Targeting Key Signaling Pathways in Glioblastoma Stem Cells for the Development of Efficient Chemo- and Immunotherapy
Abstract
1. Introduction
2. Results
2.1. Establishment of Primary Glioblastoma Stem Cells
2.2. Canonical NF-κB Is Expressed in Glioblastoma Stem Cells and Activated by TNFα
2.3. MYC and NF-κB Expression Is Characteristic for Stemness Potential in Glioblastoma Stem Cells
2.4. Inhibition of Proteasome Reduces GSC Survival
2.5. Natural Killer Cell-Mediated Lysis of Glioblastoma Stem Cells
3. Discussion
4. Materials and Methods
4.1. Isolation and Cultivation of Primary Glioblastoma Stem Cells
4.2. Sphere Formation Assay
4.3. Immunochemistry
4.4. RNA Isolation and Non-Quantitative/Quantitative Reverse-Transcription PCR
4.5. Natural Killer Cell Isolation and Culture
4.6. Flow Cytometry
4.7. Activation of the NF-κB Transcription Factor
4.8. Haploid Copy Number Alteration
4.9. Migration Assay
4.10. Inhibitor Treatments and CompuSyn Analysis
4.11. Statistical Analysis and Figure Design
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Ostrom, Q.T.; Gittleman, H.; Farah, P.; Ondracek, A.; Chen, Y.; Wolinsky, Y.; Stroup, N.E.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS statistical report: Primary brain and central nervous system tumors diagnosed in the United States in 2006–2010. Neuro Oncol. 2013, 15 (Suppl. S2), ii1–ii56. [Google Scholar] [CrossRef] [PubMed]
- Delgado-Martín, B.; Medina, M.Á. Advances in the Knowledge of the Molecular Biology of Glioblastoma and Its Impact in Patient Diagnosis, Stratification, and Treatment. Adv. Sci. 2020, 7, 1902971. [Google Scholar] [CrossRef] [PubMed]
- Davis, M.E. Glioblastoma: Overview of Disease and Treatment. Clin. J. Oncol. Nurs. 2016, 20, S2–S8. [Google Scholar] [CrossRef] [PubMed]
- Ohgaki, H.; Kleihues, P. The definition of primary and secondary glioblastoma. Clin. Cancer Res. 2013, 19, 764–772. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.R.; Yao, Y.; Xu, H.Z.; Qin, Z.Y. Isocitrate Dehydrogenase (IDH)1/2 Mutations as Prognostic Markers in Patients With Glioblastomas. Medicine (Baltimore) 2016, 95, e2583. [Google Scholar] [CrossRef]
- Wee, C.W.; Kim, E.; Kim, N.; Kim, I.A.; Kim, T.M.; Kim, Y.J.; Park, C.K.; Kim, J.W.; Kim, C.Y.; Choi, S.H.; et al. Novel recursive partitioning analysis classification for newly diagnosed glioblastoma: A multi-institutional study highlighting the MGMT promoter methylation and IDH1 gene mutation status. Radiother. Oncol. 2017, 123, 106–111. [Google Scholar] [CrossRef]
- Kitange, G.J.; Carlson, B.L.; Schroeder, M.A.; Grogan, P.T.; Lamont, J.D.; Decker, P.A.; Wu, W.; James, C.D.; Sarkaria, J.N. Induction of MGMT expression is associated with temozolomide resistance in glioblastoma xenografts. Neuro Oncol. 2009, 11, 281–291. [Google Scholar] [CrossRef]
- Wiewrodt, D.; Nagel, G.; Dreimüller, N.; Hundsberger, T.; Perneczky, A.; Kaina, B. MGMT in primary and recurrent human glioblastomas after radiation and chemotherapy and comparison with p53 status and clinical outcome. Int. J. Cancer 2008, 122, 1391–1399. [Google Scholar] [CrossRef]
