The Mulberry SPL Gene Family and the Response of MnSPL7 to Silkworm Herbivory through Activating the Transcription of MnTT2L2 in the Catechin Biosynthesis Pathway
Abstract
:1. Introduction
2. Results
2.1. Identification and Analysis of the SPL Gene Family in Mulberry
2.2. Temporal-Spatial Expression Profile Analysis of SPL Genes in Mulberry
2.3. Silkworm Herbivory Influenced the Expression Profile of MnSPL Genes
3. Discussion
3.1. The Evolutionary Conservation and Functional Diversity of SPL Genes in Mulberry
3.2. The MnSPL7/MnTT2L2 Module Responds to Silkworm Herbivory through Regulating Catechin Synthesis Gene Expression in Wild Mulberry (Chuansang)
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. Bioinformatics Analysis of SPL Genes in Mulberry
4.3. Epression Analysis of miR156 and SPL Genes in Mulberry
4.4. Dual-Luciferase Repoter Assay
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yamasaki, K.; Kigawa, T.; Inoue, M.; Tateno, M.; Yamasaki, T.; Yabuki, T.; Aoki, M.; Seki, E.; Matsuda, T.; Nunokawa, E.; et al. A novel zinc-binding motif revealed by solution structures of DNA-binding domains of Arabidopsis SBP-family transcription factors. J. Mol. Biol. 2004, 337, 49–63. [Google Scholar] [CrossRef]
- Birkenbihl, R.P.; Jach, G.; Saedler, H.; Huijser, P. Functional dissection of the plant-specific SBP-domain: Overlap of the DNA-binding and nuclear localization domains. J. Mol. Biol. 2005, 352, 585–596. [Google Scholar] [CrossRef] [Green Version]
- Klein, J.; Saedler, H.; Huijser, P. A new family of DNA binding proteins includes putative transcriptional regulators of the Antirrhinum majus floral meristem identity gene SQUAMOSA. Mol. Gen. Genet. MGG 1996, 250, 7–16. [Google Scholar] [CrossRef]
- Arazi, T.; Talmor-Neiman, M.; Stav, R.; Riese, M.; Huijser, P.; Baulcombe, D.C. Cloning and characterization of micro-RNAs from moss. Plant J. Cell Mol. Biol. 2005, 43, 837–848. [Google Scholar] [CrossRef] [PubMed]
- Riese, M.; Zobell, O.; Saedler, H.; Huijser, P. SBP-domain transcription factors as possible effectors of cryptochrome-mediated blue light signalling in the moss Physcomitrella patens. Planta 2008, 227, 505–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, S.D.; Ling, L.Z.; Yi, T.S. Evolution and divergence of SBP-box genes in land plants. BMC Genom. 2015, 16, 787. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Lu, S. Molecular characterization of the SPL gene family in Populus trichocarpa. BMC Plant Biol. 2014, 14, 131. [Google Scholar] [CrossRef] [Green Version]
- Cardon, G.; Höhmann, S.; Klein, J.; Nettesheim, K.; Saedler, H.; Huijser, P. Molecular characterisation of the Arabidopsis SBP-box genes. Gene 1999, 237, 91–104. [Google Scholar] [CrossRef]
- Yang, Z.; Wang, X.; Gu, S.; Hu, Z.; Xu, H.; Xu, C. Comparative study of SBP-box gene family in Arabidopsis and rice. Gene 2008, 407, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Song, Q.; Zhang, Y.; Li, Z.; Guo, J.; Chen, X.; Zhang, G. Genome-wide identification, characterization, and expression patterns analysis of the SBP-box gene family in wheat (Triticum aestivum L.). Sci. Rep. 2020, 10, 17250. [Google Scholar] [CrossRef]
