Discovery of microRNA-like Small RNAs in Pathogenic Plant Fungus Verticillium nonalfalfae Using High-Throughput Sequencing and qPCR and RLM-RACE Validation
Abstract
:1. Introduction
2. Results
2.1. Overview of Verticillium nonalfalfae sRNAs and NGS Sequencing
2.2. Identification of Potential milRNAs
2.3. Stem-Loop RT-qPCR Validation and Expression Analysis of Verticillium nonalfalfae milRNAs
2.4. Target Prediction and GO Clustering Analysis
2.5. 5′ RLM-RACE Validation of the Predicted Target Gene Models
3. Discussion
4. Materials and Methods
4.1. Verticillium nonalfalfae Culture Preparation
4.2. Small RNA Extraction and Ion Torrent NGS Sequencing
4.3. Sequence Analysis and milRNA Prediction
4.4. MilRNA Validation and Expression Analysis
4.5. MilRNA Target Prediction and GO Analysis
4.6. Target Validation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Inderbitzin, P.; Subbarao, K.V. Verticillium systematics and evolution: How confusion impedes Verticillium wilt management and how to resolve it. Phytopathology 2014, 104, 564–574. [Google Scholar] [CrossRef] [Green Version]
- Kasson, M.T.; O’Neal, E.S.; Davis, D.D. Expanded Host Range Testing for Verticillium nonalfalfae: Potential Biocontrol Agent Against the Invasive Ailanthus altissima. Plant Dis. 2014, 99, 823–835. [Google Scholar] [CrossRef] [Green Version]
- Fradin, E.F.; Thomma, B.P. Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol. Plant Pathol. 2006, 7, 71–86. [Google Scholar] [CrossRef]
- Neve, R.A. Hops; Chapman and Hall: London, UK; Springer: Dordrecht, The Netherlands, 1991. [Google Scholar]
- Gent, D.H.; Woods, J.L.; Putnam, M.L. New Outbreaks of Verticillium Wilt on Hop in Oregon Caused by Nonlethal Verticillium albo-atrum. Plant Health Prog. 2012, 13, 14. [Google Scholar] [CrossRef] [Green Version]
- Sewell, G.W.F.; Wilson, J.F. The nature and distribution of Verticillium albo-atrum strains highly pathogenic to the hop. Plant Pathol. 1984, 33, 39–51. [Google Scholar] [CrossRef]
- Radišek, S.; Jakše, J.; Javornik, B. Genetic variability and virulence among Verticillium albo-atrum isolates from hop. Eur. J. Plant Pathol. 2006, 116, 301–314. [Google Scholar] [CrossRef]
- Sewell, G.W.F.; Wilson, J.F. Verticillium wilt of the hop: The survival of V. albo-atrum in soil. Ann. Appl. Biol. 1966, 58, 241–249. [Google Scholar] [CrossRef]
- Mahaffee, W.F.; Pethybridge, S.J.; Gent, D.H. American Phytopathological, S. In Compendium of Hop Diseases and Pests; APS Press: St. Paul, MN, USA, 2009. [Google Scholar]
- Jakše, J.; Jelen, V.; Radišek, S.; de Jonge, R.; Mandelc, S.; Majer, A.; Curk, T.; Zupan, B.; Thomma, B.P.H.J.; Javornik, B. Genome Sequence of a Lethal Strain of Xylem-Invading Verticillium nonalfalfae. Genome Announc. 2018, 6, e01458-17. [Google Scholar] [CrossRef] [Green Version]
- Jeseničnik, T.; Štajner, N.; Radišek, S.; Jakše, J. RNA interference core components identified and characterised in Verticillium nonalfalfae, a vascular wilt pathogenic plant fungi of hops. Sci. Rep. 2019, 9, 8651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agrawal, N.; Dasaradhi, P.V.N.; Mohmmed, A.; Malhotra, P.; Bhatnagar, R.K.; Mukherjee, S.K. RNA Interference: Biology, Mechanism, and Applications. Microbiol. Mol. Biol. Rev. 2003, 67, 657–685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Green Version]
