Quercetin Reduces Lipid Accumulation in a Cell Model of NAFLD by Inhibiting De Novo Fatty Acid Synthesis through the Acetyl-CoA Carboxylase 1/AMPK/PP2A Axis
Abstract
:1. Introduction
2. Results
2.1. Que Treatment Attenuated Lipid Accumulation in FFA-Treated HepG2 Cells
2.2. Que Treatment Attenuated Endoplasmic Reticulum Stress Triggered by Lipid Accumulation
2.3. Que Treatment Reduced Lipogenic Genes Stimulation in FFAs-Treated HepG2 Cells
2.4. Que Treatment Strongly Inhibits Acetyl-CoA Carboxylase Activity
3. Discussion
4. Materials and Methods
4.1. Cell Culture Conditions, Treatment with Fatty Acids and Quercetin, and Triglycerides Content Determination
4.2. Isolation of RNA from Cultured Cells and Real-Time qPCR Analysis
4.3. Western Blot Analysis
4.4. Determination of ACACA and PP2A Enzymatic Activity
4.5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Perumpail, B.J.; Khan, M.A.; Yoo, E.R.; Cholankeril, G.; Kim, D.; Ahmed, A. Clinical epidemiology and disease burden of nonalcoholic fatty liver disease. World J. Gastroenterol. 2017, 23, 8263–8276. [Google Scholar] [CrossRef]
- Grattagliano, I.; Montezinho, L.P.; Oliveira, P.J.; Frühbeck, G.; Gómez-Ambrosi, J.; Montecucco, F.; Carbone, F.; Wieckowski, M.R.; Wang, D.Q.; Portincasa, P. Targeting mitochondria to oppose the progression of nonalcoholic fatty liver disease. Biochem. Pharmacol. 2019, 160, 34–45. [Google Scholar] [CrossRef]
- Francque, S.; Vonghia, L. Pharmacological Treatment for Non-alcoholic Fatty Liver Disease. Adv. Ther. 2019, 36, 1052–1074. [Google Scholar] [CrossRef] [Green Version]
- Siculella, L.; Tocci, R.; Rochira, A.; Testini, M.; Gnoni, A.; Damiano, F. Lipid accumulation stimulates the cap-independent translation of SREBP-1a mRNA by promoting hnRNP A1 binding to its 5’-UTR in a cellular model of hepatic steatosis. Biochim. Biophys. Acta 2016, 1861, 471–481. [Google Scholar] [CrossRef]
- Smith, G.I.; Shankaran, M.; Yoshino, M.; Schweitzer, G.G.; Chondronikola, M.; Beals, J.W.; Okunade, A.L.; Patterson, B.W.; Nyangau, E.; Field, T.; et al. Insulin resistance drives hepatic de novo lipogenesis in nonalcoholic fatty liver disease. J. Clin. Investig. 2020, 130, 1453–1460. [Google Scholar] [CrossRef]
- Hardy, T.; Wonders, K.; Younes, R.; Aithal, G.P.; Aller, R.; Allison, M.; Bedossa, P.; Betsou, F.; Boursier, J.; Brosnan, M.J.; et al. The European NAFLD Registry: A real-world longitudinal cohort study of nonalcoholic fatty liver disease. Contemp. Clin. Trials 2020, 98, 106175. [Google Scholar] [CrossRef]
- Manco, M. Insulin Resistance and NAFLD: A Dangerous Liaison beyond the Genetics. Children (Basel) 2017, 4, 74. [Google Scholar] [CrossRef] [Green Version]
- Lee, A.H.; Scapa, E.F.; Cohen, D.E.; Glimcher, L.H. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 2008, 320, 1492–1496. [Google Scholar] [CrossRef] [Green Version]
- Rutkowski, D.T.; Wu, J.; Back, S.H.; Callaghan, M.U.; Ferris, S.P.; Iqbal, J.; Vlark, R.; Miao, H.; Hassler, J.R.; Fornek, J.; et al. UPR pathways combine to prevent hepatic steatosis caused by ER stress-mediated suppression of transcriptional master regulators. Dev. Cell 2008, 15, 829–840. [Google Scholar] [CrossRef] [Green Version]
