Next Article in Journal
Transcriptomic and Metabolomic Analyses Reveal That Fullerol Improves Drought Tolerance in Brassica napus L
Previous Article in Journal
Cross-Regulation between Autophagy and Apoptosis Induced by Vitamin E and Lactobacillus Plantarum through Beclin-1 Network
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 23
10.3390/ijms232315306
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence and Variability of the Efflux Pump Gene norA across the Staphylococcus Genus †

by
Carolina Ferreira
‡,
Patrícia Abrantes
‡,
Sofia Santos Costa
,
Miguel Viveiros
and
Isabel Couto
*
Global Health and Tropical Medicine, GHTM, Instituto de Higiene e Medicina Tropical, IHMT, Universidade NOVA de Lisboa, UNL, 1349-008 Lisbon, Portugal
*
Author to whom correspondence should be addressed.
†
We dedicate this article to the memory of the mentor Leonard Amaral (1939–2020), who introduced us to the field of efflux pumps and made many important contributions to this area of knowledge.
‡
These authors contributed equally to this work.
Int. J. Mol. Sci. 2022, 23(23), 15306; https://doi.org/10.3390/ijms232315306
Submission received: 2 November 2022 / Accepted: 29 November 2022 / Published: 4 December 2022
(This article belongs to the Section Molecular Microbiology)
Browse Figures
Versions Notes

Abstract

:
NorA is one of the main native MDR efflux pumps of Staphylococcus aureus, contributing to reduced susceptibility towards fluoroquinolones and biocides, but little is known about its variability within S. aureus or its distribution and conservation among other staphylococci. We screened for sequences homologous to S. aureus norA and found it in 61 out of the 63 Staphylococcus species described. To the best of our knowledge, this is the first study to report the occurrence of norA across the Staphylococcus genus. The norA phylogenetic tree follows the evolutionary relations of staphylococci and the closely related Mammalliicoccus genus. Comparative analyses suggest a conservation of the NorA function in staphylococci. We also analyzed the variability of norA within S. aureus, for which there are several circulating norA alleles, differing up to 10% at the nucleotide level, which may hamper proper norA detection. We demonstrate the applicability of a PCR-based algorithm to detect and differentiate norA alleles in 52 S. aureus representing a wider collection of 89 isolates from different hosts. Our results highlight the prevalence of norAI and norAII in different settings and the association of norA alleles with specific S. aureus clonal lineages. Ultimately, it confirms the applicability of our PCR-based algorithm to rapidly detect and assign the different norA alleles, a trait that may impact antimicrobial efflux capacity and the search for potential NorA inhibitors.

1. Introduction

NorA was the first multidrug efflux pump (MDR EP) to be described in Staphylococcus aureus [1] and remains the most well-studied MDR EP of the several native efflux systems described for this bacterium. NorA is a transporter of the major facilitator superfamily (MFS) and is composed of 12 transmembrane segments (TMS) and 388 amino acids [2,3]. Early reports associated this MDR EP with extrusion of a wide range of antimicrobial agents that include fluoroquinolones (particularly with hydrophobic character), several biocides such as quaternary ammonium compounds (cetrimide, benzalkonium chloride), and dyes (ethidium bromide, rhodamine, acriflavine) [1,4]. In the last decade, additional substrates of NorA have been identified, namely siderophores [5] and fusaric acid [6]. The contribution of NorA to the reduced susceptibility towards fluoroquinolones and biocides in S. aureus isolates of human or environmental origin has been demonstrated by several studies [7,8,9,10,11], as well as its role as a first-step resistance mechanism towards these antimicrobial agents [12,13]. Besides S. aureus, less is known about the genetic occurrence of norA among other staphylococci. There is scarce literature on the NorA of S epidermidis, S. pseudintermedius, and S. haemolyticus and its contribution to fluoroquinolone resistance and/or reduced susceptibility to biocides [14,15,16], and little is known about the presence of this MDR EP across the entire Staphylococcus genus.
NorA is encoded by the 1164 bp norA gene. The genetic variability of S. aureus norA was reported earlier in literature with three norA alleles described, namely norAI [2], norAII [17], and norAIII [18]. These gene variants differed by up to 10% and 5% at the nucleotide and polypeptide sequence, respectively. Failure to recognize the inherent variability of the NorA coding gene still results in many reports in the literature describing S. aureus strains as not bearing norA due to failure to conduct amplification with the appropriate set of primers. Another confounding factor is the lack of recognition of norA as an S. aureus core gene with inherent variability in repositories that feed bioinformatic tools for analysis of antibiotic-resistance genes.
In a previous work from our group, we demonstrated that norA is a core gene of S. aureus and that each strain carries one of the several norA alleles [19]. We also reported that besides the three norA alleles already described in the literature, there was at least a fourth allele and potentially several other variants. Additionally, we observed a relation between the different norA alleles and specific S. aureus lineages [19]. Among the databases analyzed, we observed a prevalence of norAI and norAII alleles, since these are related to the current predominant S. aureus clonal complexes, including CC5, CC8, and CC22. In that earlier study, we proposed a molecular approach for the rapid recognition of the different circulating norA alleles based on a set of primers designed to differentiate the four known norA alleles [19].
We now demonstrate the applicability of this molecular approach to detect norA variability among a set of contemporary S. aureus isolates of both human and companion animal origin, further demonstrating the occurrence of different S. aureus norA alleles and their relationship with specific S. aureus clonal lineages. We also extend our analysis to the remaining Staphylococcus genus by screening the presence of a norA determinant in the genomes of strains representative of 61 staphylococcal species and the closely related Mammalliicoccus genus and by proposing that this element is part of the staphylococcal core genome.