- Wang, S.; Ren, X.; Xue, J.; Xue, Y.; Cheng, X.; Hou, X.; Zhang, X. Molecular characterization and expression analysis of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE gene family in Paeonia suffruticosa. Plant Cell Rep. 2020, 39, 1425–1441. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Park, M.Y.; Conway, S.R.; Wang, J.W.; Weigel, D.; Poethig, R.S. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 2009, 138, 750–759. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.W. Regulation of flowering time by the miR156-mediated age pathway. J. Exp. Bot. 2014, 65, 4723–4730. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.W.; Park, M.Y.; Wang, L.J.; Koo, Y.; Chen, X.Y.; Weigel, D.; Poethig, R.S. miRNA control of vegetative phase change in trees. PLoS Genet. 2011, 7, e1002012. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.W.; Czech, B.; Weigel, D. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 2009, 138, 738–749. [Google Scholar] [CrossRef] [Green Version]
- Jung, J.H.; Lee, H.J.; Ryu, J.Y.; Park, C.M. SPL3/4/5 Integrate Developmental Aging and Photoperiodic Signals into the FT-FD Module in Arabidopsis Flowering. Mol. Plant 2016, 9, 1647–1659. [Google Scholar] [CrossRef] [Green Version]
- Wei, H.; Zhao, Y.; Xie, Y.; Wang, H. Exploiting SPL genes to improve maize plant architecture tailored for high-density planting. J. Exp. Bot. 2018, 69, 4675–4688. [Google Scholar] [CrossRef]
- Gao, R.; Wang, Y.; Gruber, M.Y.; Hannoufa, A. miR156/SPL10 Modulates Lateral Root Development, Branching and Leaf Morphology in Arabidopsis by Silencing AGAMOUS-LIKE 79. Front. Plant Sci. 2017, 8, 2226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, N.; Niu, Q.W.; Ng, K.H.; Chua, N.H. The role of miR156/SPLs modules in Arabidopsis lateral root development. Plant J. Cell Mol. Biol. 2015, 83, 673–685. [Google Scholar] [CrossRef]
- Barrera-Rojas, C.H.; Rocha, G.H.B.; Polverari, L.; Pinheiro Brito, D.A.; Batista, D.S.; Notini, M.M.; da Cruz, A.C.F.; Morea, E.G.O.; Sabatini, S.; Otoni, W.C.; et al. miR156-targeted SPL10 controls Arabidopsis root meristem activity and root-derived de novo shoot regeneration via cytokinin responses. J. Exp. Bot. 2020, 71, 934–950. [Google Scholar] [CrossRef]
- Gou, J.Y.; Felippes, F.F.; Liu, C.J.; Weigel, D.; Wang, J.W. Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell 2011, 23, 1512–1522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, L.G.; Shan, J.X.; Shi, M.; Gao, J.P.; Lin, H.X. The miR156-SPL9-DFR pathway coordinates the relationship between development and abiotic stress tolerance in plants. Plant J. Cell Mol. Biol. 2014, 80, 1108–1117. [Google Scholar] [CrossRef] [PubMed]
- Chao, L.M.; Liu, Y.Q.; Chen, D.Y.; Xue, X.Y.; Mao, Y.B.; Chen, X.Y. Arabidopsis Transcription Factors SPL1 and SPL12 Confer Plant Thermotolerance at Reproductive Stage. Mol. Plant 2017, 10, 735–748. [Google Scholar] [CrossRef]
- Mao, Y.B.; Liu, Y.Q.; Chen, D.Y.; Chen, F.Y.; Fang, X.; Hong, G.J.; Wang, L.J.; Wang, J.W.; Chen, X.Y. Jasmonate response decay and defense metabolite accumulation contributes to age-regulated dynamics of plant insect resistance. Nat. Commun. 2017, 8, 13925. [Google Scholar] [CrossRef] [Green Version]
- Preston, J.C.; Hileman, L.C. SQUAMOSA-PROMOTER BINDING PROTEIN 1 initiates flowering in Antirrhinum majus through the activation of meristem identity genes. Plant J. Cell Mol. Biol. 2010, 62, 704–712. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Hu, T.; Zhao, J. Developmental Functions of miR156-Regulated Squamosa Promoter Binding Protein-Like (SPL) Genes in Arabidopsis thaliana. PLoS Genet. 2016, 12, e1006263. [Google Scholar] [CrossRef] [Green Version]