- Happold, C.; Stojcheva, N.; Silginer, M.; Weiss, T.; Roth, P.; Reifenberger, G.; Weller, M. Transcriptional control of O(6) -methylguanine DNA methyltransferase expression and temozolomide resistance in glioblastoma. J. Neurochem. 2018, 144, 780–790. [Google Scholar] [CrossRef]
- Xia, Y.; Shen, S.; Verma, I.M. NF-κB, an active player in human cancers. Cancer Immunol. Res. 2014, 2, 823–830. [Google Scholar] [CrossRef]
- Taniguchi, K.; Karin, M. NF-κB, inflammation, immunity and cancer: Coming of age. Nat. Rev. Immunol. 2018, 18, 309–324. [Google Scholar] [CrossRef]
- Kaltschmidt, B.; Greiner, J.F.W.; Kadhim, H.M.; Kaltschmidt, C. Subunit-Specific Role of NF-κB in Cancer. Biomedicines 2018, 6, 44. [Google Scholar] [CrossRef]
- Soubannier, V.; Stifani, S. NF-κB Signalling in Glioblastoma. Biomedicines 2017, 5, 29. [Google Scholar] [CrossRef]
- Kaltschmidt, C.; Banz-Jansen, C.; Benhidjeb, T.; Beshay, M.; Förster, C.; Greiner, J.; Hamelmann, E.; Jorch, N.; Mertzlufft, F.; Pfitzenmaier, J.; et al. A Role for NF-κB in Organ Specific Cancer and Cancer Stem Cells. Cancers 2019, 11, 655. [Google Scholar] [CrossRef]
- Eilers, M.; Eisenman, R.N. Myc’s broad reach. Genes Dev. 2008, 22, 2755–2766. [Google Scholar] [CrossRef]
- Zaytseva, O.; Kim, N.-h.; Quinn, L.M. MYC in Brain Development and Cancer. Int. J. Mol. Sci. 2020, 21, 7742. [Google Scholar] [CrossRef]
- Vita, M.; Henriksson, M. The Myc oncoprotein as a therapeutic target for human cancer. Semin. Cancer Biol. 2006, 16, 318–330. [Google Scholar] [CrossRef]
- Herms, J.W.; von Loewenich, F.D.; Behnke, J.; Markakis, E.; Kretzschmar, H.A. c-myc oncogene family expression in glioblastoma and survival. Surg. Neurol. 1999, 51, 536–542. [Google Scholar] [CrossRef]
- Hodgson, J.G.; Yeh, R.F.; Ray, A.; Wang, N.J.; Smirnov, I.; Yu, M.; Hariono, S.; Silber, J.; Feiler, H.S.; Gray, J.W.; et al. Comparative analyses of gene copy number and mRNA expression in glioblastoma multiforme tumors and xenografts. Neuro-Oncology 2009, 11, 477–487. [Google Scholar] [CrossRef]
- Orian, J.M.; Vasilopoulos, K.; Yoshida, S.; Kaye, A.H.; Chow, C.W.; Gonzales, M.F. Overexpression of multiple oncogenes related to histological grade of astrocytic glioma. Br. J. Cancer 1992, 66, 106–112. [Google Scholar] [CrossRef]
- Duyao, M.P.; Buckler, A.J.; Sonenshein, G.E. Interaction of an NF-kappa B-like factor with a site upstream of the c-myc promoter. Proc. Natl. Acad. Sci. USA 1990, 87, 4727–4731. [Google Scholar] [CrossRef] [PubMed]
- Kessler, D.J.; Duyao, M.P.; Spicer, D.B.; Sonenshein, G.E. NF-kappa B-like factors mediate interleukin 1 induction of c-myc gene transcription in fibroblasts. J. Exp. Med. 1992, 176, 787–792. [Google Scholar] [CrossRef] [PubMed]
- La Rosa, F.A.; Pierce, J.W.; Sonenshein, G.E. Differential regulation of the c-myc oncogene promoter by the NF-kappa B rel family of transcription factors. Mol. Cell Biol. 1994, 14, 1039–1044. [Google Scholar] [CrossRef]
- Moser, B.; Hochreiter, B.; Basilio, J.; Gleitsmann, V.; Panhuber, A.; Pardo-Garcia, A.; Hoesel, B.; Salzmann, M.; Resch, U.; Noreen, M.; et al. The inflammatory kinase IKKalpha phosphorylates and stabilizes c-Myc and enhances its activity. Mol. Cancer 2021, 20, 16. [Google Scholar] [CrossRef] [PubMed]