2. Results and Discussion

2.1. The norA Gene Is Ubiquitous across the Staphylococcus Genus

To better understand if norA is ubiquitous within the Staphylococcus genus, sequences homologous to S. aureus norA were screened in available databases. The retrieved nucleotide sequences of the norA gene from different Staphylococcus species were aligned and studied in terms of phylogeny. The corresponding polypeptide sequences were analyzed, and the impact of possible residue substitutions on NorA activity was predicted.
A total of 61 nucleotide sequences representing the norA gene from 61 out of the 63 staphylococcal species described to date was found in the available genome databases (Supplementary Material S1), highlighting that the corresponding efflux pump is part of the fundamental machinery of the staphylococcal cell. The two species not included in this analysis were S. canis, for which we only found an incomplete norA sequence, and S. massiliensis, for which no norA related sequence was found, possibly because its genome is not yet fully sequenced.
A multiple alignment was performed for the 61 nucleotide sequences retrieved together with the three S. aureus norA prototype alleles. The norA sequences of the five species that were recently reclassified to the new genus Mammalliicoccus, namely M. sciuri (formerly S. sciuri), M. fleurettii (formerly S. fleurettii), M. vitulinus (formerly S. vitulinus), M. lentus (formerly S. lentus), and M. stepanovicii (formerly S. stepanovicii) were also included in the alignment due to the historical and phylogenetic relatedness with the Staphylococcus genus. The highest norA identity among the species analyzed in this study was between M. fleurettii and S. schleiferi, with 100.0% sequence identity (which may reflect M. fleurettii misassignment in databases), while the largest nucleotide difference was found between S. delphini and M. vitulinus and corresponded to 54.5% identity
As shown in Figure 1A, the norA phylogenetic tree reconstructed by the maximum likelihood method identified seven cluster groups. A monophyletic group containing M. lentus, M. sciuri, M. vitulinus and M. stepanovicii was identified as the sister group to all other Staphylococcus analyzed, a result in line with the recent assignment of these four species to the new Mammalliicoccus genus [20]. As expected, norAI, norAII, and norAIII from S. aureus formed a strongly supported sub-cluster (bootstrap = 100%), together with S. argentus, S. schweitzeri, S. roterodami, and S. singaporensis—four recently renamed species that were previously described as divergent lineages of S. aureus [21,22,23]. Except for M. fleurettii, also recently reassigned to the new Mammalliicoccus genus, most relations within the norA gene phylogenetic tree are in general agreement with the evolutionary relations of staphylococci based on the phylogenetic tree of 16S-23S rRNA region obtained by Kosecka-Strojel et al. (2019) [24], highlighting the presence of norA in the early branching of the Staphylococcus genus.

2.2. Characterization of the NorA Predicted Polypeptide Sequences across Staphylococci

Figure 1B illustrates the phylogenetic tree based on NorA polypeptide sequences built using a maximum likelihood tree, showing a similar evolutionary relation at the nucleotide and at the protein level. An exception was observed for S. epidermidis and S. aureus clusters that are merged at the polypeptide level.
Figure 2 displays the alignment of the 68 polypeptide sequences of NorA and NorA-like found across staphylococci and the newly established Mammalliicoccus genus. Identity of NorA sequences among Staphylococcus species varies between 64.0% and 100.0%. The highest divergency was observed between S. simulans and S. lutrae (140 residues difference), while the most closely related protein sequences were observed between M. fleuretti and S. schleiferi and between S. roterodami and S. singaporensis, corresponding to 100% identity.
Figure 2 summarizes these alterations and their location within the predicted NorA sequences as well as consensus and conservation histograms for each TMS when compared to NorAI of S. aureus. This comparative analysis indicates a higher divergence on the C-terminal region, in agreement with the knowledge that efflux pumps from the MFS 12-TMS families share greater sequence similarity within their N-termini [25]. As observed for other MFS pumps, the predicted NorA presents high percentage of glycines in TMS5 and an overall conservation of this TMS among the different staphylococcal species. Abundance of glycines in TMS5 has been postulated to confer conformational plasticity to efflux pumps [26].
We also observed a high divergence in the polypeptide region between the putative transmembrane segments TMS6 and TMS7 (residues 176–202), within TMS9 and TMS12 and in C-terminal, while the least divergent region is located between residues 300–345, encompassing the transmembrane segments TMS10 and TMS11. Several residue substitutions were found within MFS conserved motifs [25,27]. Motif A (G1xL3aD5rxG8rkxxl), which includes the cytoplasmatic loop between TMS2 and TMS3, is mostly conserved, yet residue substitutions at the position L3 are encountered in a few species of the S. haemolyticus cluster (Leu61Met) and in the Mammalliicoccus cluster (Leu61Phe). Motif B (lxxxR5xxqG9xgaa), located within TMS4; Motif C (gxxxG5P6xxG9G10xl), located within TMS5; and Motif G (G1xxxG5P6L7) within TMS11 were mostly conserved throughout all predicted NorA sequences.
Ijms 23 15306 g001a 550Ijms 23 15306 g001b 550
Figure 1. Phylogenetic analysis of the norA efflux pump gene (A) and NorA efflux pump (B) across the Staphylococcus genus. Maximum likelihood (ML) consensus tree rooted at midpoint and drawn to scale, with branch lengths in the scale of nucleotide (A) or aminoacid (B) substitutions per site. Bootstrap support values are illustrated at branch nodes. The species highlighted by * correspond to the species that were recently proposed to be reclassified from Staphylococcus to the new Mammalliicoccus genus.
Figure 1. Phylogenetic analysis of the norA efflux pump gene (A) and NorA efflux pump (B) across the Staphylococcus genus. Maximum likelihood (ML) consensus tree rooted at midpoint and drawn to scale, with branch lengths in the scale of nucleotide (A) or aminoacid (B) substitutions per site. Bootstrap support values are illustrated at branch nodes. The species highlighted by * correspond to the species that were recently proposed to be reclassified from Staphylococcus to the new Mammalliicoccus genus.
Ijms 23 15306 g001aIjms 23 15306 g001b
Ijms 23 15306 g002a 550Ijms 23 15306 g002b 550
Figure 2. Multiple alignment of NorA polypeptide sequences derived from S. aureus alleles norAI [2], norAII [17], and norAIII [18] and from the norA sequences identified for other Staphylococcus species. Blue boxes correspond to the transmembrane segments (TMS) of NorA predicted by Brawley et al. [28] and red boxes to the MFS conserved motifs predicted by Paulsen et al. [25]. Consensus and conservation tracks are displayed for each of the TMS identified. Consensus histogram (black) reflects the percentage of the modal residue per column (‘+’ denotes non-conserved residues). Conservation histogram (yellow) reflects conservation of the physicochemical properties (‘*’ absolutely conserved residues, ‘+’ physicochemical properties conserved; less conserved positions are shown in darker colors with decreasing score <9).
Figure 2. Multiple alignment of NorA polypeptide sequences derived from S. aureus alleles norAI [2], norAII [17], and norAIII [18] and from the norA sequences identified for other Staphylococcus species. Blue boxes correspond to the transmembrane segments (TMS) of NorA predicted by Brawley et al. [28] and red boxes to the MFS conserved motifs predicted by Paulsen et al. [25]. Consensus and conservation tracks are displayed for each of the TMS identified. Consensus histogram (black) reflects the percentage of the modal residue per column (‘+’ denotes non-conserved residues). Conservation histogram (yellow) reflects conservation of the physicochemical properties (‘*’ absolutely conserved residues, ‘+’ physicochemical properties conserved; less conserved positions are shown in darker colors with decreasing score <9).
Ijms 23 15306 g002aIjms 23 15306 g002b
A recent study by Brawley and colleagues determined the first S. aureus NorA structure, complexed with a synthetic antigen-binding fragment (Fab36) [28]. This study revealed eleven residues that may play an important functional role in NorA, since their substitution significantly affected resistance to norfloxacin, a substrate of NorA. We observed a conservation of six out of those eleven residues through Staphylococcus spp. and that the residue substitutions were mostly specific to some of the NorA clusters (Figure 1B and Figure 2). The alterations Gly20Ser and Thr336Ala were only detected in the Mammalliicoccus cluster, whereas the alterations Asn137Ser and Phe140Tyr were found in all or some of the species included in the S. pseudintermedius cluster, respectively. Additionally, the Ile23Val substitution was detected in the S. simulans cluster and all species of the S. saprophyticus cluster except for S. pettenkoferi and S. argensis. We expanded this analysis using the SuSPect algorithm with the NorA structural model described by Brawley and colleagues [28] to predict deleterious variants in the protein. The differences encountered between the several NorA polypeptide sequences correspond to residues that were not predicted to be pivotal for the protein activity (Supplementary Material S2), again reinforcing a conservation of NorA function across staphylococci.
In another recent study, Shang and colleagues describe alterations in the 277–297 polypeptide region that have a significant impact on NorA efflux activity and resistance to fluoroquinolones and could be partially responsible for the functional differences of the NorA EP in S. aureus, particularly the substitutions Val281Ile, Phe288Ile, and Asn290Asp, suggesting that the 277–297 region plays a major role in NorA conformational stabilization [29]. However, this region is significantly variable among staphylococcal NorA sequences analyzed in our study. In particular, residues Val281, Phe288, and Asn290 present several different alterations across staphylococci, including in species for which NorA activity and its association with fluoroquinolone resistance has already been demonstrated, namely S. epidermidis [14] and S. pseudintermedius [16], suggesting that additional residues may be involved in the conformational stabilization of the NorA family.