- He, J.; Xu, M. Threshold-dependent repression of SPL gene expression by miR156/miR157 controls vegetative phase change in Arabidopsis thaliana. PLoS Genet. 2018, 14, e1007337. [Google Scholar] [CrossRef] [Green Version]
- Ioannidi, E.; Rigas, S.; Tsitsekian, D.; Daras, G.; Alatzas, A.; Makris, A.; Tanou, G.; Argiriou, A.; Alexandrou, D.; Poethig, S.; et al. Trichome patterning control involves TTG1 interaction with SPL transcription factors. Plant Mol. Biol. 2016, 92, 675–687. [Google Scholar] [CrossRef] [PubMed]
- Jerome Jeyakumar, J.M.; Ali, A.; Wang, W.M.; Thiruvengadam, M. Characterizing the Role of the miR156-SPL Network in Plant Development and Stress Response. Plants 2020, 9, 1206. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Ye, Y.; Xu, M.; Feng, L.; Xu, L.A. Roles of the SPL gene family and miR156 in the salt stress responses of tamarisk (Tamarix chinensis). BMC Plant Biol. 2019, 19, 370. [Google Scholar] [CrossRef] [Green Version]
- Ma, Y.; Xue, H.; Zhang, F. The miR156/SPL module regulates apple salt stress tolerance by activating MdWRKY100 expression. Plant Biotechnol. J. 2021, 19, 311–323. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, W.; Wang, X.; Yang, R.; Wu, Z.; Wang, H.; Wang, L.; Hu, Z.; Guo, S.; Zhang, H.; et al. MiR156 regulates anthocyanin biosynthesis through SPL targets and other microRNAs in poplar. Hortic. Res. 2020, 7, 118. [Google Scholar] [CrossRef]
- He, N.; Zhang, C.; Qi, X.; Zhao, S.; Tao, Y.; Yang, G.; Lee, T.H.; Wang, X.; Cai, Q.; Li, D.; et al. Draft genome sequence of the mulberry tree Morus notabilis. Nat. Commun. 2013, 4, 2445. [Google Scholar] [CrossRef] [Green Version]
- Huang, H.P.; Ou, T.T.; Wang, C.J. Mulberry (sang shèn zǐ) and its bioactive compounds, the chemoprevention effects and molecular mechanisms in vitro and in vivo. J. Tradit. Complement. Med. 2013, 3, 7–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, Q.; Zhao, L. The Mulberry (Morus alba L.) Fruit-A Review of Characteristic Components and Health Benefits. J. Agric. Food Chem. 2017, 65, 10383–10394. [Google Scholar] [CrossRef]
- Chen, H.; Pu, J.; Liu, D.; Yu, W.; Shao, Y.; Yang, G.; Xiang, Z.; He, N. Anti-Inflammatory and Antinociceptive Properties of Flavonoids from the Fruits of Black Mulberry (Morus nigra L.). PLoS ONE 2016, 11, e0153080. [Google Scholar] [CrossRef]
- Cheng, H.Y.; Wang, Y.; Tao, X.; Fan, Y.F.; Dai, Y.; Yang, H.; Ma, X.R. Genomic profiling of exogenous abscisic acid-responsive microRNAs in tomato (Solanum lycopersicum). BMC Genom. 2016, 17, 423. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Yu, W.; Chen, G.; Meng, S.; Xiang, Z.; He, N. Antinociceptive and Antibacterial Properties of Anthocyanins and Flavonols from Fruits of Black and Non-Black Mulberries. Molecules 2017, 23, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramsay, N.A.; Glover, B.J. MYB-bHLH-WD40 protein complex and the evolution of cellular diversity. Trends Plant Sci. 2005, 10, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Yang, Z.; Zeng, Q.; Wang, S.; Luo, Y.; Huang, Y.; Xin, Y.; He, N. Abnormal expression of bHLH3 disrupts a flavonoid homeostasis network, causing differences in pigment composition among mulberry fruits. Hortic. Res. 2020, 7, 83. [Google Scholar] [CrossRef] [PubMed]
- Jiao, F.; Luo, R.; Dai, X.; Liu, H.; Yu, G.; Han, S.; Lu, X.; Su, C.; Chen, Q.; Song, Q.; et al. Chromosome-Level Reference Genome and Population Genomic Analysis Provide Insights into the Evolution and Improvement of Domesticated Mulberry (Morus alba). Mol. Plant 2020, 13, 1001–1012. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Luo, Y.; Ma, B. Hierarchical Action of Mulberry miR156 in the Vegetative Phase Transition. Int. J. Mol. Sci. 2021, 22, 5550. [Google Scholar] [CrossRef]