- Grumont, R.; Lock, P.; Mollinari, M.; Shannon, F.M.; Moore, A.; Gerondakis, S. The mitogen-induced increase in T cell size involves PKC and NFAT activation of Rel/NF-kappaB-dependent c-myc expression. Immunity 2004, 21, 19–30. [Google Scholar] [CrossRef]
- Grumont, R.J.; Strasser, A.; Gerondakis, S. B cell growth is controlled by phosphatidylinosotol 3-kinase-dependent induction of Rel/NF-kappaB regulated c-myc transcription. Mol. Cell 2002, 10, 1283–1294. [Google Scholar] [CrossRef]
- Hayes, C. Cellular immunotherapies for cancer. Ir. J. Med. Sci. 2021, 190, 41–57. [Google Scholar] [CrossRef]
- Wu, S.Y.; Fu, T.; Jiang, Y.Z.; Shao, Z.M. Natural killer cells in cancer biology and therapy. Mol. Cancer 2020, 19, 120. [Google Scholar] [CrossRef]
- Jones, A.B.; Rocco, A.; Lamb, L.S.; Friedman, G.K.; Hjelmeland, A.B. Regulation of NKG2D Stress Ligands and Its Relevance in Cancer Progression. Cancers 2022, 14, 2339. [Google Scholar] [CrossRef]
- Chitadze, G.; Kabelitz, D. Immune surveillance in glioblastoma: Role of the NKG2D system and novel cell-based therapeutic approaches. Scand. J. Immunol. 2022, 96, e13201. [Google Scholar] [CrossRef]
- Brandetti, E.; Focaccetti, C.; Pezzolo, A.; Ognibene, M.; Folgiero, V.; Cotugno, N.; Benvenuto, M.; Palma, P.; Manzari, V.; Rossi, P.; et al. Enhancement of Neuroblastoma NK-Cell-Mediated Lysis through NF-kB p65 Subunit-Induced Expression of FAS and PVR, the Loss of Which Is Associated with Poor Patient Outcome. Cancers 2021, 13, 4368. [Google Scholar] [CrossRef]
- Wang, R.W.; Vigano, S.; Ben-David, U.; Amon, A.; Santaguida, S. Aneuploid senescent cells activate NF-kappaB to promote their immune clearance by NK cells. EMBO Rep. 2021, 22, e52032. [Google Scholar] [CrossRef]
- Guegan, J.P.; Pollet, J.; Ginestier, C.; Charafe-Jauffret, E.; Peter, M.E.; Legembre, P. CD95/Fas suppresses NF-kappaB activation through recruitment of KPC2 in a CD95L/FasL-independent mechanism. iScience 2021, 24, 103538. [Google Scholar] [CrossRef]
- Gimple, R.C.; Bhargava, S.; Dixit, D.; Rich, J.N. Glioblastoma stem cells: Lessons from the tumor hierarchy in a lethal cancer. Genes Dev. 2019, 33, 591–609. [Google Scholar] [CrossRef]
- Lathia, J.D.; Mack, S.C.; Mulkearns-Hubert, E.E.; Valentim, C.L.L.; Rich, J.N. Cancer stem cells in glioblastoma. Genes Dev. 2015, 29, 1203–1217. [Google Scholar] [CrossRef]
- Yan, K.; Yang, K.; Rich, J.N. The evolving landscape of glioblastoma stem cells. Curr. Opin. Neurol. 2013, 26, 701–707. [Google Scholar] [CrossRef]
- Prager, B.C.; Bhargava, S.; Mahadev, V.; Hubert, C.G.; Rich, J.N. Glioblastoma Stem Cells: Driving Resilience through Chaos. Trends. Cancer 2020, 6, 223–235. [Google Scholar] [CrossRef]
- Glas, M.; Rath, B.H.; Simon, M.; Reinartz, R.; Schramme, A.; Trageser, D.; Eisenreich, R.; Leinhaas, A.; Keller, M.; Schildhaus, H.-U.; et al. Residual tumor cells are unique cellular targets in glioblastoma. Ann. Neurol. 2010, 68, 264–269. [Google Scholar] [CrossRef]
- Seymour, T.; Nowak, A.; Kakulas, F. Targeting Aggressive Cancer Stem Cells in Glioblastoma. Front. Oncol. 2015, 5, 159. [Google Scholar] [CrossRef]