2.3. Applicability of a Molecular Approach for Rapid norA Allele Screening in S. aureus

After establishing the presence of the norA determinant among the entire Staphylococcus genus, we then focused our study on the variability of this determinant within S. aureus. We have previously established that norA is a core gene of S. aureus and that each strain carries one of several norA alleles. This led to the proposal of a molecular approach for the rapid detection of the different norA alleles as failure to detect a norA variant may result into misleading interpretations [19].
The primers proposed earlier to screen this allelic variability [19] were now applied as suggested, with few modifications (Table 1), to our study collection of 52 S. aureus strains of human (n = 25) or companion animal (n = 27) origin, representative of all the PFGE types or sub-types previously detected in a wider collection of 89 S. aureus strains. The main characteristics of these strains have been described elsewhere, including antibiotic susceptibility and molecular typing [30,31]. Briefly, the 25 strains of human origin comprised 16 clonal lineages, as defined by MLST, corresponding mainly to clonal complexes CC5, CC7, CC8, CC15, CC22, CC25, CC30, CC45, CC97, CC152 [30]. The 27 S. aureus from veterinary sources included 14 clonal lineages belonging to CC1, CC5, CC7, CC8, CC15, CC22, CC97, CC121, and CC398 [31].
A norA amplification product was obtained for each strain tested, further confirming our earlier observation that the norA gene is part of the S. aureus core genome. Additionally, a single amplification product was obtained with the three sets of primers used for 50 out of the 52 strains tested (Table 2). The only exceptions were the two S. aureus carrying the norACC59–CC121 allele that amplified with the primers for norAIII/norACC59–CC121 and with the ones for norAI (Table 2).
Our previous study suggested that each norA allele is related to specific S. aureus clonal lineages [19], which was confirmed in the present work. For example, S. aureus belonging to CC5 and CC8, predicted to carry the norAI allele, only produced an amplification product when subjected to the norAI-specific PCR, whereas those belonging to CC22 and CC398, predicted to harbor norAII allele, were only positive in the norAII-specific PCR (Table 2). The association of norAIII allele and CC45 was also confirmed, considering that the single ST278 strain belongs to the CC45 clonal lineage. On the other hand, the strain belonging to ST121, expected to carry norACC59–CC121, showed an unexpected result by producing amplicons with both norAI and norAIII/norACC59–CC121 primers. Nevertheless, when subjected to enzymatic digestion with HindIII, the norAIII/norACC59–CC121-PCR amplicon was not digested, as expected for a norACC59–CC121 allele (Table 2).
Some of the strains tested belong to clonal lineages for which no association with a particular norA allele has been established yet, namely CC7, CC25, CC97, and the singletons ST816 and ST6564. By applying our molecular approach, we were able to assign a norA allele to each one of these strains (Table 2). In particular, norAI was found in strains from lineages CC7, CC25, and CC97, while norAII was associated with ST6564. The ST816 strain presented a pattern similar to the one obtained for the ST121 strain, indicating that ST816 strain also harbors norACC59–CC121 (Table 2).
To further confirm the assignment of norA allelic profiles, we sequenced the entire norA gene in a subset of 16 strains belonging to the 12 main clonal lineages present in the collection. For each strain, we amplified, sequenced, and assembled three PCR products to obtain the full 1164 bp sequence of norA. For strains belonging to ST22, ST5, ST7, and ST97, norA sequences were obtained for two strains, either from human or companion animal origin. Multiple alignment of the 16 norA sequences with each prototype allele confirmed the correct PCR-based allelic assignment. As expected, each strain tested harbored a norA allele with up to 10 nucleotides of difference toward the respective prototype norA. Of them, norAI showed less variability, with nucleotide identity ranging from 99.9% (a single nucleotide variation) to 100% (Figure 3A). The norAII allele was more variable, with nucleotide identities varying from 98.9% to 100% (Figure 3B). The single norAIII detected showed no variation to the prototype allele (Figure 3C). Regarding the norACC59–CC121 allele, the analysis was conducted against the norA sequences retrieved from two strains of clonal lineages ST59 and ST121 with complete genomes available at GenBank Database. Nucleotide identities varied from 99.6% to 100% when aligned with the ST121-associated norA and from 96.0% to 96.1% when aligned with norA from the ST59 strain (Figure 3D).
Although limited, the variations observed among the different norA alleles may impact NorA efflux activity and therefore susceptibility towards several antimicrobial agents. Considering the intra-allelic variation, most of the alterations found were silent and only a few resulted in alterations in the polypeptide sequence. Regarding the norAI allele, we found a nucleotide variation in one ST8 strain that resulted in the substitution Gly291Asp. This same alteration had already been identified in previous studies, both in fluoroquinolone-susceptible and -resistant strains, thus it is not expected to affect NorA activity [33]. Regarding the norAII allele, we found the substitution Asn200Asp in two ST22 strains. It was not possible to ascertain the intra-allelic variation of norAIII, since this less frequent allele was only detected in a single strain. Regarding the norACC59–CC121 allele, there are several nucleotide alterations between the norA CC59 and norA CC121 prototype sequences that yield 11 amino acid variations. The strain belonging to ST816 has three and 10 amino acid alterations when compared to the CC121 and CC59 sequences, respectively (Figure 3D).
In terms of inter-allelic variability, the norAI allele has ~91% identity at the nucleotide level with the norAII and norAIII alleles and ~96% identity with the norACC59–CC121 allele (Figure 3E). The norAII allele has ~91% identity with the norAIII and the norACC59–CC121 allele, but the identity is lower (88.9%) in comparison with the CC121 reference norA. The norAIII allele has 91.8% to 94.9% identity with the norACC59–CC121 allele. An identity of 96.1% was also found between the norA sequences of CC59 and CC121 strains (Figure 3E). Regarding the allelic products (Figure 3F), we observed an identity ranging between 93.4% (NorACC59 vs. NorAII) and 97.9% (NorACC59 vs. NorAI).
Based on our findings, we now delineate a workflow aiming at a rapid screening of norA alleles in S. aureus (Figure 4). The proposed workflow allowed the detection and differentiation of norA alleles in S. aureus collections from different settings and hosts, demonstrating the applicability of our PCR-based algorithm to rapidly identify the different norA alleles.