- Kammoun, H.L.; Hainault, I.; Ferré, P.; Foufelle, F. Nutritional related liver disease: Targeting the endoplasmic reticulum stress. Curr. Opin. Clin. Nutr. Metab. Care 2009, 12, 575–582. [Google Scholar] [CrossRef]
- Damiano, F.; Alemanno, S.; Gnoni, G.V.; Siculella, L. Translational control of the sterol-regulatory transcription factor SREBP-1 mRNA in response to serum starvation or ER stress is mediated by an internal ribosome entry site. Biochem. J. 2010, 429, 603–612. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.S.; Mendez, R.; Heng, H.H.; Yang, Z.Q.; Zhang, K. Pharmacological ER stress promotes hepatic lipogenesis and lipid droplet formation. Am. J. Transl. Res. 2012, 4, 102–113. [Google Scholar]
- Galiero, R.; Caturano, A.; Vetrano, E.; Cesaro, A.; Rinaldi, L.; Salvatore, T.; Marfella, R.; Sardu, C.; Moscarella, E.; Gragnano, F.; et al. Pathophysiological mechanisms and clinical evidence of relationship between Nonalcoholic fatty liver disease (NAFLD) and cardiovascular disease. Rev. Cardiovasc. Med. 2021, 22, 755–768. [Google Scholar] [CrossRef]
- EASL-EASD-EASO. Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease. J. Hepatol. 2016, 64, 1388–1402. [Google Scholar] [CrossRef]
- Ryan, M.C.; Itsiopoulos, C.; Thodis, T.; Ward, G.; Trost, N.; Hofferberth, S.; O’Dea, K.; Desmond, P.V.; Johnson, N.A.; Wilson, A.M. The Mediterranean diet improves hepatic steatosis and insulin sensitivity in individuals with non-alcoholic fatty liver disease. J. Hepatol. 2013, 59, 138–143. [Google Scholar] [CrossRef]
- Armandi, A.; Schattenberg, J.M. Beyond the Paradigm of Weight Loss in Non-Alcoholic Fatty Liver Disease: From Pathophysiology to Novel Dietary Approaches. Nutrients 2021, 13, 1977. [Google Scholar] [CrossRef]
- Yi, H.; Peng, H.; Wu, X.; Xu, X.; Kuang, T.; Zhang, J.; Du, L.; Fan, G. The Therapeutic Effects and Mechanisms of Quercetin on Metabolic Diseases: Pharmacological Data and Clinical Evidence. Oxid. Med. Cell. Longev. 2021, 2021, 6678662. [Google Scholar] [CrossRef]
- Damiano, F.; Giannotti, L.; Gnoni, G.V.; Siculella, L.; Gnoni, A. Quercetin inhibition of SREBPs and ChREBP expression results in reduced cholesterol and fatty acid synthesis in C6 glioma cells. Int. J. Biochem. Cell Biol. 2019, 117, 105618. [Google Scholar] [CrossRef]
- Batiha, G.E.; Beshbishy, A.M.; Ikram, M.; Mulla, Z.S.; El-Hack, M.; Taha, A.E.; Algammal, A.M.; Elewa, Y. The Pharmacological Activity, Biochemical Properties, and Pharmacokinetics of the Major Natural Polyphenolic Flavonoid: Quercetin. Foods 2020, 9, 374. [Google Scholar] [CrossRef] [Green Version]
- Moon, J.; Do, H.J.; Kim, O.Y.; Shin, M.J. Antiobesity effects of quercetin-rich onion peel extract on the differentiation of 3T3-L1 preadipocytes and the adipogenesis in high fat-fed rats. Food Chem. Toxicol. 2013, 58, 347–354. [Google Scholar] [CrossRef]