- Witte, K.E.; Hertel, O.; Windmöller, B.A.; Helweg, L.P.; Höving, A.L.; Knabbe, C.; Busche, T.; Greiner, J.F.W.; Kalinowski, J.; Noll, T.; et al. Nanopore Sequencing Reveals Global Transcriptome Signatures of Mitochondrial and Ribosomal Gene Expressions in Various Human Cancer Stem-like Cell Populations. Cancers 2021, 13, 1136. [Google Scholar] [CrossRef]
- Schulte Am Esch, J.S.A.; Windmöller, B.A.; Hanewinkel, J.; Storm, J.; Förster, C.; Wilkens, L.; Krüger, M.; Kaltschmidt, B.; Kaltschmidt, C. Isolation and Characterization of Two Novel Colorectal Cancer Cell Lines, Containing a Subpopulation with Potential Stem-Like Properties: Treatment Options by MYC/NMYC Inhibition. Cancers 2020, 12, 2582. [Google Scholar] [CrossRef] [PubMed]
- Morata-Tarifa, C.; Jiménez, G.; García, M.A.; Entrena, J.M.; Griñán-Lisón, C.; Aguilera, M.; Picon-Ruiz, M.; Marchal, J.A. Low adherent cancer cell subpopulations are enriched in tumorigenic and metastatic epithelial-to-mesenchymal transition-induced cancer stem-like cells. Sci. Rep. 2016, 6, 18772. [Google Scholar] [CrossRef] [PubMed]
- Walia, V.; Elble, R.C. Enrichment for breast cancer cells with stem/progenitor properties by differential adhesion. Stem. Cells Dev. 2010, 19, 1175–1182. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Sharma, A.; Maciaczyk, J.; Schmidt-Wolf, I.G.H. Recent Development in NKT-Based Immunotherapy of Glioblastoma: From Bench to Bedside. Int. J. Mol. Sci. 2022, 23, 1311. [Google Scholar] [CrossRef] [PubMed]
- Golán, I.; Rodríguez de la Fuente, L.; Costoya, J.A. NK Cell-Based Glioblastoma Immunotherapy. Cancers 2018, 10, 522. [Google Scholar] [CrossRef]
- Schreck, R.; Meier, B.; Mannel, D.N.; Droge, W.; Baeuerle, P.A. Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells. J. Exp. Med. 1992, 175, 1181–1194. [Google Scholar] [CrossRef]
- Witte, K.E.; Pfitzenmaier, J.; Storm, J.; Lütkemeyer, M.; Wimmer, C.; Schulten, W.; Czaniera, N.; Geisler, M.; Förster, C.; Wilkens, L.; et al. Analysis of Several Pathways for Efficient Killing of Prostate Cancer Stem Cells: A Central Role of NF-κB RELA. Int. J. Mol. Sci. 2021, 22, 8901. [Google Scholar] [CrossRef]
- Windmöller, B.A.; Beshay, M.; Helweg, L.P.; Flottmann, C.; Beermann, M.; Förster, C.; Wilkens, L.; Greiner, J.F.W.; Kaltschmidt, C.; Kaltschmidt, B. Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling. Cells 2021, 10, 1024. [Google Scholar] [CrossRef]
- Miraglia, S.; Godfrey, W.; Yin, A.H.; Atkins, K.; Warnke, R.; Holden, J.T.; Bray, R.A.; Waller, E.K.; Buck, D.W. A novel five-transmembrane hematopoietic stem cell antigen: Isolation, characterization, and molecular cloning. Blood 1997, 90, 5013–5021. [Google Scholar] [CrossRef]
- Galli, R.; Binda, E.; Orfanelli, U.; Cipelletti, B.; Gritti, A.; De Vitis, S.; Fiocco, R.; Foroni, C.; Dimeco, F.; Vescovi, A. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res. 2004, 64, 7011–7021. [Google Scholar] [CrossRef]
- Singh, S.K.; Hawkins, C.; Clarke, I.D.; Squire, J.A.; Bayani, J.; Hide, T.; Henkelman, R.M.; Cusimano, M.D.; Dirks, P.B. Identification of human brain tumour initiating cells. Nature 2004, 432, 396–401. [Google Scholar] [CrossRef]