2.4. Prevalence of S. aureus norA Alleles and Their Association with Specific Clonal Lineages

Applying the proposed workflow to the subset of 52 strains studied, norAI was the most prevalent allele, carried by 32 (32/52, 61.6%) strains, followed by norAII, present in 17 (17/52, 32.7%) strains. A single strain harbored the norAIII allele (1/52, 1.9%). Interestingly, we also detected the recently described norACC59–CC121 allele in two strains (2/52, 3.8%) (Table 3). Taking the whole collection in consideration (n = 89), assuming isolates from the same clonal lineage harbor the same norA allele, the allelic distribution was as follows: norAI: 47/89 (52.8%), norAII: 39/89 (43.9%), norACC59–CC121: 2/89 (2.2%), and norAIII: 1/89 (1.1%).
Analyzing the allelic prevalence according to the host (human vs. companion animal) from which strains were isolated, we observed a predominance of norAI for strains of human origin (n = 24, 24/34, 70.6%), followed by norAII (n = 9, 9/34, 26.5%) and norAIII (n = 1, 1/34, 2.9%). For strains from companion animals, norAI and norAII were found at somewhat similar frequencies; 23/55 (41.8%) and 30/55 (54.6%), respectively. The norACC59–CC121 allele was only identified in two strains (2/55, 3.6%) from one horse and one rabbit. The difference between the prevalence of these alleles among isolates of human or companion animal origin could be explained by the wider dissemination of specific S. aureus lineages within those hosts.
In sum, we observed the prevalence of the two alleles norAI and norAII, which account for up to ~97% of the norA variants found in the 89 S. aureus isolated from human and companion animals. This result is in accordance with our previous analysis of genomic datasets (from 1038 S. aureus strains) [19], which also revealed that norAI and norAII accounted for over 96% of all genomes screened.
Our previous findings suggested that one could infer which norA allele would be expected according to the strain clonal lineage [19]. We now demonstrate this inference to be correct for all strains tested by superimposing the existing information on each strain clonality with the respective norA allelic profile (Table 2). The most prevalent allele in this collection, norAI, was identified in strains of the clonal complexes CC1, CC5, CC8, and CC15 and also in CC7, CC25, and CC97. We confirmed the presence of norAII in CC22, CC30, CC152, CC398, and the newly identified singleton ST6564. As expected, the less frequent alleles norAIIII and norACC59–CC121 were detected in strains from CC45 and CC121, respectively. We were also able to associate norACC59–CC121 with the animal-related lineage ST816 (Table 2). These data allow us to illustrate the global distribution of norA alleles among the main S. aureus clonal lineages (Figure 5).

2.5. Implications for Future Work

The results described in this paper reinforce norA as an important element of the S. aureus genome as well as of the entire Staphylococcus genus. Establishing norA as a conserved gene across Staphylococcus will assist in better understanding the staphylococcal efflux machinery.
We also demonstrated the presence of several S. aureus norA circulating alleles, whose distribution mimics the S aureus main strain lineages defined by MLST. We now confirm the applicability of an experimental workflow to detect the different norA alleles. The wider application of this workflow by others will obviate the difficulties observed in the recent past years on the detection of the different norA alleles and data interpretation, a problem experienced by many researchers that seriously impacted knowledge advance in this area.
The finding that norA is part of the S. aureus core genome and thus is present in all S. aureus strains implies that reporting the detection of this gene is not sufficient to make a direct association with a particular resistance phenotype. To make such a correlation, one must carry out expression analysis of the norA gene as well as of other efflux pump genes, as it has been shown that S. aureus strains can display different efflux pump gene expression patterns [7,9,34], even under pressure of the same antimicrobial [8,10,12].
The observed norA variability may also impact the design of specific inhibitors, an area of growing interest. As pointed out by Brooks and colleagues [35], most of the studies on genes encoding efflux pumps address substrate specificity but fail to take into consideration the conservation of these genes at the strain level. In the case of norA, there are two levels of variation to consider: (i) the different circulating alleles and (ii) the intra-allelic nucleotide variation. In particular, most of the studies carried out on the development of NorA inhibitors are based on strain SA-1199 and its derivative, SA-1199B, constructed by Kaatz and colleagues [36]. This strain carries the norAIII allele, which is seldom found among isolates of clinical origin. This allele shows 9% differences in the nucleotide sequence compared to the more prevalent norAI and norAII, that together may account for up to 96% of circulating S. aureus lineages.
Further studies should expand this work to other settings to get a global picture of norA diversity and distribution. Additional questions to be addressed should include (i) assay of the functionality of the different norA alleles; (ii) detailed regulation of gene expression; (iii) design/testing of (specific) efflux inhibitors for each specific allele.

3. Materials and Methods

3.1. Screening of norA Alleles among Contemporary S. aureus Strains

3.1.1. Bacterial Strains

The S. aureus study collection comprised 52 strains causing skin and soft tissue infections (SSTIs) in humans or companion animals. The 25 strains of human origin (9 MRSA and 16 MSSA) were recovered from 26 ambulatory patients over a five-months period in 2014 [30], whereas the 27 strains of animal origin (14 MRSA and 13 MSSA) were recovered from 15 dogs, 6 cats, 4 rabbits, one horse, and one isolate collected from an unknown animal host, all originating from either an academic veterinary laboratory from 2001 to 2018 or a veterinary private diagnostic laboratory during 2017 or 2018 [31]. These 52 S. aureus strains are representative of all the PFGE types or sub-types previously detected in a wider collection of 89 S. aureus strains (34 from humans and 55 from animals) [30,31] with clonal lineages established by MLST [30,31].