- Li, T.; Qi, X.; Zeng, Q.; Xiang, Z.; He, N. MorusDB: A resource for mulberry genomics and genome biology. Database J. Biol. Databases Curation 2014, 2014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, C.; Ye, M.; Sang, M.; Wu, R. A Regulatory Network for miR156-SPL Module in Arabidopsis thaliana. Int. J. Mol. Sci. 2019, 20, 6166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, K.; Wu, C.; Xiong, L. Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiol. 2006, 142, 280–293. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Hou, H.; Li, X.; Xiang, J.; Yin, X.; Gao, H.; Zheng, Y.; Bassett, C.L.; Wang, X. Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.). Plant Physiol. Biochem. 2013, 70, 100–114. [Google Scholar] [CrossRef] [PubMed]









| Gene Name | Gene ID | mRNA Length | CDS Length | Exon Number | Strand | miR156 Target Site |
|---|---|---|---|---|---|---|
| MnSPL1 | Morus013868 | 5282 | 3081 | 10 | - | / |
| MnSPL2 | Morus015493 | 2478 | 1503 | 4 | - | GUGCUCUCUCUCUUCUGUCAA |
| MnSPL3 | Morus009607 | 10,219 | 480 | 2 | + | / |
| MnSPL4 | Morus014488 | 1855 | 513 | 2 | - | UUGCUCUCUCUCUUCUGUCAA |
| MnSPL5 | Morus010322 | 1381 | 630 | 2 | - | / |
| MnSPL6 | Morus026457 | 3240 | 1491 | 3 | - | GUGCUCUCUCUCUUCUGUCAU |
| MnSPL7 | Morus011281 | 5842 | 2535 | 12 | + | GAUGUCUCUUUCCUCUGUCAG |
| MnSPL8 | Morus021788 | 2020 | 1095 | 3 | - | / |
| MnSPL10 | Morus021787 | 2565 | 1302 | 3 | + | / |
| MnSPL12 | Morus025152 | 6389 | 3072 | 10 | - | / |
| MnSPL13 | Morus010123 | 2469 | 1200 | 3 | - | GUGCUCUCUAUCUUCUGUCAU |
| MnSPL14 | Morus024784 | 5168 | 3129 | 10 | - | UUGCUCAC-GUUUUCUGUUGA |
| MnSPL15 | Morus018032 | 2947 | 1110 | 3 | + | GUGCUCUCUCUCUUCUGUCAA |
| MnSPL16A | Morus010792 | 1816 | 1239 | 3 | - | GUGCUCUCUAUCUUCUGUCAA |
| MnSPL16B | Morus017456 | 1515 | 1041 | 3 | - | GUGCUCUCUCUCUUCUGUCAU |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Ma, B.; Luo, Y.; Wei, W.; Yuan, J.; Zhai, C.; He, N. The Mulberry SPL Gene Family and the Response of MnSPL7 to Silkworm Herbivory through Activating the Transcription of MnTT2L2 in the Catechin Biosynthesis Pathway. Int. J. Mol. Sci. 2022, 23, 1141. https://doi.org/10.3390/ijms23031141
Li H, Ma B, Luo Y, Wei W, Yuan J, Zhai C, He N. The Mulberry SPL Gene Family and the Response of MnSPL7 to Silkworm Herbivory through Activating the Transcription of MnTT2L2 in the Catechin Biosynthesis Pathway. International Journal of Molecular Sciences. 2022; 23(3):1141. https://doi.org/10.3390/ijms23031141
Chicago/Turabian StyleLi, Hongshun, Bi Ma, Yiwei Luo, Wuqi Wei, Jianglian Yuan, Changxin Zhai, and Ningjia He. 2022. "The Mulberry SPL Gene Family and the Response of MnSPL7 to Silkworm Herbivory through Activating the Transcription of MnTT2L2 in the Catechin Biosynthesis Pathway" International Journal of Molecular Sciences 23, no. 3: 1141. https://doi.org/10.3390/ijms23031141
APA StyleLi, H., Ma, B., Luo, Y., Wei, W., Yuan, J., Zhai, C., & He, N. (2022). The Mulberry SPL Gene Family and the Response of MnSPL7 to Silkworm Herbivory through Activating the Transcription of MnTT2L2 in the Catechin Biosynthesis Pathway. International Journal of Molecular Sciences, 23(3), 1141. https://doi.org/10.3390/ijms23031141