- Brescia, P.; Ortensi, B.; Fornasari, L.; Levi, D.; Broggi, G.; Pelicci, G. CD133 is essential for glioblastoma stem cell maintenance. Stem. Cells 2013, 31, 857–869. [Google Scholar] [CrossRef]
- Li, Y.; Laterra, J. Cancer Stem Cells: Distinct Entities or Dynamically Regulated Phenotypes? Cancer Res. 2012, 72, 576–580. [Google Scholar] [CrossRef]
- Du, Z.; Jia, D.; Liu, S.; Wang, F.; Li, G.; Zhang, Y.; Cao, X.; Ling, E.A.; Hao, A. Oct4 is expressed in human gliomas and promotes colony formation in glioma cells. Glia 2009, 57, 724–733. [Google Scholar] [CrossRef]
- Lopez-Bertoni, H.; Johnson, A.; Rui, Y.; Lal, B.; Sall, S.; Malloy, M.; Coulter, J.B.; Lugo-Fagundo, M.; Shudir, S.; Khela, H.; et al. Sox2 induces glioblastoma cell stemness and tumor propagation by repressing TET2 and deregulating 5hmC and 5mC DNA modifications. Signal. Transduct. Target. Ther. 2022, 7, 37. [Google Scholar] [CrossRef]
- Ostrom, Q.T.; Gittleman, H.; Truitt, G.; Boscia, A.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2011–2015. Neuro Oncol. 2018, 20, iv1–iv86. [Google Scholar] [CrossRef]
- Alves, A.L.V.; Gomes, I.N.F.; Carloni, A.C.; Rosa, M.N.; da Silva, L.S.; Evangelista, A.F.; Reis, R.M.; Silva, V.A.O. Role of glioblastoma stem cells in cancer therapeutic resistance: A perspective on antineoplastic agents from natural sources and chemical derivatives. Stem. Cell Res. Ther. 2021, 12, 206. [Google Scholar] [CrossRef]
- Hanif, F.; Muzaffar, K.; Perveen, K.; Malhi, S.M.; Simjee Sh, U. Glioblastoma Multiforme: A Review of its Epidemiology and Pathogenesis through Clinical Presentation and Treatment. Asian. Pac. J. Cancer Prev. 2017, 18, 3–9. [Google Scholar] [CrossRef]
- Schafer, A.; Teufel, J.; Ringel, F.; Bettstetter, M.; Hoepner, I.; Rasper, M.; Gempt, J.; Koeritzer, J.; Schmidt-Graf, F.; Meyer, B.; et al. Aldehyde dehydrogenase 1A1--a new mediator of resistance to temozolomide in glioblastoma. Neuro Oncol. 2012, 14, 1452–1464. [Google Scholar] [CrossRef]
- Kaltschmidt, B.; Witte, K.E.; Greiner, J.F.W.; Weissinger, F.; Kaltschmidt, C. Targeting NF-kappaB Signaling in Cancer Stem Cells: A Narrative Review. Biomedicines 2022, 10, 261. [Google Scholar] [CrossRef]
- Bredel, M.; Scholtens, D.M.; Yadav, A.K.; Alvarez, A.A.; Renfrow, J.J.; Chandler, J.P.; Yu, I.L.; Carro, M.S.; Dai, F.; Tagge, M.J.; et al. NFKBIA deletion in glioblastomas. N. Engl. J. Med. 2011, 364, 627–637. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wang, H.; Li, Z.; Wu, Q.; Lathia, J.D.; McLendon, R.E.; Hjelmeland, A.B.; Rich, J.N. c-Myc is required for maintenance of glioma cancer stem cells. PLoS ONE 2008, 3, e3769. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Ying, H.; Yan, H.; Kimmelman, A.C.; Hiller, D.J.; Chen, A.J.; Perry, S.R.; Tonon, G.; Chu, G.C.; Ding, Z.; et al. Pten and p53 converge on c-Myc to control differentiation, self-renewal, and transformation of normal and neoplastic stem cells in glioblastoma. Cold Spring Harb. Symp. Quant. Biol. 2008, 73, 427–437. [Google Scholar] [CrossRef] [PubMed]