3.1.2. Screening of norA Alleles

The primers used for amplification of the different norA alleles were the ones proposed earlier [19]. The primers and PCR conditions are discriminated in Table 1. Briefly, the molecular approach proposed is based on the PCR amplification of allele-specific fragments using three pairs of primers, in which the reverse primed is shared. Each PCR reaction was performed with 1.75 mM MgCl2, 0.2 mM dNTPs, 0.4 μM of each primer, 1x Taq buffer, and 0.03 U of NZYTaq II. All reagents were acquired from NZYTech (Lisbon, Portugal). Amplification products of the norAIII/norACC59–CC121 alleles were further analyzed by restriction of 20 μL of PCR products with 10 U of HindIII (New England Biolabs, Ipswitch, MA, USA) at 37 °C for 90 min, followed by gel electrophoresis in 1% agarose gels.

3.1.3. norA Sequencing

Representative strains of the major clonal lineages were selected for analysis of the entire norA gene. A set of PCRs was previously designed to amplify three regions (A, B, and C) of the norA gene, using three pair of primers [19]. PCR products were sequenced at STAB-Vida (Caparica, Portugal), and the sequences were analyzed and assembled with the program SnapGene Viewer v. 5.1.4.1 (GSL Biotech, San Diego, CA, USA; available at snapgene.com). Alignments were made using MEGA v. 7.0.26 [37]. Sequences were aligned against the prototype sequences of the three established norA alleles (norAI: D90119.1; norAII: AB019536.1; norAIII: M97169.1) as well as two norA sequences related to the norACC59–CC121 allele (CC59: strain M013, CP003166 [742094:743260]; CC121: strain XQ, CP013137 [180371:181537]).

3.1.4. Relation between norA and S. aureus Clonal Lineages

The allelic profiles of all S. aureus sequence types (ST) described to date (28 October 2022) were retrieved from the PubMLST database (https://pubmlst.org/organisms/staphylococcus-aureus, accessed on 28 October 2022) and used to construct a minimum spanning tree representing the evolutionary relations between clonal lineages using the goeBURST algorithm [38] with the PHYLOViZ 2.0 Online software (https://online.phyloviz.net/index, accessed on 28 October 2022) [39]

3.2. Survey of the Gene Coding for the NorA Efflux Pump among the Staphylococcus Genus

Nucleotide sequences of the norA gene from 61 different Staphylococcus species were obtained from two different sources: reference norA genes for the 56 species available at RefSeq [40] and putative norA genes obtained from genome projects for the remaining 7 staphylococcal species available in the Ensembl Bacteria, release 49 database (https://bacteria.ensembl.org/index.html, accessed on 28 October 2022). This analysis also included the norA sequences of the five Mammalliicoccus species, all retrieved from the RefSeq repository. Accession numbers for these sequences can be found in Supplementary Material S1.
Sequences were aligned with the S. aureus norAI sequence using the Muscle algorithm provided in the MEGA v11 software package [41] and exported for W-IQ-TREE [42] for phylogenetic analysis. After selection of the best substitution model, a maximum likelihood (ML) tree was reconstructed using a GTR+F+I+G4 model, the ultra-fast bootstrapping option [43], and SH-aLRT support values [44] calculated from 1000 replicates. Visualization of the resulting phylogenetic tree was performed with FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/, accessed on 20 October 2022).

3.3. Characterization of NorA Polypeptide Sequences across Staphylococci

NorA amino acid sequences derived from the 61 sequences previously identified for the evolutionary study of norA gene, which include the three S. aureus norA prototype alleles and the five norA sequences from the Mammalliicoccus species (described in detail in Supplementary Material S1), were aligned using the Muscle algorithm included in MEGA v11 [41]. The resulting multiple sequence alignment was exported for W-IQ-TREE [42] for phylogenetic analysis and for Jalview v2.11.2.5 program [45] for conserved motif visualization.
After selection of the best substitution model in W-IQ-TREE [42], a maximum likelihood (ML) tree was reconstructed using an LG+I+G4 model, the ultra-fast bootstrapping option [43], and SH-aLRT support values [44] calculated from 1000 replicates. Visualization of the resulting phylogenetic tree was performed with FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/, accessed on 20 October 2022).
In parallel, multiple sequence alignment was visualized and edited with the Jalview v2.11.2.5 program [45]. Transmembrane segments (TMS) and conserved motifs described for MFS transporters with 12 TMS [28] were manually identified and compared between sequences. Consensus and conservation histograms were calculated for each of the TMS and motifs using Jalview.
The in silico platform PHYRE2 (Protein Homology/analogY Recognition Engine v2.0) [46] was used to identify the tridimensional structure most similar to the S. aureus NorAI (98% identity), namely the c7Lo8z model of NorA protein in complex with Fab36 [28]. Impact of possible residue substitutions on NorA activity was predicted with the SuSPect algorithm [47], based on the c7Lo8z model, producing a table of scores from 0 to 100 according to predicted deleteriousness (0 = neutral to 100 = deleterious). A score of 50 was recommended as a cut-off between neutral and deleterious variants, with extreme scores allowing more confident predictions [47]. In this work, a score of ≥75 was used as cut-off value.

4. Conclusions

The results described in this study show that norA is part of the staphylococcal genomic patrimony that follows the evolutionary pathway of these bacteria. Our data also suggest an overall conservation of NorA function across staphylococci. The analysis of norA variability within several species opens new avenues for the study of the role played by NorA in other staphylococci of clinical relevance. We also described and applied a molecular approach to study norA variability within S. aureus. This approach confirmed norA as a part of the S. aureus core genome and rapidly distinguished several circulating alleles. The observed association between S. aureus genetic lineages and norA alleles is relevant, as it may impact in efflux activity and the design of NorA inhibitors.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms232315306/s1.