- Gnoni, G.V.; Paglialonga, G.; Siculella, L. Quercetin inhibits fatty acid and triacylglycerol synthesis in rat-liver cells. Eur. J. Clin. Investig. 2009, 39, 761–768. [Google Scholar] [CrossRef]
- Li, X.; Wang, R.; Zhou, N.; Wang, X.; Liu, Q.; Bai, Y.; Bai, Y.; Liu, Z.; Yang, H.; Zou, J.; et al. Quercetin improves insulin resistance and hepatic lipid accumulation in vitro in a NAFLD cell model. Biomed. Rep. 2013, 1, 71–76. [Google Scholar] [CrossRef] [Green Version]
- Rafiei, H.; Omidian, K.; Bandy, B. Dietary Polyphenols Protect Against Oleic Acid-Induced Steatosis in an in Vitro Model of NAFLD by Modulating Lipid Metabolism and Improving Mitochondrial Function. Nutrients 2019, 11, 541. [Google Scholar] [CrossRef] [Green Version]
- Gómez-Lechón, M.J.; Donato, M.T.; Martínez-Romero, A.; Jiménez, N.; Vicente Castell, J.; O’Connor, J.E. A human hepatocellular in vitro model to investigate steatosis. Chem.-Biol. Interact. 2007, 165, 106–116. [Google Scholar] [CrossRef]
- Dara, L.; Ji, C.; Kaplowitz, N. The contribution of endoplasmic reticulum stress to liver diseases. Hepatology 2011, 53, 1752–1763. [Google Scholar] [CrossRef] [Green Version]
- Damiano, F.; Tocci, R.; Gnoni, G.V.; Siculella, L. Expression of citrate carrier gene is activated by ER stress effectors XBP1 and ATF6α, binding to an UPRE in its promoter. Biochim. Biophys. Acta 2015, 1849, 23–31. [Google Scholar] [CrossRef]
- Shimano, H.; Sato, R. SREBP-regulated lipid metabolism: Convergent physiology—Divergent pathophysiology. Nat. Rev. Endocrinol. 2017, 13, 710–730. [Google Scholar] [CrossRef]
- Damiano, F.; Gnoni, G.V.; Siculella, L. Functional analysis of rat liver citrate carrier promoter: Differential responsiveness to polyunsaturated fatty acids. Biochem. J. 2009, 417, 561–571. [Google Scholar] [CrossRef] [Green Version]
- Manka, P.P.; Kaya, E.; Canbay, A.; Syn, W.K. A Review of the Epidemiology, Pathophysiology, and Efficacy of Anti-diabetic Drugs Used in the Treatment of Nonalcoholic Fatty Liver Disease. Dig. Dis. Sci. 2021, 66, 3676–3688. [Google Scholar] [CrossRef]
- Berná, G.; Romero-Gomez, M. The role of nutrition in non-alcoholic fatty liver disease: Pathophysiology and management. Liver Int. 2020, 40, 102–108. [Google Scholar] [CrossRef] [Green Version]
- Ricchi, M.; Odoardi, M.R.; Carulli, L.; Anzivino, C.; Ballestri, S.; Pinetti, A.; Fantoni, L.I.; Marra, F.; Bertolitti, M.; Banni, S.; et al. Differential effect of oleic acid and palmitic acid on lipid accumulation and apoptosis in cultured hepatocytes. J. Gastroenterol. Hepatol. 2009, 24, 830–840. [Google Scholar] [CrossRef]
- Godoy-Matos, A.F.; Silva Júnior, W.S.; Valerio, C.M. NAFLD as a continuum: From obesity to metabolic syndrome and diabetes. Diabetol. Metab. Syndr. 2020, 12, 60. [Google Scholar] [CrossRef]
- Damiano, F.; Gnoni, G.V.; Siculella, L. Citrate carrier promoter is target of peroxisome proliferator-activated receptor alpha and gamma in hepatocytes and adipocytes. Int. J. Biochem. Cell Biol. 2012, 44, 659–668. [Google Scholar] [CrossRef]