- Tateishi, K.; Iafrate, A.J.; Ho, Q.; Curry, W.T.; Batchelor, T.T.; Flaherty, K.T.; Onozato, M.L.; Lelic, N.; Sundaram, S.; Cahill, D.P.; et al. Myc-Driven Glycolysis Is a Therapeutic Target in Glioblastoma. Clin. Cancer Res. 2016, 22, 4452–4465. [Google Scholar] [CrossRef] [PubMed]
- Hoek, K.S.; Schlegel, N.C.; Brafford, P.; Sucker, A.; Ugurel, S.; Kumar, R.; Weber, B.L.; Nathanson, K.L.; Phillips, D.J.; Herlyn, M.; et al. Metastatic potential of melanomas defined by specific gene expression profiles with no BRAF signature. Pigment. Cell Res. 2006, 19, 290–302. [Google Scholar] [CrossRef]
- Hoek, K.S.; Eichhoff, O.M.; Schlegel, N.C.; Döbbeling, U.; Kobert, N.; Schaerer, L.; Hemmi, S.; Dummer, R. In vivo switching of human melanoma cells between proliferative and invasive states. Cancer Res. 2008, 68, 650–656. [Google Scholar] [CrossRef]
- Hatzikirou, H.; Basanta, D.; Simon, M.; Schaller, K.; Deutsch, A. ‘Go or grow’: The key to the emergence of invasion in tumour progression? Math. Med. Biol. 2012, 29, 49–65. [Google Scholar] [CrossRef]
- Bhat, K.P.L.; Balasubramaniyan, V.; Vaillant, B.; Ezhilarasan, R.; Hummelink, K.; Hollingsworth, F.; Wani, K.; Heathcock, L.; James, J.D.; Goodman, L.D.; et al. Mesenchymal differentiation mediated by NF-kappaB promotes radiation resistance in glioblastoma. Cancer Cell 2013, 24, 331–346. [Google Scholar] [CrossRef]
- Rinkenbaugh, A.L.; Cogswell, P.C.; Calamini, B.; Dunn, D.E.; Persson, A.I.; Weiss, W.A.; Lo, D.C.; Baldwin, A.S. IKK/NF-kappaB signaling contributes to glioblastoma stem cell maintenance. Oncotarget 2016, 7, 69173–69187. [Google Scholar] [CrossRef]
- Avci, N.G.; Ebrahimzadeh-Pustchi, S.; Akay, Y.M.; Esquenazi, Y.; Tandon, N.; Zhu, J.-J.; Akay, M. NF-κB inhibitor with Temozolomide results in significant apoptosis in glioblastoma via the NF-κB(p65) and actin cytoskeleton regulatory pathways. Sci. Rep. 2020, 10, 13352. [Google Scholar] [CrossRef]
- Bellas, R.E.; FitzGerald, M.J.; Fausto, N.; Sonenshein, G.E. Inhibition of NF-kappa B activity induces apoptosis in murine hepatocytes. Am. J. Pathol. 1997, 151, 891–896. [Google Scholar]
- Yamaki, T.; Suenaga, Y.; Iuchi, T.; Alagu, J.; Takatori, A.; Itami, M.; Araki, A.; Ohira, M.; Inoue, M.; Kageyama, H.; et al. Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma. Sci. Rep. 2013, 3, 1160. [Google Scholar] [CrossRef]
- Available online: www.cancerresearchuk.org (accessed on 10 June 2022).
- Pang, H.; Chen, D.; Cui, Q.C.; Dou, Q.P. Sodium diethyldithiocarbamate, an AIDS progression inhibitor and a copper-binding compound, has proteasome-inhibitory and apoptosis-inducing activities in cancer cells. Int. J. Mol. Med. 2007, 19, 809–816. [Google Scholar] [CrossRef]
- Bota, D.A.; Alexandru, D.; Keir, S.T.; Bigner, D.; Vredenburgh, J.; Friedman, H.S. Proteasome inhibition with bortezomib induces cell death in GBM stem-like cells and temozolomide-resistant glioma cell lines, but stimulates GBM stem-like cells’ VEGF production and angiogenesis. J. Neurosurg. 2013, 119, 1415–1423. [Google Scholar] [CrossRef]