Author Contributions

Conceptualization, S.S.C. and I.C.; methodology, P.A., S.S.C. and I.C.; software, P.A.; validation, S.S.C. and I.C.; formal analysis, C.F., P.A., S.S.C. and I.C.; investigation, C.F., P.A. and S.S.C.; resources, I.C.; data curation, C.F., P.A. and S.S.C.; writing—original draft preparation, C.F., P.A., S.S.C. and I.C.; writing—review and editing, C.F., P.A., S.S.C., M.V. and I.C.; visualization, C.F. and S.S.C.; supervision, S.S.C. and I.C.; project administration, I.C.; funding acquisition, I.C. and S.S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Project BIOSAFE funded by FEDER through the Programa Operacional Factores de Competitividade—COMPETE and by Fundação para a Ciência e a Tecnologia (FCT, Portugal)—Grant LISBOA-01-0145-FEDER-030713, PTDC/CAL-EST/30713/2017 and by FCT through grant 2021.05063.BD (C.F) and funds to GHTM (UID/04413/2020).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data have been provided in the paper. Raw data can also be provided by the authors upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ubukata, K.; Itoh-Yamashita, N.; Konno, M. Cloning and expression of the norA gene for fluoroquinolone resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 1989, 33, 1535–1539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Yoshida, H.; Bogaki, M.; Nakamura, S.; Ubukata, K.; Konno, M. Nucleotide sequence and characterization of the Staphylococcus aureus norA gene, which confers resistance to quinolones. J. Bacteriol. 1990, 172, 6942–6949. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Lewis, K. Multidrug resistance pumps in bacteria: Variations on a theme. Trends Biochem. Sci. 1994, 19, 119–123. [Google Scholar] [CrossRef] [PubMed]
  4. Neyfakh, A.A.; Borsch, C.M.; Kaatz, G.W. Fluoroquinolone resistance protein NorA of Staphylococcus aureus is a multidrug efflux transporter. Antimicrob. Agents Chemother. 1993, 37, 128–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Deng, X.; Ji, Q.; Liang, H.; Missiakas, D.; Lan, L.; He, C. Expression of multidrug resistance efflux pump gene norA is iron responsive in Staphylococcus aureus. J. Bacteriol. 2012, 194, 1753–1762. [Google Scholar] [CrossRef] [Green Version]
  6. Marchi, E.; Furi, L.; Arioli, S.; Morrissey, I.; Di Lorenzo, V.; Mora, D.; Giovannetti, L.; Oggioni, M.R.; Viti, C. Novel insight into antimicrobial resistance and sensitivity phenotypes associated to qac and norA genotypes in Staphylococcus aureus. Microbiol. Res. 2015, 170, 184–194. [Google Scholar] [CrossRef]
  7. DeMarco, C.E.; Cushing, L.A.; Frempong-Manso, E.; Seo, S.M.; Jaravaza, T.A.A.; Kaatz, G.W. Efflux-related resistance to norfloxacin, dyes, and biocides in bloodstream isolates of Staphylococcus aureus. Antimicrob. Agents Chemother. 2007, 51, 3235–3239. [Google Scholar] [CrossRef] [Green Version]
  8. Huet, A.A.; Raygada, J.L.; Mendiratta, K.; Seo, S.M.; Kaatz, G.W. Multidrug efflux pump overexpression in Staphylococcus aureus after single and multiple in vitro exposures to biocides and dyes. Microbiology 2008, 154, 3144–3153. [Google Scholar] [CrossRef] [Green Version]
  9. Kosmidis, C.; DeMarco, C.E.; Frempong-Manso, E.; Seo, S.M.; Kaatz, G.W. In silico genetic correlations of multidrug efflux pump gene expression in Staphylococcus aureus. Int. J. Antimicrob. Agents 2010, 36, 222–229. [Google Scholar] [CrossRef]
  10. Costa, S.S.; Falcão, C.; Viveiros, M.; Machado, D.; Martins, M.; Melo-Cristino, J.; Amaral, L.; Couto, I. Exploring the contribution of efflux on the resistance to fluoroquinolones in clinical isolates of Staphylococcus aureus. BMC Microbiol. 2011, 11, e241. [Google Scholar] [CrossRef]
  11. Furi, L.; Ciusa, M.L.; Knight, S.; Di Lorenzo, V.; Tocci, N.; Cirasola, D.; Aragones, L.; Coelho, J.R.; Freitas, A.T.; Marchi, E.; et al. Evaluation of reduced susceptibility to quaternary ammonium compounds and bisbiguanidines in clinical isolates and laboratory-generated mutants of Staphylococcus aureus. Antimicrob. Agents Chemother. 2013, 57, 3488–3497. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Costa, S.S.; Viveiros, M.; Rosato, A.E.; Melo-Cristino, J.; Couto, I. Impact of efflux in the development of multidrug resistance phenotypes in Staphylococcus aureus. BMC Microbiol. 2015, 15, 232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Papkou, A.; Hedge, J.; Kapel, N.; Young, B.; MacLean, R.C. Efflux pump activity potentiates the evolution of antibiotic resistance across S. aureus isolates. Nat. Commun. 2020, 11, 3970. [Google Scholar] [CrossRef] [PubMed]
  14. Costa, S.S.; Viveiros, M.; Pomba, C.; Couto, I. Active antimicrobial efflux in Staphylococcus epidermidis: Building up of resistance to fluoroquinolones and biocides in a major opportunistic pathogen. J. Antimicrob. Chemother. 2018, 73, 320–324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Marco, L.; Liliana, G.; Anna, B.; Annarita, M. Intrinsic role of coagulase negative staphylococci norA-like efflux system in fluoroquinolones resistance. AIMS Microbiol. 2017, 3, 908–914. [Google Scholar] [CrossRef]
  16. Rampacci, E.; Felicetti, T.; Pietrella, D.; Sabatini, S.; Passamonti, F. Drug efflux transporters in Staphylococcus pseudintermedius: In silico prediction and characterization of resistance. J. Antimicrob. Chemother. 2022, 77, 3283–3290. [Google Scholar] [CrossRef] [PubMed]
  17. Noguchi, N.; Okada, H.; Narui, K.; Sasatsu, M. Comparison of the nucleotide sequence and expression of norA genes and microbial susceptibility in 21 strains of Staphylococcus aureus. Microb. Drug Resist. 2004, 10, 197–203. [Google Scholar] [CrossRef]
  18. Kaatz, G.W.; Seo, S.M.; Ruble, C.A. Efflux-mediated fluoroquinolone resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 1993, 37, 1086–1094. [Google Scholar] [CrossRef] [Green Version]
  19. Costa, S.S.; Sobkowiak, B.; Parreira, R.; Edgeworth, J.D.; Viveiros, M.; Clark, T.G.; Couto, I. Genetic diversity of norA, coding for a main efflux pump of Staphylococcus aureus. Front. Genet. 2019, 9, 710. [Google Scholar] [CrossRef]
