targeting HGF/c-MET downstream pathway. Cell Commun. Signal. 2019, 17, 52. [Google Scholar] [CrossRef] [Green Version]
- Panchy, N.; Azeredo-Tseng, C.; Luo, M.; Randall, N.; Hong, T. Integrative Transcriptomic Analysis Reveals a Multiphasic Epithelial-Mesenchymal Spectrum in Cancer and Non-tumorigenic Cells. Front. Oncol 2019, 9, 1479. [Google Scholar] [CrossRef]
- Pastushenko, I.; Blanpain, C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019, 29, 212–226. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, V.C.; Carrara, R.C.; Simoes, D.L.; Saggioro, F.P.; Carlotti, C.G., Jr.; Covas, D.T.; Neder, L. Sudan Black B treatment reduces autofluorescence and improves resolution of in situ hybridization specific fluorescent signals of brain sections. Histol. Histopathol. 2010, 25, 1017–1024. [Google Scholar] [CrossRef]
- Bankhead, P.; Loughrey, M.B.; Fernandez, J.A.; Dombrowski, Y.; McArt, D.G.; Dunne, P.D.; McQuaid, S.; Gray, R.T.; Murray, L.J.; Coleman, H.G.; et al. QuPath: Open source software for digital pathology image analysis. Sci. Rep. 2017, 7, 16878. [Google Scholar] [CrossRef] [Green Version]
- Kothari, S.; Phan, J.H.; Stokes, T.H.; Wang, M.D. Pathology imaging informatics for quantitative analysis of whole-slide images. J. Am. Med. Inform. Assoc. 2013, 20, 1099–1108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kayser, K. Quantification of virtual slides: Approaches to analysis of content-based image information. J. Pathol. Inform. 2011, 2, 2. [Google Scholar] [CrossRef] [PubMed]
- Akbar, S.; Peikari, M.; Salama, S.; Panah, A.Y.; Nofech-Mozes, S.; Martel, A.L. Automated and Manual Quantification of Tumour Cellularity in Digital Slides for Tumour Burden Assessment. Sci. Rep. 2019, 9, 14099. [Google Scholar] [CrossRef] [PubMed] [Green Version]







Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Privat-Maldonado, A.; Verloy, R.; Cardenas Delahoz, E.; Lin, A.; Vanlanduit, S.; Smits, E.; Bogaerts, A. Cold Atmospheric Plasma Does Not Affect Stellate Cells Phenotype in Pancreatic Cancer Tissue in Ovo. Int. J. Mol. Sci. 2022, 23, 1954. https://doi.org/10.3390/ijms23041954
Privat-Maldonado A, Verloy R, Cardenas Delahoz E, Lin A, Vanlanduit S, Smits E, Bogaerts A. Cold Atmospheric Plasma Does Not Affect Stellate Cells Phenotype in Pancreatic Cancer Tissue in Ovo. International Journal of Molecular Sciences. 2022; 23(4):1954. https://doi.org/10.3390/ijms23041954
Chicago/Turabian StylePrivat-Maldonado, Angela, Ruben Verloy, Edgar Cardenas Delahoz, Abraham Lin, Steve Vanlanduit, Evelien Smits, and Annemie Bogaerts. 2022. "Cold Atmospheric Plasma Does Not Affect Stellate Cells Phenotype in Pancreatic Cancer Tissue in Ovo" International Journal of Molecular Sciences 23, no. 4: 1954. https://doi.org/10.3390/ijms23041954
APA StylePrivat-Maldonado, A., Verloy, R., Cardenas Delahoz, E., Lin, A., Vanlanduit, S., Smits, E., & Bogaerts, A. (2022). Cold Atmospheric Plasma Does Not Affect Stellate Cells Phenotype in Pancreatic Cancer Tissue in Ovo. International Journal of Molecular Sciences, 23(4), 1954. https://doi.org/10.3390/ijms23041954