- Tang, J.H.; Yang, L.; Chen, J.X.; Li, Q.R.; Zhu, L.R.; Xu, Q.F.; Huang, G.H.; Zhang, Z.X.; Xiang, Y.; Du, L.; et al. Bortezomib inhibits growth and sensitizes glioma to temozolomide (TMZ) via down-regulating the FOXM1-Survivin axis. Cancer Commun. (Lond.) 2019, 39, 81. [Google Scholar] [CrossRef]
- Curran, M.P.; McKeage, K. Bortezomib: A review of its use in patients with multiple myeloma. Drugs 2009, 69, 859–888. [Google Scholar] [CrossRef]
- Ishikawa, E.; Tsuboi, K.; Saijo, K.; Harada, H.; Takano, S.; Nose, T.; Ohno, T. Autologous natural killer cell therapy for human recurrent malignant glioma. Anticancer Res. 2004, 24, 1861–1871. [Google Scholar]
- Castriconi, R.; Daga, A.; Dondero, A.; Zona, G.; Poliani, P.L.; Melotti, A.; Griffero, F.; Marubbi, D.; Spaziante, R.; Bellora, F.; et al. NK cells recognize and kill human glioblastoma cells with stem cell-like properties. J. Immunol. 2009, 182, 3530–3539. [Google Scholar] [CrossRef]
- Avril, T.; Vauleon, E.; Hamlat, A.; Saikali, S.; Etcheverry, A.; Delmas, C.; Diabira, S.; Mosser, J.; Quillien, V. Human glioblastoma stem-like cells are more sensitive to allogeneic NK and T cell-mediated killing compared with serum-cultured glioblastoma cells. Brain Pathol. 2012, 22, 159–174. [Google Scholar] [CrossRef]
- Haspels, H.N.; Rahman, M.A.; Joseph, J.V.; Gras Navarro, A.; Chekenya, M. Glioblastoma Stem-Like Cells Are More Susceptible Than Differentiated Cells to Natural Killer Cell Lysis Mediated Through Killer Immunoglobulin-Like Receptors-Human Leukocyte Antigen Ligand Mismatch and Activation Receptor-Ligand Interactions. Front. Immunol. 2018, 9, 1345. [Google Scholar] [CrossRef]
- Friebel, E.; Kapolou, K.; Unger, S.; Nunez, N.G.; Utz, S.; Rushing, E.J.; Regli, L.; Weller, M.; Greter, M.; Tugues, S.; et al. Single-Cell Mapping of Human Brain Cancer Reveals Tumor-Specific Instruction of Tissue-Invading Leukocytes. Cell 2020, 181, 1626–1642.e20. [Google Scholar] [CrossRef] [PubMed]
- Romee, R.; Foley, B.; Lenvik, T.; Wang, Y.; Zhang, B.; Ankarlo, D.; Luo, X.; Cooley, S.; Verneris, M.; Walcheck, B.; et al. NK cell CD16 surface expression and function is regulated by a disintegrin and metalloprotease-17 (ADAM17). Blood 2013, 121, 3599–3608. [Google Scholar] [CrossRef] [PubMed]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef]
- De Preter, K.; Speleman, F.; Combaret, V.; Lunec, J.; Laureys, G.; Eussen, B.H.; Francotte, N.; Board, J.; Pearson, A.D.; De Paepe, A.; et al. Quantification of MYCN, DDX1, and NAG gene copy number in neuroblastoma using a real-time quantitative PCR assay. Mod. Pathol. 2002, 15, 159–166. [Google Scholar] [CrossRef]
- Witte, K.E.; Slotta, C.; Lütkemeyer, M.; Kitke, A.; Coras, R.; Simon, M.; Kaltschmidt, C.; Kaltschmidt, B. PLEKHG5 regulates autophagy, survival and MGMT expression in U251-MG glioblastoma cells. Sci. Rep. 2020, 10, 21858. [Google Scholar] [CrossRef]
- Chou, T.C. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 2010, 70, 440–446. [Google Scholar] [CrossRef]
Donor ID | Tumor Typing and Characterization | WHO Grade | Sex | Age |
---|---|---|---|---|
GII | Primary glioblastoma multiforme, IDH1 wildtype with MGMT promoter methylation | IV | Female | 86 |