  20. Madhaiyan, M.; Wirth, J.S.; Saravanan, V.S. Phylogenomic analyses of the Staphylococcaceae family suggest the reclassification of five species within the genus Staphylococcus as heterotypic synonyms, the promotion of five subspecies to novel species, the taxonomic reassignment of five Staphylococcus species to Mammalliicoccus gen. nov., and the formal assignment of Nosocomiicoccus to the family Staphylococcaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 5926–5936. [Google Scholar] [CrossRef]
  21. Becker, K.; Schaumburg, F.; Kearns, A.; Larsen, A.R.; Lindsay, J.A.; Skov, R.L.; Westh, H. Implications of identifying the recently defined members of the Staphylococcus aureus complex S. argenteus and S. schweitzeri: A position paper of members of the ESCMID Study Group for Staphylococci and Staphylococcal Diseases (ESGS). Clin. Microbiol. Infect. 2019, 25, 1064–1070. [Google Scholar] [CrossRef]
  22. Schutte, A.H.J.; Strepis, N.; Zandijk, W.H.A.; Bexkens, M.L.; Bode, L.G.M.; Klaassen, C.H.W. Characterization of Staphylococcus roterodami sp. Nov., a new species within the Staphylococcus aureus complex isolated from a human foot infection. Int. J. Syst. Evol. Microbiol. 2021, 71, 4996. [Google Scholar] [CrossRef] [PubMed]
  23. Chew, K.L.; Octavia, S.; Lai, D.; Lin, R.T.P.; Teo, J.W.P. Staphylococcus singaporensis sp. nov., a new member of the Staphylococcus aureus complex, isolated from human clinical specimens. Int. J. Syst. Evol. Microbiol. 2021, 71, 005067. [Google Scholar] [CrossRef] [PubMed]
  24. Kosecka-Strojek, M.; Sabat, A.J.; Akkerboom, V.; Becker, K.; van Zanten, E.; Wisselink, G.; Miedzobrodzki, J.; Kooistra-Smid, A.M.D.M.; Friedrich, A.W. Development and validation of a reference data set for assigning Staphylococcus species based on Next-Generation Sequencing of the 16S-23S rRNA region. Front. Cell Infect. Microbiol. 2019, 7, 278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Paulsen, I.T.; Brown, M.H.; Skurray, R.A. Proton-dependent multidrug efflux systems. Microbiol. Rev. 1996, 60, 575–608. [Google Scholar] [CrossRef] [PubMed]
  26. Ginn, S.L.; Brown, M.H.; Skurray, R.A. The TetA(K) tetracycline/H+ antiporter from Staphylococcus aureus: Mutagenesis and functional analysis of motif C. J. Bacteriol. 2000, 182, 1492–1498. [Google Scholar] [CrossRef] [Green Version]
  27. Zhang, X.C.; Zhao, Y.; Heng, J.; Jiang, D. Energy coupling mechanisms of MFS transporters. Protein Sci. 2015, 24, 1560–1579. [Google Scholar] [CrossRef] [Green Version]
  28. Shang, Y.; Lv, P.; Li, S.; Wang, W.; Liu, Y.; Yang, C. Allele-based analysis revealed the critical functions of region 277-297 in the NorA efflux pump of Staphylococcus aureus. J. Antimicrob. Chemother. 2021, 76, 1420–1427. [Google Scholar] [CrossRef]
  29. Brawley, D.N.; Sauer, D.B.; Li, J.; Zheng, X.; Koide, A.; Jedhe, G.S.; Suwatthee, T.; Song, J.; Liu, Z.; Arora, P.S.; et al. Structural basis for inhibition of the drug efflux pump NorA from Staphylococcus aureus. Nat. Chem. Biol. 2022, 18, 706–712. [Google Scholar] [CrossRef]
  30. Ferreira, C.; Costa, S.S.; Serrano, M.; Oliveira, K.; Trigueiro, G.; Pomba, C.; Couto, I. Clonal lineages, antimicrobial resistance, and PVL carriage of Staphylococcus aureus associated to skin and soft-tissue infections from ambulatory patients in Portugal. Antibiotics 2021, 10, 345. [Google Scholar] [CrossRef]
  31. Costa, S.S.; Ribeiro, R.; Serrano, M.; Oliveira, K.; Ferreira, C.; Leal, M.; Pomba, C.; Couto, I. Staphylococcus aureus causing skin and soft tissue infections in companion animals: Antimicrobial resistance profiles and clonal lineages. Antibiotics 2022, 11, 599. [Google Scholar] [CrossRef] [PubMed]
  32. Sierra, J.M.; Ruiz, J.; de Anta, M.T.J.; Vila, J. Prevalence of two different genes encoding NorA in 23 clinical strains of Staphylococcus aureus. J. Antimicrob. Chemother. 2000, 46, 145–146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Schmitz, F.J.; Hertel, B.; Hofmann, B.; Scheuring, S.; Verhoef, J.; Fluit, A.C.; Heinz, H.P.; Köhrer, K.; Jones, M.E. Relationship between mutations in the coding and promoter regions of the norA genes in 42 unrelated clinical isolates of Staphylococcus aureus and the MICs of norfloxacin for these strains. J. Antimicrob. Chemother. 1998, 42, 561–563. [Google Scholar] [CrossRef] [Green Version]
  34. Kosmidis, C.; Schindler, B.D.; Jacinto, P.L.; Patel, D.; Bains, K.; Seo, S.M.; Kaatz, G.W. Expression of multidrug resistance efflux pump genes in clinical and environmental isolates of Staphylococcus aureus. Int. J. Antimicrob. Agents 2012, 40, 204–209. [Google Scholar] [CrossRef]
  35. Brooks, L.E.; Ul-Hasan, S.; Chan, B.K.; and Sistrom, M.J. Quantifying the evolutionary conservation of genes encoding multidrug efflux pumps in the ESKAPE pathogens to identify antimicrobial drug targets. mSystems 2018, 3, e00024-18. [Google Scholar] [CrossRef] [Green Version]
  36. Kaatz, G.W.; Seo, S.M.; Ruble, C.A. Mechanisms of fluoroquinolone resistance in Staphylococcus aureus. J. Infect. Dis. 1991, 163, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
  37. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
  38. Francisco, A.P.; Bugalho, M.; Ramirez, M.; Carriço, J.A. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinform. 2009, 10, 152. [Google Scholar] [CrossRef] [Green Version]
  39. Ribeiro-Gonçalves, B.; Francisco, A.P.; Vaz, C.; Ramirez, M.; Carriço, J.A. PHYLOViZ Online: Web-based tool for visualization, phylogenetic inference, analysis and sharing of minimum spanning trees. Nucl. Acids Res. 2016, 44, W246–W251. [Google Scholar] [CrossRef]
  40. O’Leary, N.A.; Wright, M.W.; Brister, J.R.; Ciufo, S.; Haddad, D.; McVeigh, R.; Rajput, B.; Robbertse, B.; Smith-White, B.; Ako-Adjei, D.; et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. Nucl. Acids Res. 2016, 44, D733–D745. [Google Scholar] [CrossRef]
  41. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  42. Trifinopoulos, J.; Nguyen, L.-T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucl. Acids Res. 2016, 44, W232–W235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
  44. Guindon, S.; Dufayard, S.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview version 2: A Multiple Sequence Alignment and Analysis Workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [Green Version]