- Carthew, R.W.; Sontheimer, E.J. Origins and Mechanisms of miRNAs and siRNAs. Cell 2009, 136, 642–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hammond, S.M. An overview of microRNAs. Adv. Drug Deliv. Rev. 2015, 87, 3–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nicolas, F.E.; Garre, V. RNA Interference in Fungi: Retention and Loss. Microbiol. Spectr. 2016, 4, 4–6. [Google Scholar] [CrossRef] [PubMed]
- Torres-Martínez, S.; Ruiz-Vázquez, R.M. The RNAi Universe in Fungi: A Varied Landscape of Small RNAs and Biological Functions. Annu. Rev. Microbiol. 2017, 71, 371–391. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Fu, Y.; Xie, J.; Li, B.; Jiang, D.; Li, G.; Cheng, J. Identification of microRNA-like RNAs in a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing. Mol. Genet. Genom. 2012, 287, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Jiang, N.; Jiang, Q.; Sun, X.; Wang, Y.; Zhang, H.; Hu, Z. Exploring MicroRNA-Like Small RNAs in the Filamentous Fungus Fusarium oxysporum. PLoS ONE 2014, 9, e104956. [Google Scholar]
- Chen, Y.; Gao, Q.; huamg, M.; Liu, Y.; Liu, Z.; Liu, X.; Ma, Z. Characterization of RNA silencing components in the plant pathogenic fungus Fusarium graminearum. Sci. Rep. 2015, 5, 12500. [Google Scholar] [CrossRef] [Green Version]
- Mueth, N.A.; Ramachandran, S.R.; Hulbert, S.H. Small RNAs from the wheat stripe rust fungus (Puccinia striiformis f.sp. tritici). BMC Genom. 2015, 16, 718. [Google Scholar] [CrossRef] [Green Version]
- Dubey, H.; Kiran, K.; Jaswal, R.; Jain, P.; Kayastha, A.M.; Bhardwaj, S.; Mondal, T.K.; Sharma, T.R. Discovery and profiling of small RNAs from Puccinia triticina by deep sequencing and identification of their potential targets in wheat. Funct. Integr. Genom. 2019, 19, 391–407. [Google Scholar] [CrossRef] [PubMed]
- Inderbitzin, P.; Bostock, R.M.; Davis, M.; Usami, T.; Platt, H.W.; Subbarao, K.V. Phylogenetics and Taxonomy of the Fungal Vascular Wilt Pathogen Verticillium, with the Descriptions of Five New Species. PLoS ONE 2011, 6, e28341. [Google Scholar] [CrossRef]
- Jin, Y.; Zhao, J.H.; Zhao, P.; Zhang, T.; Wang, S.; Guo, H.S. A fungal milRNA mediates epigenetic repression of a virulence gene in Verticillium dahliae. Philos. Trans. R. Soc. B 2019, 374, 20180309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nunes, C.C.; Dean, R.A. Host-induced gene silencing: A tool for understanding fungal host interaction and for developing novel disease control strategies. Mol. Plant Pathol. 2012, 13, 519–529. [Google Scholar] [CrossRef]
- Weiberg, A.; Wang, M.; Bellinger, M.; Jin, H. Small RNAs: A new paradigm in plant-microbe interactions. Annu. Rev. Phytopathol. 2014, 52, 495–516. [Google Scholar] [CrossRef]
- Wang, M.; Weiberg, A.; Lin, F.M.; Thomma, B.P.H.J.; Huang, H.D.; Jin, H. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection. Nat. Plants 2016, 2, 16151. [Google Scholar] [CrossRef] [PubMed]
- Hua, C.; Zhao, J.H.; Guo, H.S. Trans-Kingdom RNA Silencing in Plant-Fungal Pathogen Interactions. Mol. Plant 2018, 11, 235–244. [Google Scholar] [CrossRef] [Green Version]
- Villalobos-Escobedo, J.M.; Herrera-Estrella, A.; Carreras-Villasenor, N. The interaction of fungi with the environment orchestrated by RNAi. Mycologia 2016, 108, 556–571. [Google Scholar] [CrossRef] [PubMed]