GIV | Secondary glioblastoma multiforme, IDH1 mutation with MGMT promoter methylation | IV | Male | 60 |
GV | Primary glioblastoma multiforme, IDH1 wildtype without MGMT promoter methylation | IV | Male | 42 |
Target Gene | Sequence (5′-3′) |
---|---|
B-ACTIN | GAGAAGATGACCCAGATCATGT |
CATCTCTTGCTCGAAGTCCAG | |
KLF4 | CAGCTTCACCTATCCGATCC |
TGTACACCGGGTCCAATTCT | |
MYC | GGCACTTTGCACTGGAACTT |
AGGCTGCTGGTTTTCCACTA | |
MYCN | ACAGTCATCTGTCTGGACGC |
TCCTCGGATGGCTACAGTCT | |
OCT4 | CGAAAGAGAAAGCGAACCAG |
GCCGGTTACAGAACCACACT | |
SOX2 | GGAGCTTTGCAGGAAGTTTG |
GCAAGAAGCCTCTCCTTGAA |
Target Gene | Sequence (5′-3′) |
---|---|
B-ACTIN | CTTCGCGGGCGACGAT |
CCACATAGGAATCCTTCTGACC | |
GAPDH | CATGAGAAGTATGACAACAGCCT |
AGTCCTTCCACGATACCAAAGT | |
SOX2 | GGAGCTTTGCAGGAAGTTTG |
GCAAGAAGCCTCTCCTTGAA | |
KLF4 | CAGCTTCACCTATCCGATCC |
TGTACACCGGGTCCAATTCT | |
OCT4 | CGAAAGAGAAAGCGAACCAG |
GCCGGTTACAGAACCACACT | |
MYC | GGCACTTTGCACTGGAACTT |
AGGCTGCTGGTTTTCCACTA | |
MYCN | ACAGTCATCTGTCTGGACGC |
TCCTCGGATGGCTACAGTCT | |
MAX | AGGCTGCTGGTTTTCCACTA |
TGAGTCCCGCAAACTGTGAA | |
MYCL | ACCAGCTGTCTTGGGTGAAG |
TTAAGTGTTCCCAGGGTCGC | |
CD133 | AACAGTTTGCCCCCAGGAAA |
GAAGGACTCGTTGCTGGTGA | |
CD44 | CTACAAGCACAATCCAGGCA |
GCATTGGATGGCTGGTATGA | |
NESTIN | CGCACCTCAAGATGTCCCTC |
CAGCTTGGGTCCTGAAAGC |
Target Gene | Sequence (5′-3′) |
---|---|
GAPDH | AGACTGGCTCTTAAAAAGTGCAGG |
TGCTGTAGCCAAATTCGTTGTC | |
MYC | AAAAGTGGGCGGCTGGATAC |
AGGGATGGGAGGAAACGCTA | |
MYCN | CGCAAAAGCCACCTCTCATTA |
TCCAGCAGATGCCACATAAGG | |
SYNDECAN4 | CAGGGTCTGGGAGCCAAGT |
GCACAGTGCTGGACATTGACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Helweg, L.P.; Storm, J.; Witte, K.E.; Schulten, W.; Wrachtrup, L.; Janotte, T.; Kitke, A.; Greiner, J.F.W.; Knabbe, C.; Kaltschmidt, B.; et al. Targeting Key Signaling Pathways in Glioblastoma Stem Cells for the Development of Efficient Chemo- and Immunotherapy. Int. J. Mol. Sci. 2022, 23, 12919. https://doi.org/10.3390/ijms232112919
Helweg LP, Storm J, Witte KE, Schulten W, Wrachtrup L, Janotte T, Kitke A, Greiner JFW, Knabbe C, Kaltschmidt B, et al. Targeting Key Signaling Pathways in Glioblastoma Stem Cells for the Development of Efficient Chemo- and Immunotherapy. International Journal of Molecular Sciences. 2022; 23(21):12919. https://doi.org/10.3390/ijms232112919
Chicago/Turabian StyleHelweg, Laureen P., Jonathan Storm, Kaya E. Witte, Wiebke Schulten, Lennart Wrachtrup, Till Janotte, Angelika Kitke, Johannes F. W. Greiner, Cornelius Knabbe, Barbara Kaltschmidt, and et al. 2022. "Targeting Key Signaling Pathways in Glioblastoma Stem Cells for the Development of Efficient Chemo- and Immunotherapy" International Journal of Molecular Sciences 23, no. 21: 12919. https://doi.org/10.3390/ijms232112919
APA StyleHelweg, L. P., Storm, J., Witte, K. E., Schulten, W., Wrachtrup, L., Janotte, T., Kitke, A., Greiner, J. F. W., Knabbe, C., Kaltschmidt, B., Simon, M., & Kaltschmidt, C. (2022). Targeting Key Signaling Pathways in Glioblastoma Stem Cells for the Development of Efficient Chemo- and Immunotherapy. International Journal of Molecular Sciences, 23(21), 12919. https://doi.org/10.3390/ijms232112919