- Flessa, C.M.; Kyrou, I.; Nasiri-Ansari, N.; Kaltsas, G.; Papavassiliou, A.G.; Kassi, E.; Randeva, H.S. Endoplasmic Reticulum Stress and Autophagy in the Pathogenesis of Non-alcoholic Fatty Liver Disease (NAFLD): Current Evidence and Perspectives. Curr. Obes. Rep. 2021, 10, 134–161. [Google Scholar] [CrossRef]
- Zheng, Z.; Zhang, C.; Zhang, K. Role of unfolded protein response in lipogenesis. World J. Hepatol. 2010, 2, 203–207. [Google Scholar] [CrossRef]
- Ruvolo, P.P. Ceramide regulates cellular homeostasis via diverse stress signaling pathways. Leukemia 2001, 15, 1153–1160. [Google Scholar] [CrossRef] [Green Version]
- Hajduch, E.; Lachkar, F.; Ferré, P.; Foufelle, F. Roles of Ceramides in Non-Alcoholic Fatty Liver Disease. J. Clin. Med. 2021, 10, 792. [Google Scholar] [CrossRef]
- Vauzour, D.; Corsini, S.; Müller, M.; Spencer, J.P.E. Inhibition of PP2A by hesperetin may contribute to Akt and ERK1/2 activation status in cortical neurons. Arch. Biochem. Biophys. 2018, 650, 14–21. [Google Scholar] [CrossRef]
- Priore, P.; Gnoni, A.; Natali, F.; Testini, M.; Gnoni, G.V.; Siculella, L.; Damiano, F. Oleic Acid and Hydroxytyrosol Inhibit Cholesterol and Fatty Acid Synthesis in C6 Glioma Cells. Oxid. Med. Cell. Longev. 2017, 2017, 9076052. [Google Scholar] [CrossRef] [Green Version]





| Primer | Sequence (5′-3′) |
|---|---|
| hCiCfor | GAAGTTCATCCACGACCAGAC |
| hCiCrev | TCGGTACCAGTTGCGCAGG |
| hFASNfor | GAAGGAGGGTGTGTTTGCC |
| hFASNrev | GGATAGAGGTGCTGAGCC |
| hACACAfor | GCAACCAAGTAGTGAGGATG |
| hACACArev | CTGTTTGGATGAGATGTGGG |
| hSREBP-1for | ACACCATGGGGAAGCACAC |
| hSREBP-1rev | CTTCACTCTCAATGCGCC |
| hDGAT2 for | CGAAAGCCACTTCTCATACA |
| hDGAT2 rev | TGCCTACTACTGCCCTCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gnoni, A.; Di Chiara Stanca, B.; Giannotti, L.; Gnoni, G.V.; Siculella, L.; Damiano, F. Quercetin Reduces Lipid Accumulation in a Cell Model of NAFLD by Inhibiting De Novo Fatty Acid Synthesis through the Acetyl-CoA Carboxylase 1/AMPK/PP2A Axis. Int. J. Mol. Sci. 2022, 23, 1044. https://doi.org/10.3390/ijms23031044
Gnoni A, Di Chiara Stanca B, Giannotti L, Gnoni GV, Siculella L, Damiano F. Quercetin Reduces Lipid Accumulation in a Cell Model of NAFLD by Inhibiting De Novo Fatty Acid Synthesis through the Acetyl-CoA Carboxylase 1/AMPK/PP2A Axis. International Journal of Molecular Sciences. 2022; 23(3):1044. https://doi.org/10.3390/ijms23031044
Chicago/Turabian StyleGnoni, Antonio, Benedetta Di Chiara Stanca, Laura Giannotti, Gabriele Vincenzo Gnoni, Luisa Siculella, and Fabrizio Damiano. 2022. "Quercetin Reduces Lipid Accumulation in a Cell Model of NAFLD by Inhibiting De Novo Fatty Acid Synthesis through the Acetyl-CoA Carboxylase 1/AMPK/PP2A Axis" International Journal of Molecular Sciences 23, no. 3: 1044. https://doi.org/10.3390/ijms23031044
APA StyleGnoni, A., Di Chiara Stanca, B., Giannotti, L., Gnoni, G. V., Siculella, L., & Damiano, F. (2022). Quercetin Reduces Lipid Accumulation in a Cell Model of NAFLD by Inhibiting De Novo Fatty Acid Synthesis through the Acetyl-CoA Carboxylase 1/AMPK/PP2A Axis. International Journal of Molecular Sciences, 23(3), 1044. https://doi.org/10.3390/ijms23031044