- Knip, M.; Constantin, M.E.; Thordal-Christensen, H. Trans-kingdom cross-talk: Small RNAs on the move. PLoS Genet. 2014, 10, e1004602. [Google Scholar] [CrossRef]
- Weiberg, A.; Bellinger, M.; Jin, H. Conversations between kingdoms: Small RNAs. Curr. Opin. Biotechnol. 2015, 32, 207–215. [Google Scholar] [CrossRef] [Green Version]
- Weiberg, A.; Wang, M.; Lin, F.M.; Zhao, H.; Zhang, Z.; Kaloshian, I.; Huang, H.D.; Jin, H. Fungal Small RNAs Suppress Plant Immunity by Hijacking Host RNA Interference Pathways. Science 2013, 342, 118–123. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Weiberg, A.; Dellota, E.; Yamane, D.; Jin, H. Botrytis small RNA Bc-siR37 suppresses plant defense genes by cross-kingdom RNAi. RNA Biol. 2017, 14, 421–428. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, M.; Jin, H. Spray-Induced Gene Silencing: A Powerful Innovative Strategy for Crop Protection. Trends Microbiol. 2017, 25, 4–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mathelier, A.; Carbone, A. MIReNA: Finding microRNAs with high accuracy and no learning at genome scale and from deep sequencing data. Bioinformatics 2010, 26, 2226–2234. [Google Scholar] [CrossRef] [Green Version]
- Mishra, A.K.; Duraisamy, G.S.; Tycova, A.; Matousek, J. Computational exploration of microRNAs from expressed sequence tags of Humulus lupulus, target predictions and expression analysis. Comput. Biol. Chem. 2015, 59 Pt A, 131–141. [Google Scholar] [CrossRef]
- Kramer, M.F. STEM-LOOP RT-qPCR for miRNAS. In Current Protocols in Molecular Biology; Ausbel, F.M., Ed.; Wiley: Hoboken, NJ, USA, 2015; Volume 95, pp. 15.10.1–15.10.15. [Google Scholar]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dang, Y.; Yang, Q.; Xue, Z.; Liu, Y. RNA Interference in Fungi: Pathways, Functions, and Applications. Eukaryot. Cell 2011, 10, 1148–1155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, J.; Kim, K.T.; Jeon, J.; Wu, J.; Song, H.; Aseiegbu, F.; Lee, Y.H. funRNA: A fungi-centered genomics platform for genes encoding key components of RNAi. BMC Genom. 2014, 15 (Suppl. 9), S14. [Google Scholar] [CrossRef] [Green Version]
- Nicolas, F.E.; de Haro, J.P.; Torres-Martinez, S.; Ruiz-Vazquez, R.M. Mutants defective in a Mucor circinelloides dicer-like gene are not compromised in siRNA silencing but display developmental defects. Fungal Genet. Biol. 2007, 44, 504–516. [Google Scholar] [CrossRef]
- Nicolas, F.E.; Moxon, S.; de Haro, J.P.; Calo, S.; Grigoriev, I.V.; Torres-Martinez, S.; Moulton, V.; Ruiz-Vazquez, R.M.; Dalmay, T. Endogenous short RNAs generated by Dicer 2 and RNA-dependent RNA polymerase 1 regulate mRNAs in the basal fungus Mucor circinelloides. Nucleic Acids Res. 2010, 38, 5535–5541. [Google Scholar] [CrossRef]
- Cervantes, M.; vila, A.; Nicolas, F.E.; Moxon, S.; de HAro, J.P.; Dalmay, T.; Torres-Martinez, S.; Ruiz-Vazqez, R.M. A single argonaute gene participates in exogenous and endogenous RNAi and controls cellular functions in the basal fungus Mucor circinelloides. PLoS ONE 2013, 8, e69283. [Google Scholar] [CrossRef] [Green Version]
- Raman, V.; Simon, S.A.; Demirci, S.; Nakano, M.; Meyers, B.C.; Donofrio, N.M. Small RNA Functions Are Required for Growth and Development of Magnaporthe oryzae. Mol. Plant Microbe Interact. 2017, 30, 517–530. [Google Scholar] [CrossRef] [Green Version]
- Liu, T.; Hu, J.; Zuo, Y.; Jin, Y.; Hou, J. Identification of microRNA-like RNAs from Curvularia lunata associated with maize leaf spot by bioinformation analysis and deep sequencing. Mol. Genet. Genom. 2016, 291, 587–596. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; Yang, Y.; Janbon, G.; Pan, J.; Zhu, X. Identification and functional demonstration of miRNAs in the fungus Cryptococcus neoformans. PLoS ONE 2012, 7, e52734. [Google Scholar] [CrossRef] [Green Version]
- Lau, S.K.; Chow, W.N.; Wong, A.Y.P.; Yeung, J.M.Y.; Bao, J.; Zhang, N.; Lok, S.; Woo, P.C.Y.; Yeun, K.Y. Identification of microRNA-like RNAs in mycelial and yeast phases of the thermal dimorphic fungus Penicillium marneffei. PLoS Negl. Trop. Dis. 2013, 7, e2398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, K.; Zhong, J.; Jiang, L.; Liu, G.; Gou, C.Y.; Wu, Q.; Wang, Y.; Luo, J.; Gou, D. Identification of microRNA-Like RNAs in the Filamentous Fungus Trichoderma reesei by Solexa Sequencing. PLoS ONE 2013, 8, e76288. [Google Scholar]
- Zhang, W.; Li, X.; Ma, L.; Urrehman, U.; Bao, X.; Zhang, Y.; Zhang, C.Y.; Hou, D.; Zhou, Z. Identification of microRNA-like RNAs in Ophiocordyceps sinensis. Sci. China Life Sci. 2019, 62, 349–356. [Google Scholar] [CrossRef] [PubMed]
- Shao, Y.; Tang, J.; Chen, S.; Wu, Y.; Wang, K.; Ma, B.; Zhiu, Q.; Chen, A.; Wang, Y. milR4 and milR16 Mediated Fruiting Body Development in the Medicinal Fungus Cordyceps militaris. Front. Microbiol. 2019, 10, 83. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.C.; Li, L.; Gu, W.; Xue, Z.; Crosthwaite, S.K.; Pertsemlidis, A.; Lewis, Z.A.; Freitag, M.; Sleker, E.U.; Mello, C.C.; et al. Diverse pathways generate microRNA-like RNAs and Dicer-independent small interfering RNAs in fungi. Mol. Cell 2010, 38, 803–814. [Google Scholar] [CrossRef] [Green Version]
- Zhou, X.; Khare, T.; Kumar, V. Recent trends and advances in identification and functional characterization of plant miRNAs. Acta Physiol. Plant 2020, 42, 25. [Google Scholar] [CrossRef]
- Nerva, L.; Sandrini, M.; Gambino, G.; Chitarra, W. Double-Stranded RNAs (dsRNAs) as a Sustainable Tool against Gray Mold (Botrytis cinerea) in Grapevine: Effectiveness of Different Application Methods in an Open-Air Environment. Biomolecules 2020, 10, 200. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Ridzon, D.A.; Broomer, A.J.; Zhou, Z.; Lee, D.H.; Nguyen, J.T.; Barbisin, M.; Xu, N.L.; mahuvakar, V.R.; Andersen, M.R.; et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005, 33, e179. [Google Scholar] [CrossRef]
- Rodriguez, A.; Griffiths-Jones, S.; Ashurst, J.L.; Bradley, A. Identification of mammalian microRNA host genes and transcription units. Genome Res. 2004, 14, 1902–1910. [Google Scholar] [CrossRef] [Green Version]
- Olena, A.F.; Patton, J.G. Genomic organization of microRNAs. J. Cell. Physiol. 2010, 222, 540–545. [Google Scholar] [CrossRef] [Green Version]
- Lau, A.Y.T.; Cheng, X.; Cheng, C.K.; Nong, W.; Cheung, M.K.; Chan, R.H.F.; Hui, J.H.L.; Kwan, H.S. Discovery of microRNA-like RNAs during early fruiting body development in the model mushroom Coprinopsis cinerea. PLoS ONE 2018, 13, e0198234. [Google Scholar] [CrossRef] [Green Version]
- de Curcio, J.S.; Paccez, J.D.; Novaes, E.; Brock, M.; Soares, C.M.d.A. Cell Wall Synthesis, Development of Hyphae and Metabolic Pathways Are Processes Potentially Regulated by MicroRNAs Produced Between the Morphological Stages of Paracoccidioides brasiliensis. Front. Microbiol. 2018, 9, 3057. [Google Scholar] [CrossRef] [PubMed]
- Thomson, D.W.; Bracken, C.P.; Goodall, G.J. Experimental strategies for microRNA target identification. Nucleic Acids Res. 2011, 39, 6845–6853. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pennypacker, B.W. Verticillium Wilts. In The Quarterly Review of Biology; Pegg, G.F., Brady, B.L., Eds.; CABI Publishing: Wallingford, UK, 2004; Volume 79, p. 80. [Google Scholar]
- Wang, L.; Xu, X.; Yang, J.; Chen, L.; Liu, B.; Liu, T.; Jin, Q. Integrated microRNA and mRNA analysis in the pathogenic filamentous fungus Trichophyton rubrum. BMC Genom. 2018, 19, 933. [Google Scholar] [CrossRef]
- Zhou, Q.; Wang, Z.; Zhang, J.; Meng, H.; Huang, B. Genome-wide identification and profiling of microRNA-like RNAs from Metarhizium anisopliae during development. Fungal Biol. 2012, 116, 1156–1162. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Qiao, F.; Long, Y.; Cong, H.; Sun, H. MicroRNA-like RNAs in plant pathogenic fungus Fusarium oxysporum f.sp. niveum are involved in toxin gene expression fine tuning. 3 Biotech 2017, 7, 354. [Google Scholar] [CrossRef]
- Wang, M.; Dean, R.A. Movement of small RNAs in and between plants and fungi. Mol. Plant Pathol. 2020, 21, 589–601. [Google Scholar] [CrossRef]
- Silvestri, A.; Fiorilli, V.; Miozzi, L.; Accotto, G.P.; Turina, M.; Lanfranco, L. In silico analysis of fungal small RNA accumulation reveals putative plant mRNA targets in the symbiosis between an arbuscular mycorrhizal fungus and its host plant. BMC Genom. 2019, 20, 169. [Google Scholar] [CrossRef]
- Peres da Silva, R.; Puccia, R.; Rodrigues, M.L.; Oliveira, D.L.; Jpffe, L.S.; Cesar, G.V.; Nimrichter, L.; Goldenberg, S.; Alves, L.R. Extracellular vesicle-mediated export of fungal RNA. Sci. Rep. 2015, 5, 7763. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, Q.; He, B.; Weiberg, A.; Buck, A.H.; Jin, H. Small RNAs and extracellular vesicles: New mechanisms of cross-species communication and innovative tools for disease control. PLoS Pathog. 2020, 15, e1008090. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neumann, M.J.; Dobinson, K.F. Sequence tag analysis of gene expression during pathogenic growth and microsclerotia development in the vascular wilt pathogen Verticillium dahliae. Fungal Genet. Biol. 2003, 38, 54–62. [Google Scholar] [CrossRef]
- European and Mediterranean Plant Protection Organization Organisation Européenne et Méditerranéenne pour la Protection des Plantes. Verticillium albo-atrum and V.dahliae on hop. EPPO Bull. 2007, 37, 528–535. [Google Scholar]
- Lei, J.; Sun, Y. miR-PREFeR: An accurate, fast and easy-to-use plant miRNA prediction tool using small RNA-Seq data. Bioinformatics 2014, 30, 2837–2839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marton, K.; Flajšman, M.; Radišek, S.; Košmelj, K.; Jakše, J.; Javornik, B.; Berne, S. Comprehensive analysis of Verticillium nonalfalfae in silico secretome uncovers putative effector proteins expressed during hop invasion. PLoS ONE 2018, 13, e0198971. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing. Available online: https://r-project.org/index.html (accessed on 3 November 2020).
- Matz, M.V. Rank-Based Gene Ontology Analysis with Adaptive Clustering. Available online: https://github.com/z0on/GO_MWU (accessed on 13 May 2021).
Sample | No. of All Total Sequenced Reads | No. of Unique Reads | Percent of Unique Reads [%] | No. of All rRNA/tRNA/sn-snoRNA | Percent of rRNA/tRNA/sn-snoRNA [%] |
---|---|---|---|---|---|
Rec_XSM | 9,700,277 | 2,526,947 | 26 | 499,837 | 5.2 |
Rec_CD | 10,360,750 | 2,322,612 | 22 | 542,831 | 5.2 |
Rec_conidia | 12,804,008 | 2,090,161 | 16 | 684,176 | 5.3 |
Rec_resting | 8,359,143 | 1,161,372 | 14 | 258,592 | 3.1 |
T2_XSM | 8,595,353 | 1,510,766 | 18 | 562,534 | 6.5 |
T2_CD | 4,387,811 | 912,222 | 21 | 256,280 | 5.8 |
T2_conidia | 10,468,293 | 1,572,551 | 15 | 665,576 | 6.4 |
T2_resting | 9,055,417 | 683,765 | 8 | 271,404 | 3.0 |
Name | Length [nt] | Sequence (5′-3′) | Precursor Location | Precursor Length [nt] | MFE [kcal mol−1] | In Protein Coding Region? |
---|---|---|---|---|---|---|
vna-miR-1-5p | 23 | AAACGCTGATCTCCAAGTTACCT | Vna.chr3:112750..112859 | 110 | −33.3 | NO |
vna-miR-2-5p | 22 | ACGGGTCCGGATATGCAGCTTG | Vna.chr4:1556903..1556813 | 101 | −44.3 | NO |
vna-miR-3-5p | 18 | TGGCGCTGAGGGTGTCGA | Vna.chr1:2345083..2345190 | 108 | −40.2 | YES |
vna-miR-4-5p | 18 | CGCGCCGCGATGCCGCCG | Vna.chr3:662853..662940 | 88 | −43.8 | YES |
vna-miR-5-3p | 21 | TCAAGCCTGGGGCTCGCTTTG | Vna.chr4:3996299..3996386 | 88 | −41.2 | NO |
vna-miR-6-5p | 18 | GGTCGACCTCTGGGCGCT | Vna.chr4:3834130..3834239 | 110 | −50.6 | NO |
vna-miR-7-3p | 18 | TCCGGGATGAGGAGGAGC | Vna.chr4:933646..933736 | 91 | −40.7 | YES |
mmu-miR-7044-5p (conserved-miR-7044) | 18 | GGTGGTGGTGGTGGCGGC | Vna.chr3:3285001..3285047 | 110 | −61.0 | NO |
vna-miR-8-5p | 20 | TAGGTGGCTCTGAGGCATGG | Vna.chr-un:2863075..2863184 | 110 | −39.8 | NO |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeseničnik, T.; Štajner, N.; Radišek, S.; Mishra, A.K.; Košmelj, K.; Kunej, U.; Jakše, J. Discovery of microRNA-like Small RNAs in Pathogenic Plant Fungus Verticillium nonalfalfae Using High-Throughput Sequencing and qPCR and RLM-RACE Validation. Int. J. Mol. Sci. 2022, 23, 900. https://doi.org/10.3390/ijms23020900
Jeseničnik T, Štajner N, Radišek S, Mishra AK, Košmelj K, Kunej U, Jakše J. Discovery of microRNA-like Small RNAs in Pathogenic Plant Fungus Verticillium nonalfalfae Using High-Throughput Sequencing and qPCR and RLM-RACE Validation. International Journal of Molecular Sciences. 2022; 23(2):900. https://doi.org/10.3390/ijms23020900
Chicago/Turabian StyleJeseničnik, Taja, Nataša Štajner, Sebastjan Radišek, Ajay Kumar Mishra, Katarina Košmelj, Urban Kunej, and Jernej Jakše. 2022. "Discovery of microRNA-like Small RNAs in Pathogenic Plant Fungus Verticillium nonalfalfae Using High-Throughput Sequencing and qPCR and RLM-RACE Validation" International Journal of Molecular Sciences 23, no. 2: 900. https://doi.org/10.3390/ijms23020900
APA StyleJeseničnik, T., Štajner, N., Radišek, S., Mishra, A. K., Košmelj, K., Kunej, U., & Jakše, J. (2022). Discovery of microRNA-like Small RNAs in Pathogenic Plant Fungus Verticillium nonalfalfae Using High-Throughput Sequencing and qPCR and RLM-RACE Validation. International Journal of Molecular Sciences, 23(2), 900. https://doi.org/10.3390/ijms23020900