  46. Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [Green Version]
  47. Yates, C.M.; Filippis, I.; Kelley, L.A.; Sternberg, M.J. SuSPect: Enhanced prediction of single amino acid variant (SAV) phenotype using network features. J. Mol. Biol. 2014, 426, 2692–2701. [Google Scholar] [CrossRef]
Ijms 23 15306 g003 550
Figure 3. Variability between and within norA alleles (A–E) and between NorA proteins (F) for the S. aureus strains studied in comparison with prototype alleles and their products. Comparisons were made with MEGA 7.0.26 software and are indicated as the identity between sequences (%). A color code highlights the degree of identity between the compared norA/NorA sequences.
Figure 3. Variability between and within norA alleles (A–E) and between NorA proteins (F) for the S. aureus strains studied in comparison with prototype alleles and their products. Comparisons were made with MEGA 7.0.26 software and are indicated as the identity between sequences (%). A color code highlights the degree of identity between the compared norA/NorA sequences.
Ijms 23 15306 g003
Ijms 23 15306 g004 550
Figure 4. Proposed workflow for the rapid screening of S. aureus norA alleles.
Figure 4. Proposed workflow for the rapid screening of S. aureus norA alleles.
Ijms 23 15306 g004
Ijms 23 15306 g005 550
Figure 5. Global distribution of norA alleles amongst the main S. aureus clonal lineages. The maximum spanning tree was constructed using all S. aureus MLST profiles available at PubMLST with the PhyloviZ 2.0 Online software. The clonal lineages differing by up to three loci are linked.
Figure 5. Global distribution of norA alleles amongst the main S. aureus clonal lineages. The maximum spanning tree was constructed using all S. aureus MLST profiles available at PubMLST with the PhyloviZ 2.0 Online software. The clonal lineages differing by up to three loci are linked.
Ijms 23 15306 g005
Table
Table 1. Molecular approach used for differentiation of norA alleles.
Table 1. Molecular approach used for differentiation of norA alleles.
AllelePrimers (5′ → 3′)Amplicon Size (nt)PCR ConditionsRestriction with HindIII (nt)
Forward primers
norAIYonorA (Fw) a:
ATATTCAGTTGTTGTCTTAATAT		23094 °C, 4 min
35 cycles of 94 °C, 30 s; 55 °C, 30 s; 72 °C, 30 s
72 °C, 5 min		No
norAIINorAII (Fw) b:
CTGTATTCTTTATATACATCG		39194 °C, 4 min
35 cycles of 94 °C, 30 s; 57 °C, 30 s; 72 °C, 30 s
72 °C, 5 min		No
norAIIINorAIII (Fw) b:
GACCCCTAAAAAAGTTTCGAC		52694 °C, 3 min
35 cycles of 94 °C, 30 s; 54 °C, 30 s; 72 °C, 30 s
72 °C, 5 min		166 + 360
norACC59–CC121No restriction
Reverse primer
All allelesNorA2 (Rv) a,c:
GCACATCAAATAACGCACCT
a Sierra et al. [32]; b Costa et al. [19]; c all PCRs use NorA2 as the reverse primer.
Table
Table 2. Assignment of norA allele according to the lineage of the 52 S. aureus strains in study.
Table 2. Assignment of norA allele according to the lineage of the 52 S. aureus strains in study.
Clonal Complex (CC)
/Clonal Lineages (ST)		Origin (No. of Strains)Confirmed Allele
norAInorAIInorAIIInorACC59–CC121
Expected allele: norAI a
CC1
ST188Companion animal (n = 1)+---
ST6565Companion animal (n = 1)+---
CC5
ST5Companion animal (n = 3); human (n = 2)+---
ST105Companion animal (n = 2); human (n = 5)+---
ST6531Human (n = 1)+---
ST6535Companion animal (n = 1)+---
CC8
ST8Human (n = 4)+---
ST72Companion animal (n = 2); human (n = 1)+---
ST6566Companion animal (n = 1)+---
CC15
ST15Companion animal (n = 1); human (n = 2)+---
Expected allele: norAII a
CC22
ST22Companion animal (n = 10); human (n = 3)-+--
CC30
ST30Human (n = 1)-+--
CC152
ST152Human (n = 1)-+--
CC398
ST398Companion animal (n = 5)-+--
Expected allele: norAIII or norACC59–CC121 a
CC45
ST278Human (n = 1)--+ b-
CC121
ST121Companion animal (n = 1)+--+ c
No previous association with norA allele
CC7
ST7Companion animal (n =1); human (n = 1)+---
CC25
ST25Human (n = 2)+---
CC97
ST97Companion animal (n =1); human (n = 1)+---
---
ST816Companion animal (n = 1)+--+ c
---
ST6564Human (n = 1)-+--
a According to Costa et al. [19]; b restriction of PCR product with HindIII yielded two fragments of ca. 160 and 360 nt, as expected for norAIII allele; c absence of restriction of PCR product with HindIII, as expected for norACC59–CC121.
Table
Table 3. Prevalence of the different norA alleles and correlation with S. aureus strain lineages.
Table 3. Prevalence of the different norA alleles and correlation with S. aureus strain lineages.
norA AlleleNo.
Strains (%)		HostST (CC) [30,31]
norAI32 (61.6%)Human (n = 18)
Companion animal (n = 14)		ST188, ST6565 (CC1); ST5, ST105, ST6531, ST6535 (CC5); ST7 (CC7); ST8, ST72, ST6566 (CC8); ST15 (CC15); ST25 (CC25); ST97 (CC97)
norAII17 (32.7%)Human (n = 6)
Companion animal (n = 11)		ST22 (CC22); ST30 (CC30); ST152 (CC152); ST398 (CC398); ST6564
norAIII1 (1.9%)Human (n = 1)ST278 (CC45)
norACC59–CC1212 (3.8%)Companion animal (n = 2)ST121 (CC121); ST816
ST: sequence type; CC: clonal complex.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ferreira, C.; Abrantes, P.; Costa, S.S.; Viveiros, M.; Couto, I. Occurrence and Variability of the Efflux Pump Gene norA across the Staphylococcus Genus. Int. J. Mol. Sci. 2022, 23, 15306. https://doi.org/10.3390/ijms232315306

AMA Style

Ferreira C, Abrantes P, Costa SS, Viveiros M, Couto I. Occurrence and Variability of the Efflux Pump Gene norA across the Staphylococcus Genus. International Journal of Molecular Sciences. 2022; 23(23):15306. https://doi.org/10.3390/ijms232315306

Chicago/Turabian Style

Ferreira, Carolina, Patrícia Abrantes, Sofia Santos Costa, Miguel Viveiros, and Isabel Couto. 2022. "Occurrence and Variability of the Efflux Pump Gene norA across the Staphylococcus Genus" International Journal of Molecular Sciences 23, no. 23: 15306. https://doi.org/10.3390/ijms232315306

APA Style

Ferreira, C., Abrantes, P., Costa, S. S., Viveiros, M., & Couto, I. (2022). Occurrence and Variability of the Efflux Pump Gene norA across the Staphylococcus Genus. International Journal of Molecular Sciences, 23(23), 15306. https://doi.org/10.3390/ijms232315306

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop